CN111041127A - HSV1 virus detection primer and kit thereof - Google Patents
HSV1 virus detection primer and kit thereof Download PDFInfo
- Publication number
- CN111041127A CN111041127A CN202010026788.9A CN202010026788A CN111041127A CN 111041127 A CN111041127 A CN 111041127A CN 202010026788 A CN202010026788 A CN 202010026788A CN 111041127 A CN111041127 A CN 111041127A
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- hsv1
- amplification
- hsv1 virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention provides a detection primer of HSV1 virus, which belongs to the technical field of gene detection, and comprises a forward primer, a reverse primer and an MGB probe primer for amplifying HSV1 virus genes, wherein the HSV1 virus is detected by adopting a digital PCR technology, and the designed primer and MGB probe can be expanded and applied to other digital PCR systems; the kit can detect the nucleic acid sample of the HSV1 virus with low concentration, has high specificity and sensitivity and high primer amplification efficiency, greatly improves the detection rate of the HSV1 virus, and provides a reliable method for clinically detecting the HSV1 virus.
Description
Technical Field
The invention relates to the technical field of gene detection, in particular to primers and a kit for detecting human HSV1 virus by digital PCR.
Background
Herpes Simplex Virus (HSV) is a member of the family herpesviridae.A double-stranded DNA virus with an envelope, about 100 or more, which is classified into α, β and gamma three subfamilies of herpesviridae according to its biological properties.human herpesviridae has been found to be 8 in number, and herpesviridae is transmitted mainly by contact and invades tissues of ectodermal origin (including skin, mucous membrane and nervous tissue). HSV has two subtypes, HSV-1 and HSV-2, with a nucleic acid sequence homology of up to 50% for both types, but with a different infection pattern from clinical manifestations. HSV-1 is a subfamily of herpesviridae α, consists of 152261bp, encodes about 70 proteins, and not only causes primary infection, but also causes latent infection and recurrence.
Currently, Quantitative fluorescence time polymerase chain reaction (QPCR) is a comparatively many technical means used for detecting and quantifying HSV1 virus, and the technique is to add a fluorescence-labeled probe (such as TaqMan) into a PCR reaction system, monitor the whole amplification process by using a fluorescence signal accumulated in real time, and finally perform Quantitative analysis on an unknown template by a standard curve, thereby evaluating the amplification effect of PCR. Fluorescent quantitative PCR is a relatively quantitative method, which relies mainly on a standard curve prepared from a calibrator to determine the concentration of an unknown sample. There are numerous disadvantages to this technique: 1. the difference in background between the calibrator and the sample is liable to affect the efficiency and measurement response of PCR; 2. low copy number of the target DNA molecule cannot be detected by amplification; 3. the PCR amplification efficiency of the sample may be different from the amplification efficiency of the calibrator; impurities introduced into the DNA solution during DNA extraction or DNA degradation affect the PCR dynamic amplification process. Therefore, the detection and absolute quantification of the HSV1 virus with low copy number are difficult to achieve by fluorescent quantitative PCR.
Digital polymerase chain reaction (dPCR) is an absolute quantification technique for single molecule target DNA. The technology is that a PCR solution containing a DNA template is diluted and then distributed to a large number of independent reaction chambers (such as chips), liquid molecules follow Poisson distribution, single molecules are separated by dilution, and PCR amplification is carried out independently, the distribution of the sample can greatly reduce the influence of background signals, improve the amplification sensitivity of low-abundance targets, finally each amplification product is analyzed, and the original copy number of the DNA template is calculated by a Poisson probability distribution formula without adopting a reference standard substance or an external standard substance. Accurate quantification relies on 40-45 cycles of amplification, with very low levels of false negative detection (single DNA template present in the reaction chamber and undetected). The method has the advantages of convenient operation, high detection flux, strong specificity, high sensitivity, accurate quantification and the like.
As a new DNA quantification technology, the digital PCR overcomes a series of defects of real-time fluorescence quantitative PCR and realizes the absolute quantification of the monomolecular DNA. The problems that the standard curve used by the fluorescent quantitative PCR affects the measurement result and the like are avoided. The technology can replace fluorescent quantitative PCR to be applied to quantitative detection of HSV1 virus.
Disclosure of Invention
Based on the technical problems, the invention provides a group of PCR primers and MGB probes with strong specificity and high amplification efficiency, and a high-sensitivity digital PCR technology is combined to achieve the purpose of detecting and absolutely quantifying the low copy value HSV1 virus.
The MGB probe is designed with non-fluorescent quenching group based on common probe, and has lowered background signal strength. Meanwhile, the MGB group has high affinity to the DNA double-chain minor groove, the specificity and the signal to noise ratio of the detection are improved, and the detection cost is reduced. In the present invention, the Tm value of the MGB probe is uniformly designed to be 70 ℃ specifically, and the PCR amplification primers are uniformly designed to be 60 ℃ specifically, so that the MGB probe can be specifically bound to the PCR amplification product sequence. In the PCR amplification process, the MGB probe is hydrolyzed by utilizing the 5 '-3' exonuclease characteristic of Taq enzyme to generate a fluorescent signal.
The invention provides a detection primer of HSV1 virus, which comprises a forward primer, a reverse primer and an MGB probe primer of HSV1 virus.
Preferably, the forward primer and the reverse primer correspond to bases of HSV1 virus genes 137686-: 001 and SEQ ID No.: 2, respectively.
The MGB probe primer is positioned at 137711 and 137728 bases of HSV1 virus genes, and the sequence of the MGB probe primer is shown as SEQ ID No.: 3, respectively. The primer amplification gene sequence is located at 137686-137757 bases of HSV1 virus gene, and the size of the amplification fragment is 72 bases, such as SEQ ID No.: 4, respectively.
In the HSV1 virus detection primer, the HSV1 virus sequence is selected from the HSV1 virus genes 137686-137705 and 137740-137757 bases in a PubMed database, and the sequence is as shown in SEQ ID No.: 1 and SEQ ID No.: 002. The 3 'end of the primer has no continuous G or C base aggregation, and the 3' end has no self-complementary overlapping sequence, so that the generation of hairpin structures and primer dimers can be avoided.
In the HSV1 virus detection primers, the forward primer and the reverse primer are as set forth in SEQ ID No.: 1 and SEQ ID No.: 2, respectively.
HSV1-F Forward: GCTATCCGGAGAAACAGCAC (SEQ ID NO:1)
HSV1-R reverses: CAGATGCCAGACTGCGCG (SEQ ID NO:2)
The MGB probe primer sequence is shown in SEQ ID No.: 3, respectively.
HSV1 probe: VIC-TTGGCGTTCTGTGTGTCG-MGB (SEQ ID NO:3)
The sequence of the amplification region is shown as SEQ ID No.: 4, respectively.
Primer amplification sequence:
GCTATCCGGAGAAACAGCACACGACTTGGCGTTCTGTGTGTCGCGATGTCTCTGCGCGCAGTCTGGCATCTG(SEQ ID NO.:4)
the designed MGB probe primer is modified at the 5' end by using VIC fluorescent dye and is shown as SEQ ID No.: 3, the fluorescence signal is strong, and the detection efficiency is highest.
In the HSV1 virus detection primer, the use method of the detection primer comprises the following steps:
1) extracting sample DNA;
2) using SEQ ID No.: 1-3, and amplifying the DNA sample in the step 1) by using a chip PCR (polymerase chain reaction) amplifier to obtain an amplification product of HSV1 virus;
3) scanning and analyzing the amplification product in the step 2) by using a biochip reader to obtain a copy value of the amplification product.
The invention also provides a kit for detecting the human HSV1 virus, and the kit comprises the detection primer.
Further, the detection kit comprises a sample DNA extraction reagent, 70% ethanol, isopropanol, a detection system PCR reaction solution, a positive control and a negative control;
wherein the PCR reaction solution of the detection system comprises: 1 pair of amplification primers and 1 MGB probe primer, and the sequence is shown as SEQ ID No.: 1-3.
Preferably, the detection system PCR reaction solution further comprises: PCR Buffer and DNA Buffer, such as commercial 2XMultiplex PCR Plus Buffer; dNTP Mix; HotStar Taq Plus DNA Polymerase.
The invention designs forward and reverse primers and MGB probe primers for detecting HSV1 virus, and the forward and reverse primers and the MGB probe primers can be simultaneously used for fluorescent quantitative PCR and digital PCR amplification reactions. The amplification efficiency of the PCR primer is higher than that of other primers through fluorescent quantitative PCR amplification comparison. The absolute copy value of HSV1 can be accurately detected by performing digital PCR detection on the plasmid standard substance and the submission sample. The amplification efficiency can be optimized by adjusting the reaction conditions such as the concentration of forward and reverse primers and MGB probes, the annealing temperature, and the like.
The invention has the following beneficial effects: the designed forward and reverse amplification primers of the HSV1 virus can efficiently amplify a target gene, have high specificity and accuracy, and have higher amplification efficiency than other amplification primers; the method for amplifying the target gene by adopting the digital PCR method has the advantages of high sensitivity, absolute quantification and the like. The detection efficiency of the HSV1 virus is greatly improved, and a reliable method is provided for clinically detecting the HSV1 virus.
Description of the drawings:
FIG. 1 is a sequence of SEQ ID No.: 1-3 and a fluorescence quantitative PCR amplification effect chart reported in the literature;
FIG. 2 is a sequence of SEQ ID No.: 1-3 and other primers.
Detailed Description
The following preferred embodiments are merely illustrative of the technical solutions of the present invention and are not restrictive, and although the present invention has been described in detail with reference to the following preferred embodiments, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the present invention as defined by the appended claims.
Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings. It should be noted that the embodiments and features of the embodiments in the present application may be arbitrarily combined with each other without conflict.
Example 1
Primer sequence for detecting HSV1 virus amplification
Comprising SEQ ID No.: 1-3, forward and reverse primers for amplifying HSV1 virus and MGB probe primer.
The forward and reverse primers designed by the present invention have random base distribution, no continuous G or C base aggregation at the 3 'end of the primer, no self-complementary overlapping sequence at the 3' end, and can avoid generation of hairpin structure and primer dimer, and the related literature (Kessler H, M ü hlbauer G, Rinner B, et al.Detection of peptides simple virus DNA by real-time PCR [ J ]. Journal of clinical microbiology,2000,38(7):2638 and 2642.) reports that the primers are easy to generate self-complementarity as shown in SEQ ID No. 5-7, and the number of bases of the probe primers is too large, the GC content is too high, and is over 70%, which is not beneficial to PCR amplification.
The literature reports forward primers: CATCACCGACCCGGAGAGGGAC (SEQ ID NO. 5)
The literature reports reverse primers: GGGCCAGGCGCTTGTTGGTGTA (SEQ ID NO. 6)
The literature reports that probes: CCGCCGAACTGAGCAGACACCCGCGC (SEQ ID NO. 7)
Other primers and probes are simultaneously designed in the invention, and the sequence of the primer probe is shown as SEQ ID No.: 8-10 of
Other forward primers: ACGGACGTCTGAGCCAGGCC (SEQ ID NO. 8)
Other reverse primers: CCCAAAAGCCCCAGATGCC (SEQ ID NO. 9)
Other probes: CCGGAGAAACAGCACACG (SEQ ID NO. 10)
In the detection, the forward and reverse primers and MGB probe primers described in the above claims are compared with primer probes and other primer probes of related documents, HSV1 virus gene (Shanghai bioengineering GmbH) is artificially synthesized as a template, and simultaneously, fluorescence quantitative PCR amplification is carried out to obtain an amplification curve graph (figures 1 and 2), and the amplification efficiency of the primers described in the above claims is obviously better than that of the primers in the documents and other primers. In this experiment, the GAPDH gene was used as an internal reference gene, and the amplification effect was good, and the primer sequence was described in detail in reference literature (PMID: 17229868).
Example 2
HSV1 virus detection kit for testing based on digital PCR technology
The method comprises the following steps: tissue DNA extraction kit (Kajie's extraction kit, cat # 158467); 70% ethanol; isopropyl alcohol; chip kit (chip kit provided by Hangzhou navigation gene company, cat # V1); a detection system PCR reaction solution, a positive control substance and a negative control substance. Wherein the PCR reaction solution of the detection system comprises: 2x Multiplex PCR Plus Buffer; dNTP Mix; HotStar Taq Plus DNA Polymerase; SEQ ID No.: 1-3, forward and reverse primers for amplifying HSV1 virus and MGB probe primers. Herein 2 × Multiplex PCR Plus Buffer, dNTP Mix; HotStarTaq Plus DNA Polymerase and ROX dye are all commercial conventional reagents, corresponding brands can be directly searched, and experimenters can carry out corresponding commercial adjustment according to self requirements or carry out self-preparation and adjustment of components according to prescriptions.
Example 3
Method for detecting HSV1 virus based on digital PCR technology
(1) Extraction of genomic DNA in whole blood samples:
1) extracting 600 μ L blood, adding 900 μ L erythrocyte lysate, mixing for 10 times, standing at room temperature for 1min, mixing for several times, centrifuging at 16000Xg for 1min, sucking off, and standing to obtain leukocyte precipitate, adding 600 μ L cell lysate, and shaking for 10s to completely suspend and mix leukocytes.
2) Add 18. mu.l proteinase K solution, mix well, and incubate for 2h at 58.
3) Adding 200 μ l protein precipitation solution, shaking at high speed, and mixing for 20 s.
4)16000Xg for 1min, leave the supernatant and discard the pellet.
5) The supernatant of the previous step was put into a 1.5ml centrifuge tube previously filled with 600. mu.l of isopropanol, and mixed by gently inverting it up and down 50 times, at which time, flocculent DNA was observed to precipitate.
6)16000Xg centrifugation for 1min, this time DNA all precipitation to the tube bottom to form a small white dot.
7) The residual liquid in the tube was blotted dry with a clean absorbent paper, taking care that the DNA pellet could not be blotted away.
8) Add 70% ethanol and upside down several times to wash the DNA precipitate.
9)16000Xg centrifugation for 1min, abandon the supernatant, use the clean absorbent paper will be the tube of residual liquid will be sucked dry, pay attention to not be able to suck DNA precipitation.
10) Standing in a superclean bench for 5min, and drying.
11) Add 10. mu.l of DNA lysis solution and shake at high speed for 5 seconds.
12) After incubation for 5min at 65, the DNA was dissolved thoroughly by standing overnight at room temperature.
(2) Reagent preparation:
the detection system PCR reaction solution is prepared as follows:
| name of reagent | Dosage of |
| 2X Multiplex PCR Master Mix | 12.5μl |
| Forward primer (6. mu.M) | 2.5μl |
| Reverse primer (6. mu.M) | 2.5μl |
| MGB probe primer (3. mu.M) | 2.5μl |
| ROX dye(12.5μM) | 1.0μl |
| Sample DNA template | 4.0μl |
| Total of | 25.0μl |
Wherein, the base sequences of the forward and reverse amplification primers and the MGB probe primer are shown as SEQ ID No.: 1-3.
Preparing PCR reaction liquid X mu l according to the number of detected people, and subpackaging 21 mu l of each part:
x ═ 21. mu.l of reaction X (n specimens +1 part of positive control +1 part of negative control)
And n is the number of detected samples.
(3) Sample adding: adding 4 mul of the blood genome DNA solution obtained in the step (1) into a PCR reaction solution of a detection system; for positive control experiments, 4 mul of positive control substance is directly added; for the negative control experiment, 4. mu.l ddH2O was added directly.
(4) Loading a chip: and (4) sucking 15 mu l of the PCR reaction solution prepared in the step (3) by using a pipette gun, uniformly coating the PCR reaction solution on a chip by using a sample loading brush, adding glycerol, covering a cover plate, and sealing the chip.
(5) Digital PCR amplification: the amplification is carried out on a chip-specific PCR instrument, and available instruments include iThermal 1.0PCR instrument (Hangzhou navigation Gene technology Co., Ltd.) and the like. The reaction conditions were as follows: 95 Pre-denaturation for 5min and 30 sec; 40 cycles of 9530 seconds, 5590 seconds, 7230 seconds; and 4, storing.
(6) Fluorescence scanning and image analysis:
and (3) placing the chip subjected to amplification in the step (5) in a biochip reader for fluorescence scanning photographing and data analysis, and calculating the absolute value of HSV1 virus molecules in the sample after the analysis is finished.
Example 4
The HSV1 virus detection kit based on the digital PCR technology is adopted to detect clinical specimens.
11 samples of anticoagulated blood are taken, wherein 6 positive samples and 5 negative samples are clinically confirmed. The 11 samples were subjected to genomic DNA extraction, reagent preparation and detection as described in example 3. Each sample is added into 4 mul of PCR reaction solution of the detection system, and positive and negative controls are performed at the same time. Each sample was repeated 2 times. The detection result of the digital PCR primer shows 6 positive cases, the detection copy value range is 53-49805 copies/ml, 5 negative cases are consistent with the diagnosis result, and the accuracy rate is 100%. The result of primer detection is reported in literature to show 3 positive cases and 8 negative cases, and the accuracy rate is 72.7%. The detection results of other primers show that the primer is positive for 2 cases and negative for 9 cases, and the accuracy is 63.6 percent. The detection result of the digital PCR primer is obviously higher than that of a primer and other primers reported in the literature.
The test results are shown in the following table 1:
the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Shanghai Runda Rongjia Biotech Co., Ltd
<120> detection primer of HSV1 virus and kit thereof
<141>2019-12-18
<160>10
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA/RNA
<213>Artificial Sequence
<400>1
<210>2
<211>18
<212>DNA/RNA
<213>Artificial Sequence
<400>2
<210>3
<211>18
<212>DNA/RNA
<213>Artificial Sequence
<400>3
<210>4
<211>72
<212>DNA/RNA
<213>Artificial Sequence
<400>4
gctatccgga gaaacagcac acgacttggc gttctgtgtg tcgcgatgtc tctgcgcgca 60
gtctggcatc tg 72
<210>5
<211>22
<212>DNA/RNA
<213>Artificial Sequence
<400>5
catcaccgac ccggagaggg ac 22
<210>6
<211>22
<212>DNA/RNA
<213>Artificial Sequence
<400>6
gggccaggcg cttgttggtg ta 22
<210>7
<211>26
<212>DNA/RNA
<213>Artificial Sequence
<400>7
ccgccgaact gagcagacac ccgcgc 26
<210>8
<211>20
<212>DNA/RNA
<213>Artificial Sequence
<400>8
<210>9
<211>19
<212>DNA/RNA
<213>Artificial Sequence
<400>9
cccaaaagcc ccagatgcc 19
<210>10
<211>18
<212>DNA/RNA
<213>Artificial Sequence
<400>10
Claims (9)
1. The primer for detecting the HSV1 is characterized by comprising a forward primer, a reverse primer and an amplification MGB probe primer of the HSV1 virus.
2. The detection primer as claimed in claim, wherein the HSV1 primer sequence corresponds to the bases 137686-.
3. The primer for detecting HSV1 virus of claim 1, wherein the amplification MGB probe primer corresponds to the bases 137711 and 137728 of the HSV1 virus genes.
4. The detection primer of claim 1, wherein the sequences of the forward primer and the reverse primer are as set forth in SEQ id No.: 1 and SEQ ID No.: 2, and the MGB probe primer sequence is shown as SEQ ID No.: 3, respectively.
5. The detection primer according to claim 1, wherein the detection primer is used by a method comprising:
1) extracting sample DNA;
2) using SEQ ID No.: 1-3, and amplifying the DNA sample in the step 1) by using a chip PCR (polymerase chain reaction) amplifier to obtain an amplification product of HSV1 virus;
3) scanning and analyzing the amplification product in the step 2) by using a biochip reader to obtain a copy value of the amplification product.
6. A kit for detecting human HSV1 virus, wherein the kit comprises the detection primer of any one of claims 1-5.
7. The kit of human HSV1 of claim 6, wherein the assay kit comprises a sample DNA extraction reagent, 70% ethanol, isopropanol, a detection system PCR reaction solution, a positive control, a negative control;
wherein the PCR reaction solution of the detection system comprises:
a forward amplification primer, a reverse amplification primer and a MGB probe amplification primer, wherein the sequences are shown as SEQ ID No.: 1-3.
8. The kit according to claim 6, wherein the detection system PCR reaction solution further comprises: PCR buffer and DNA polymerase.
9. Use of the HSV1 virus detection primer of claim 1 in the preparation of an HSV1 virus detection kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010026788.9A CN111041127A (en) | 2020-01-10 | 2020-01-10 | HSV1 virus detection primer and kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010026788.9A CN111041127A (en) | 2020-01-10 | 2020-01-10 | HSV1 virus detection primer and kit thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111041127A true CN111041127A (en) | 2020-04-21 |
Family
ID=70244446
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010026788.9A Withdrawn CN111041127A (en) | 2020-01-10 | 2020-01-10 | HSV1 virus detection primer and kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111041127A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500788A (en) * | 2020-05-29 | 2020-08-07 | 领航基因科技（杭州）有限公司 | Kit for detecting human herpesvirus infection and detection method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109072305A (en) * | 2016-04-25 | 2018-12-21 | 基因矩阵公司 | Utilize the target nucleic acid sequence detection method and combinations thereof of the complementary label segment of cutting |
| CN109536643A (en) * | 2019-01-09 | 2019-03-29 | 中生方政生物技术股份有限公司 | Herpes simplex virus I-type detects marker, primed probe to, kit and detection method |
-
2020
- 2020-01-10 CN CN202010026788.9A patent/CN111041127A/en not_active Withdrawn
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109072305A (en) * | 2016-04-25 | 2018-12-21 | 基因矩阵公司 | Utilize the target nucleic acid sequence detection method and combinations thereof of the complementary label segment of cutting |
| CN109536643A (en) * | 2019-01-09 | 2019-03-29 | 中生方政生物技术股份有限公司 | Herpes simplex virus I-type detects marker, primed probe to, kit and detection method |
Non-Patent Citations (3)
| Title |
|---|
| ACHIM K MOESTA等: "Local Delivery of OncoVEXmGM-CSF Generates Systemic AntitumorImmuneResponses Enhanced by Cytotoxic T-Lymphocyte–Associated Protein Blockade", 《CLINICAL CANCER RESEARCH》 * |
| FINN FILÉN等: "Duplex real-time polymerase chain reaction assay for detection and quantification of herpes simplex virus type 1 and herpes simplex virus type 2 in genital and cutaneous lesions", 《SEXUALLY TRANSMITTED DISEASES》 * |
| 李伟等: "《分子诊断学》", 30 September 2015, 中国医药科技出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111500788A (en) * | 2020-05-29 | 2020-08-07 | 领航基因科技（杭州）有限公司 | Kit for detecting human herpesvirus infection and detection method thereof |
| CN111500788B (en) * | 2020-05-29 | 2023-11-07 | 领航医学科技(深圳)有限公司 | Kit for detecting human herpesvirus infection and detection method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112410472B (en) | Primer probe combination for detecting mycoplasma pneumoniae, chlamydia pneumoniae and adenovirus and detection kit | |
| CN108676920A (en) | It is a kind of quickly to detect mouse norovirus primer, kit and its RT-RPA methods | |
| CN111088401A (en) | Multi-virus detection primer and kit thereof | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| Testoni et al. | A new method of" in-cell reverse transcriptase-polymerase chain reaction" for the detection of BCR/ABL transcript in chronic myeloid leukemia patients | |
| CN110564895A (en) | RAA constant-temperature fluorescence detection primer probe set, kit and method for feline herpesvirus FHV-1 | |
| CN111926116A (en) | Primer and probe for rapidly and quantitatively detecting duck adenovirus type 4, detection method and application thereof | |
| CN111218502B (en) | Composition for improving qPCR detection performance, reaction solution, application and method | |
| CN113774169A (en) | 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN114891902A (en) | Primer-probe combination for rapidly detecting five virulent pathogenic bacteria based on liquid drop digital PCR and application method thereof | |
| CN108315478A (en) | The probe and kit of RAA Fluorometric assay hydrophobins | |
| CN112831597A (en) | Real-time fluorescent PCR amplification primer pair and probe primer for gene identification and detection of African swine fever virus and prepared kit | |
| CN112680541B (en) | LNA-Taqman-multiplex fluorescence PCR technology and application thereof in rapid detection of candida | |
| CN113817872A (en) | 2019 novel coronavirus lambda variant nucleic acid detection reagent, kit and detection method | |
| CN111041127A (en) | HSV1 virus detection primer and kit thereof | |
| CN111926110B (en) | African swine fever virus real-time fluorescent PCR amplification primer pair, probe primer and prepared kit | |
| CN105779644A (en) | Realtime fluorescent nucleic acid constant temperature amplification detection kit of human cytomegalovirus (HCMV) | |
| CN110564882A (en) | Dual TaqMAN probe fluorescent quantitative PCR detection method for equine piroplasmosis | |
| WO1996024044A1 (en) | Method of assaying specimen substance by controlling dose of chemiluminescence | |
| CN111455094B (en) | Composition, kit, application and method for detecting deep infection fungi | |
| CN112501321B (en) | Method for molecular typing of mycobacterium tuberculosis | |
| CN113151496A (en) | Primer, probe, kit and method for visual rapid detection of schistosoma mansoni nucleic acid by LFD-RPA | |
| CN113502341A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for treponema pallidum 16s RNA, and special primer and probe thereof | |
| CN111074003A (en) | VZ virus detection primer and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20200421 |