CN111455106A - Kit for detecting 2019 novel coronavirus nucleic acid - Google Patents
Kit for detecting 2019 novel coronavirus nucleic acid Download PDFInfo
- Publication number
- CN111455106A CN111455106A CN202010286936.0A CN202010286936A CN111455106A CN 111455106 A CN111455106 A CN 111455106A CN 202010286936 A CN202010286936 A CN 202010286936A CN 111455106 A CN111455106 A CN 111455106A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- novel coronavirus
- detecting
- seq
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a kit for detecting 2019 novel coronavirus nucleic acid, which comprises a crRNA-1 for detecting 2019 novel coronavirus nucleic acid or crRNA-2, L bCas12a nuclease for detecting 2019 novel coronavirus nucleic acid, a nucleic acid detection probe, a primer pair and
DNA Amplification kit, water and 1 × NEbufferTM2.1; the kit for detecting the 2019 novel coronavirus nucleic acid can quickly and accurately detect the 2019 novel coronavirus nucleic acid, and has the advantages of good detection specificity, high sensitivity, capability of realizing high-sensitivity detection at room temperature, and convenience and quickness in operation.
Description
Technical Field
The invention belongs to the technical field of molecular biology. More particularly, it relates to a kit for detecting 2019 novel coronavirus (2019-nCoV) nucleic acids.
Background
2019 the novel coronavirus is a newly discovered new strain of coronavirus, can cause novel human coronavirus pneumonia, has the main symptoms of fever, hypodynamia and dry cough, and can rapidly progress to acute respiratory distress syndrome, septic shock, metabolic acidosis which is difficult to correct and blood coagulation dysfunction in severe patients. Currently, clinical diagnosis is mainly based on epidemiology, clinical manifestations, laboratory examinations, etc.
At present, in the detection of 2019 novel coronavirus, the gold standard is still a Real-time fluorescent quantitative PCR (RT-PCR) detection technology, and the sensitivity and the specificity are higher. Real-time fluorescence PCR detection alone, which generally takes about two hours, is used. The whole detection process also comprises the steps of sampling, processing samples and the like, and the total time is usually more than two hours. The method has the main disadvantages that the detection takes long time, and the PCR detection needs to depend on a PCR instrument or an expensive real-time quantitative PCR instrument and other various matched equipment. In the detection of new coronavirus, the RT-PCR method has more false negative results, which affects the judgment, prevention and control of epidemic situation.
Therefore, a highly sensitive kit which does not require expensive instruments, is low in cost, and can rapidly and accurately detect 2019 of the novel coronavirus is needed.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides crRNA-1 for detecting 2019 novel coronavirus nucleic acid.
It is a second object of the present invention to provide crRNA-2 for detecting 2019 novel coronavirus nucleic acids.
It is a third object of the present invention to provide a kit for detecting 2019 novel coronavirus nucleic acids.
The technical scheme of the invention is summarized as follows:
the nucleotide sequence of the crRNA-1 for detecting 2019 novel coronavirus nucleic acid is shown as SEQ ID NO. 1.
The nucleotide sequence of the crRNA-2 for detecting 2019 novel coronavirus nucleic acid is shown as SEQ ID NO. 2.
The kit for detecting the 2019 novel coronavirus nucleic acid comprises a crRNA-1 for detecting the 2019 novel coronavirus nucleic acid or crRNA-2, L bCas12a nuclease for detecting the 2019 novel coronavirus nucleic acid, a nucleic acid detection probe, a primer pair and
DNA Amplification kit, water and 1 × NEbufferTM2.1；
The nucleotide sequence of the nucleic acid detection probe is shown as SEQ ID NO. 3;
the primer pair comprises an upstream primer and a downstream primer;
the upstream primer is a first upstream primer, a second upstream primer, a third upstream primer, a fourth upstream primer or a fifth upstream primer;
the nucleotide sequence of the first upstream primer is shown as SEQ ID NO. 4;
the nucleotide sequence of the second upstream primer is shown as SEQ ID NO. 5;
the nucleotide sequence of the third upstream primer is shown as SEQ ID NO. 6;
the nucleotide sequence of the fourth upstream primer is shown as SEQ ID NO. 7;
the nucleotide sequence of the fifth upstream primer is shown as SEQ ID NO. 8;
the downstream primer is a first downstream primer, a second downstream primer, a third downstream primer, a fourth downstream primer or a fifth downstream primer;
the nucleotide sequence of the first downstream primer is shown as SEQ ID NO. 9;
the nucleotide sequence of the second downstream primer is shown as SEQ ID NO. 10;
the nucleotide sequence of the third downstream primer is shown as SEQ ID NO. 11;
the nucleotide sequence of the fourth downstream primer is shown as SEQ ID NO. 12;
the nucleotide sequence of the fifth downstream primer is shown as SEQ ID NO. 13.
The invention has the advantages that:
the kit for detecting the 2019 novel coronavirus nucleic acid can quickly and accurately detect the 2019 novel coronavirus nucleic acid, and has the advantages of good detection specificity, high sensitivity, capability of realizing high-sensitivity detection at room temperature, and convenience and quickness in operation.
Drawings
FIG. 1 is a graph showing the results of detecting 2019 novel coronavirus nucleic acid mimic samples using two kits of examples 2 and 3, respectively.
Fig. 2 is a graph showing the limit of detection of 2019 novel coronavirus nucleic acid mimic samples using the kit for detecting 2019 novel coronavirus nucleic acid of example 2. (concentration in the figure is 1.8X10-6ng/ul and concentration of 1.8x10-8Coincidence of detection result lines of ng/u)
FIG. 3 is a diagram showing the detection limit results of a nucleic acid mimic sample of a novel coronavirus in a conventional RT-PCR detection 2019.
FIG. 4 is a graph showing the results of detection of 2019 novel coronavirus nucleic acid-mimic sample and other viruses (pseudovirus, EV71, EV-D68, PR8) by using the kit of example 2 of the present invention (the lines of the detection results of the pseudovirus, EV71, EV-D68, PR8 and blank are coincident).
Detailed Description
The present invention will be further illustrated by the following specific examples.
Example 1
Designed to obtain crRNA for detecting 2019 novel coronavirus nucleic acid
Acquiring a genome sequence of 2019-nCoV, and searching a specific identification region of the genome sequence by bioinformatics analysis and alignment.
The specific operation steps are as follows, the complete genome sequence of 2019-nCoV and other coronaviruses (SARS-nCoV, MERS-nCoV, HCoV-OC43, HCoV-HKU1, MHV, HCoV-229E, HCoV-N L63, IBV) is searched in NCBI nucleic acid sequence library to obtain the complete genome sequence, the sequence of 'TTTN' is searched in the 2019-nCoV sequence, and the sequences are used as the alternative database of crRNA targeting sequence.
According to the screening principle, such as GC content, base uniformity, sequence conservation and other parameters of the sequence, a target site recognition sequence with the size of 20-24nt is finally obtained, then a direct repetitive sequence with the size of 20-21nt is added with the obtained target site recognition sequence with the size of 20-24nt to obtain the crRNA for detecting 2019 novel coronavirus nucleic acid, and 2 crRNA-1 and crRNA-2 are obtained in total, wherein the nucleotide sequence of the crRNA-1 is shown in SEQ ID NO.1, and the nucleotide sequence of the crRNA-2 is shown in SEQ ID NO. 2.
Example 2
The kit for detecting 2019 novel coronavirus nucleic acid (first kit) comprises crRNA-1, L bCas12a nuclease (for detecting 2019 novel coronavirus nucleic acid)
L ba Cas12a (Cpf1), Bio L abs), nucleic acid detection probes (nucleotides modified with FAM at the 5 'end and BHQ-1 at the 3' end), fifth upstream primer, fifth downstream primer and
DNA Amplification kit (commercially available), water (DEPC-treated water) and 1 × NEbufferTM2.1(BioLabs)；
The nucleotide sequence of the nucleic acid detection probe is shown as SEQ ID NO. 3;
the nucleotide sequence of the fifth upstream primer is shown as SEQ ID NO. 8;
the nucleotide sequence of the fifth downstream primer is shown as SEQ ID NO. 13.
Example 3
The kit for detecting 2019 novel coronavirus nucleic acid (second type) comprises crRNA-2, L bCas12a nuclease (for detecting 2019 novel coronavirus nucleic acid)
L ba Cas12a (Cpf1), Bio L abs), nucleic acid detection probes (nucleotides modified with FAM at the 5 'end and BHQ-1 at the 3' end), fifth upstream primer, fifth downstream primer and
DNA Amplification kit (commercially available), water (DEPC-treated water) and 1 × NEbufferTM2.1(BioLabs)；
The nucleotide sequence of the nucleic acid detection probe is shown as SEQ ID NO. 3;
the nucleotide sequence of the fifth upstream primer is shown as SEQ ID NO. 8;
the nucleotide sequence of the fifth downstream primer is shown as SEQ ID NO. 13.
Example 4
Use of the kit of example 2:
(1) the fifth forward primer aqueous solution with a concentration of 2.4u L of 10. mu.M, the fifth reverse primer aqueous solution with a concentration of 2.4u L of 10. mu.M, and 4u L of 1.8X10-5Detection of ng/u L (subsequently, when detection of the detection limit was performed, the concentration was diluted in a 10-fold gradient) A mock sample aqueous solution (genome sequence-N protein gene of 2019-nCoV, nucleotide sequence of the genome is shown in SEQ ID NO. 14) was added to 41.2u L
In the DNA Amplification mixing System: (
The DNA Amplification mixing system is
Preparing each component of the kit of DNA Amplification according to the instruction), and amplifying for 20min at 39 ℃;
(2) 1u L L bCas12a nuclease, 3u L1 × NEbufferTM2.1 and 4u L with the concentration of 1 mu M to detect the crRNA-1 aqueous solution of the 2019 novel coronavirus nucleic acid, and incubating for 10min at 25 ℃;
(3) and (3) mixing the amplification product obtained in the step (1) with 20u L and the incubation product obtained in the step (2) with 8u L in a 384-well plate, adding a nucleic acid detection probe with the concentration of 2u L being 1 mu M, placing the reaction system in a multifunctional microplate reader, reacting for 20min at 37 ℃, and taking a fluorescence value for result interpretation.
And (3) judging effective results: after removing background fluorescence of the sample, the sample is defined as positive when the fluorescence value is more than or equal to 3 times of that of the negative control sample, and the sample is defined as negative when the fluorescence value is less than 3 times of that of the negative control sample.
Example 5
Use of the kit of example 3:
(1) the fifth forward primer aqueous solution with a concentration of 2.4u L of 10. mu.M, the fifth reverse primer aqueous solution with a concentration of 2.4u L of 10. mu.M, and 4u L of 1.8X10-5Detection of ng/u L (subsequently, when detection of the detection limit was performed, the concentration was diluted in a 10-fold gradient) A mock sample aqueous solution (genome sequence-N protein gene of 2019-nCoV, nucleotide sequence of the genome is shown in SEQ ID NO. 14) was added to 41.2u L
In the DNA Amplification mixing System: (
The DNA Amplification mixing system is
Preparing each component of the kit of DNA Amplification according to the instruction), and amplifying for 20min at 39 ℃;
(2) 1u L L bCas12a nuclease, 3u L1 × NEbufferTM2.1 and 4u L with the concentration of 1 mu M to detect the crRNA-2 aqueous solution of the 2019 novel coronavirus nucleic acid, and incubating for 10min at 25 ℃;
(3) and (3) mixing the amplification product obtained in the step (1) with 20u L and the incubation product obtained in the step (2) with 8u L in a 384-well plate, adding a nucleic acid detection probe with the concentration of 2u L being 1 mu M, placing the reaction system in a multifunctional microplate reader, reacting for 20min at 37 ℃, and taking a fluorescence value for result interpretation.
And (3) judging effective results: after removing background fluorescence of the sample, the sample is defined as positive when the fluorescence value is more than or equal to 3 times of that of the negative control sample, and the sample is defined as negative when the fluorescence value is less than 3 times of that of the negative control sample.
FIG. 1 is a graph showing the results of detecting 2019 novel coronavirus nucleic acid mimic samples using two kits of examples 2 and 3, respectively. The result shows that the two kits can detect the 2019 novel coronavirus nucleic acid.
FIG. 2 is a 2019 detection of novel coronavirus nucleic acids using the kit of example 2The result shows that the crRNA-1 for detecting 2019 novel coronavirus nucleic acid can activate L bCas12a nuclease, so that the crRNA-1 can recognize a target site cutting probe and generate a fluorescent signal, the crRNA-1 sequence can specifically recognize related pathogen target sequences, and the detection limit is 1.8x10-11ng/uL。
FIG. 3 is a diagram showing the results of detection limits of a conventional RT-PCR detection system, the detection limit of which is 1.8X10-8ng/u L. the results show that the sensitivity of the kit of the invention is far superior to that of the conventional RT-PCR, and the detection time of the kit of the invention is 40min, while the RT-PCR requires at least 2 h.
FIG. 4 is a graph showing the results of detecting 2019 novel coronavirus nucleic acid-mimic samples and other viruses (pseudoviruses, EV71, EV-D68, PR8) using the kit of example 2 of the present invention, and the results show that the kit of example 2 of the present invention can specifically detect 2019 novel coronavirus nucleic acids. The test proves that the test kit of the example 3 detects 2019 the novel coronavirus nucleic acid simulation sample and other viruses (pseudovirus, EV71, EV-D68 and PR8), and the result is similar to the test result of the test kit of the example 2.
The fifth upstream primer and the fifth downstream primer of example 2 were replaced with the first upstream primer and the first downstream primer, the second upstream primer and the second downstream primer, the third upstream primer and the third downstream primer, and the fourth upstream primer and the fourth downstream primer, respectively, and the other examples were the same as example 2, thereby forming the third, fourth, fifth, and sixth kits, respectively. The experiment proves that the 2019 novel coronavirus nucleic acid simulation sample is detected by using the third kit, the fourth kit, the fifth kit and the sixth kit respectively, and the detection result is similar to that of the kit in the example 2.
The real sample detection is to replace the case sample of the patient to be detected with the simulated sample of the embodiment, and the other steps are performed as the same as the embodiment.
Sequence listing
<110> Tianjin university
<120> kit for detecting 2019 novel coronavirus nucleic acid
<160>14
<170>SIPOSequenceListing 1.0
<210>1
<211>45
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
uaauuucuac uaaguguaga ucugcugcuu gacagauuga accag 45
<210>2
<211>41
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
uaauuucuac uaaguguagaucugcugcuu gacagauuga a 41
<210>3
<211>5
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
<210>4
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gcagtagggg aacttctcct gc 22
<210>5
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tagaatggct ggcaatggcg gt 22
<210>6
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gcaatggcgg tgatgctgct ct 22
<210>7
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
aactccaggc agcagtaggg ga 22
<210>8
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
acttctcctg ctagaatggc tg 22
<210>9
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
tgggtttgtt ctggaccacg tc 22
<210>10
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
tggaccacgt ctgccgaaag ct 22
<210>11
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
tgccgaaagc ttgtgttaca tt 22
<210>12
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
tgtgttacat tgtatgcttt ag 22
<210>13
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
caaaatttcc ttgggtttgt tc 22
<210>14
<211>1260
<212>DNA
<213>2019 novel coronavirus (Severe acid respiratory syndrome-related coronavirus SARS-CoV-2)
<400>14
atgcaccccg cattacgttt ggtggaccct cagattcaac tggcagtaac cagaatggag 60
aacgcagtgg ggcgcgatca aaacaacgtc ggccccaagg tttacccaat aatactgcgt 120
cttggttcac cgctctcact caacatggca aggaagacct taaattccct cgaggacaag 180
gcgttccaat taacaccaat agcagtccag atgaccaaat tggctactac cgaagagcta 240
ccagacgaat tcgtggtggt gacggtaaaa tgaaagatct cagtccaaga tggtatttct 300
actacctagg aactgggcca gaagctggac ttccctatgg tgctaacaaa gacggcatca 360
tatgggttgc aactgaggga gccttgaata caccaaaaga tcacattggc acccgcaatc 420
ctgctaacaa tgctgcaatc gtgctacaac ttcctcaagg aacaacattg ccaaaaggct 480
tctacgcaga agggagcaga ggcggcagtc aagcctcttc tcgttcctca tcacgtagtc 540
gcaacagttc aagaaattca actccaggca gcagtagggg aacttctcct gctagaatgg 600
ctggcaatgg cggtgatgct gctcttgctt tgctgctgct tgacagattg aaccagcttg 660
agagcaaaat gtctggtaaa ggccaacaac aacaaggcca aactgtcact aagaaatctg 720
ctgctgaggc ttctaagaag cctcggcaaa aacgtactgc cactaaagca tacaatgtaa 780
cacaagcttt cggcagacgt ggtccagaac aaacccaagg aaattttggg gaccaggaac 840
taatcagaca aggaactgat tacaaacatt ggccgcaaat tgcacaattt gcccccagcg 900
cttcagcgtt cttcggaatg tcgcgcattg gcatggaagt cacaccttcg ggaacgtggt 960
tgacctacac aggtgccatc aaattggatg acaaagatcc aaatttcaaa gatcaagtca 1020
ttttgctgaa taagcatatt gacgcataca aaacattccc accaacagag cctaaaaagg 1080
acaaaaagaa gaaggctgat gaaactcaag ccttaccgca gagacagaag aaacagcaaa 1140
ctgtgactct tcttcctgct gcagatttgg atgatttctc caaacaattg caacaatcca 1200
tgagcagtgc tgactcaact caggcctaaa ctcatgcaga ccacacaagg cagatgggct 1260
Claims (3)
1. The crRNA-1 for detecting 2019 novel coronavirus nucleic acid is characterized by being shown as SEQ ID NO. 1.
2. The crRNA-2 for detecting 2019 novel coronavirus nucleic acid is characterized by being shown as SEQ ID NO. 2.
3. The kit for detecting the 2019 novel coronavirus nucleic acid is characterized by comprising crRNA-1 for detecting the 2019 novel coronavirus nucleic acid or crRNA-2, L bCas12a nuclease for detecting the 2019 novel coronavirus nucleic acid, a nucleic acid detection probe, a primer pair and
DNA Amplification kit, water and 1 × NEbufferTM2.1；
The nucleotide sequence of the nucleic acid detection probe is shown as SEQ ID NO. 3;
the primer pair comprises an upstream primer and a downstream primer;
the upstream primer is a first upstream primer, a second upstream primer, a third upstream primer, a fourth upstream primer or a fifth upstream primer;
the nucleotide sequence of the first upstream primer is shown as SEQ ID NO. 4;
the nucleotide sequence of the second upstream primer is shown as SEQ ID NO. 5;
the nucleotide sequence of the third upstream primer is shown as SEQ ID NO. 6;
the nucleotide sequence of the fourth upstream primer is shown as SEQ ID NO. 7;
the nucleotide sequence of the fifth upstream primer is shown as SEQ ID NO. 8;
the downstream primer is a first downstream primer, a second downstream primer, a third downstream primer, a fourth downstream primer or a fifth downstream primer;
the nucleotide sequence of the first downstream primer is shown as SEQ ID NO. 9;
the nucleotide sequence of the second downstream primer is shown as SEQ ID NO. 10;
the nucleotide sequence of the third downstream primer is shown as SEQ ID NO. 11;
the nucleotide sequence of the fourth downstream primer is shown as SEQ ID NO. 12;
the nucleotide sequence of the fifth downstream primer is shown as SEQ ID NO. 13.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010286936.0A CN111455106B (en) | 2020-04-13 | 2020-04-13 | Kit for detecting 2019 novel coronavirus nucleic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010286936.0A CN111455106B (en) | 2020-04-13 | 2020-04-13 | Kit for detecting 2019 novel coronavirus nucleic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111455106A true CN111455106A (en) | 2020-07-28 |
| CN111455106B CN111455106B (en) | 2020-12-29 |
Family
ID=71676576
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010286936.0A Active CN111455106B (en) | 2020-04-13 | 2020-04-13 | Kit for detecting 2019 novel coronavirus nucleic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111455106B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180371487A1 (en) * | 2017-06-22 | 2018-12-27 | Ut-Battelle, Llc | Genes for enhancing drought and heat tolerance in plants and methods of use |
| WO2019089623A1 (en) * | 2017-10-30 | 2019-05-09 | Children's Hospital Medical Center | Fusion proteins for use in improving gene correction via homologous recombination |
| CN110551846A (en) * | 2019-08-19 | 2019-12-10 | 上海科技大学 | cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof |
-
2020
- 2020-04-13 CN CN202010286936.0A patent/CN111455106B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180371487A1 (en) * | 2017-06-22 | 2018-12-27 | Ut-Battelle, Llc | Genes for enhancing drought and heat tolerance in plants and methods of use |
| WO2019089623A1 (en) * | 2017-10-30 | 2019-05-09 | Children's Hospital Medical Center | Fusion proteins for use in improving gene correction via homologous recombination |
| CN110551846A (en) * | 2019-08-19 | 2019-12-10 | 上海科技大学 | cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof |
Non-Patent Citations (1)
| Title |
|---|
| WORLD HEALTH ORGANIZATION: ""Molecular assays to diagnose COVID-19: Summary table of available protocols"", 《MOLECULAR ASSAYS TO DIAGNOSE COVID-19: SUMMARY TABLE OF AVAILABLE PROTOCOLS》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111455106B (en) | 2020-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111187856B (en) | Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof | |
| CN111235316B (en) | Primer probe for identifying novel coronavirus and application of primer probe in triple fluorescence RPA | |
| CN112094944B (en) | Kit for quantitatively detecting novel coronavirus copy number | |
| CN109777893A (en) | The invisible hepatitis B detection kit of droplet type digital pcr | |
| CN113774169A (en) | 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method | |
| CN112538550B (en) | RT-RPA and CRISPR/Cas-based DHAV-1 and DHAV-3 detection system and application | |
| CN113774168A (en) | 2019 novel coronavirus, Deltay and lambda variant strain typing nucleic acid detection kit and detection method thereof | |
| CN106636454B (en) | Real-time fluorescent multiplex RT-PCR method for simultaneously detecting human coronavirus 229E, OC43, NL63 and HKU1 | |
| Rahman et al. | CRISPR is a useful biological tool for detecting nucleic acid of SARS-CoV-2 in human clinical samples | |
| CN116024208B (en) | Kit capable of simultaneously detecting 26 pig epidemic diseases through single reaction | |
| CN113652505A (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN111378786A (en) | CRISPR-based nucleic acid detection kit and application thereof | |
| CN112813195B (en) | Novel quantitative detection kit for coronavirus nucleic acid based on micro-droplet digital analysis | |
| CN113817872A (en) | 2019 novel coronavirus lambda variant nucleic acid detection reagent, kit and detection method | |
| CN113046483A (en) | Novel real-time fluorescent RT-RAA primer, probe and detection kit for coronavirus | |
| CN111471802A (en) | Porcine delta coronavirus rapid detection primer, kit and application thereof | |
| CN111455106B (en) | Kit for detecting 2019 novel coronavirus nucleic acid | |
| CN111733287B (en) | Kit for detecting pathogenic nucleic acid of fever with thrombocytopenia syndrome | |
| CN114107567A (en) | Virus nucleic acid mutation detection method and application | |
| CN114438259B (en) | SGLV and YEZV dual fluorescent quantitative RT-PCR nucleic acid group, kit and method for synchronous detection | |
| CN111500768B (en) | Primer probe for identifying novel coronavirus and application of primer probe in dual-digital PCR | |
| CN112553378B (en) | Reagent and kit for detecting 2019-nCoV and application | |
| CN116515840B (en) | Kit and detection method for detecting bovine viral diarrhea virus type 3 | |
| CN115786582A (en) | Method and kit for detecting monkeypox virus by combining CRISPR/Cas12a and RPA and preparation method thereof | |
| CN115807125A (en) | Fluorescence detection kit for detecting epidemic hemorrhagic fever |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder | ||
| CP02 | Change in the address of a patent holder |
Address after: 300452 Binhai Industrial Research Institute Campus of Tianjin University, No. 48 Jialingjiang Road, Binhai New Area, Tianjin Patentee after: Tianjin University Address before: 300072 Tianjin City, Nankai District Wei Jin Road No. 92 Patentee before: Tianjin University |