CN111812172B - Electrode for proportional electrochemical biosensor and preparation method and application thereof - Google Patents

Electrode for proportional electrochemical biosensor and preparation method and application thereof Download PDF

Info

Publication number
CN111812172B
CN111812172B CN202010684868.3A CN202010684868A CN111812172B CN 111812172 B CN111812172 B CN 111812172B CN 202010684868 A CN202010684868 A CN 202010684868A CN 111812172 B CN111812172 B CN 111812172B
Authority
CN
China
Prior art keywords
electrode
solution
dspe
peg
cneu5gc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010684868.3A
Other languages
Chinese (zh)
Other versions
CN111812172A (en
Inventor
张娟
李根喜
苏丽虹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Shanghai for Science and Technology
Original Assignee
University of Shanghai for Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Shanghai for Science and Technology filed Critical University of Shanghai for Science and Technology
Priority to CN202010684868.3A priority Critical patent/CN111812172B/en
Publication of CN111812172A publication Critical patent/CN111812172A/en
Application granted granted Critical
Publication of CN111812172B publication Critical patent/CN111812172B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G65/00—Macromolecular compounds obtained by reactions forming an ether link in the main chain of the macromolecule
    • C08G65/02—Macromolecular compounds obtained by reactions forming an ether link in the main chain of the macromolecule from cyclic ethers by opening of the heterocyclic ring
    • C08G65/32—Polymers modified by chemical after-treatment
    • C08G65/329—Polymers modified by chemical after-treatment with organic compounds
    • C08G65/331—Polymers modified by chemical after-treatment with organic compounds containing oxygen
    • C08G65/332—Polymers modified by chemical after-treatment with organic compounds containing oxygen containing carboxyl groups, or halides, or esters thereof
    • C08G65/3328—Polymers modified by chemical after-treatment with organic compounds containing oxygen containing carboxyl groups, or halides, or esters thereof heterocyclic
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Electrochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Organic Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The invention discloses a proportional electrochemical biosensor electrode for detecting binding state N-glycolylneuraminic acid and a preparation method thereof. The proportional electrochemical biosensor adopts a three-electrode electrochemical system and comprises a working electrode, a reference electrode and a counter electrode; the working electrode comprises a substrate electrode and a modification layer formed on the surface of the substrate electrode, wherein the modification layer is a boric acid aptamer compound. The method is simple and rapid, has good repeatability and stability and high sensitivity, and can be used for linearly detecting the binding state N-glycolylneuraminic acid within the range of 2.186-360.396 ng/mL; the specificity is strong, the N-glycolylneuraminic acid in the binding state can be effectively distinguished from other saccharide derivatives in an actual sample, and good accuracy and practicability are shown.

Description

Electrode for proportional electrochemical biosensor and preparation method and application thereof
Technical Field
The invention belongs to the technical field of electroanalytical chemistry and electrochemical sensors, and particularly relates to a proportional electrochemical biosensor for detecting binding state N-glycolylneuraminic acid and a preparation method thereof.
Background
The N-Glycolylneuraminic Acid (Neu 5 Gc) contained in the animal food is formed by taking N-Acetylneuraminic Acid (Neu 5 Ac) as a precursor and catalyzing acetyl on the carbon 5 of CMP-Neu5Ac through CMP-Neu5Ac hydroxylase to hydroxylate. Neu5Gc is an animal product hazard factor, particularly red meat and milk and products thereof are rich in Neu5Gc, and it has been determined that dietary intake of Neu5Gc is a risk factor for long-term adverse health effects. Neu5Gc is present in glycoconjugates in most hind-mouth animals, but Neu5Gc is virtually absent in normal human tissues, and dietary absorption is the only possible route for exogenous Neu5Gc to enter human tissues. Unlike free Neu5Gc, which can be excreted in vitro through urine, the conjugated state N-glycolylneuraminic acid conjugate (CNeu 5 Gc), which exists mainly as a glycoconjugate, can be metabolically conjugated into tissues and is abnormally expressed in human cells, resulting in the development of various cancers, and it has been found that CNeu5Gc is observed at high levels in diseases such as human ovary, breast cancer, colon cancer, lung cancer and prostate cancer.
At present, the methods for detecting CNeu5Gc mainly include the following methods: high performance liquid chromatography, high performance liquid chromatography and liquid chromatography-mass spectrometry, capillary electrophoresis, immunoblotting, immunohistochemistry, flow cytometry, enzyme-linked immunosorbent assay and the like. The general liquid phase method firstly measures the content of the Neu5Gc in the animal food and the content of the Neu5Gc in the free state, and then calculates the difference between the two to obtain the content of the Neu5Gc in the combined state. The method has complex pretreatment, needs hydrolysis and derivatization of samples, has expensive instruments, complex equipment operation and large workload, and is difficult to be used for real-time mass detection and analysis of CNeu5Gc. Antibodies are mostly adopted as recognition units of Neu5Gc in biological methods such as immunization, the biological methods have strong specificity, but the various CNeu5Gc in animal food cannot be recognized in the detection process, and the methods cannot meet the requirement of daily rapid analysis.
Therefore, the establishment of a new simple, economic, sensitive, rapid, accurate and efficient CNeu5Gc analysis method is a problem to be solved urgently. Electrochemical analysis methods have become a popular detection technique due to their high sensitivity, rapid response, and simple operation. The boronic acid aptamer complex serves as a capture element of CNeu5Gc to construct an effective biosensor, and the pH-assisted self-assembled lipid bilayer can realize signal change by hindering electron transfer from a solution to an electrode surface through its insulating property. The CNeu5Gc in the animal food is detected by the technical means of the method, and a novel electrochemical method is provided for detecting the CNeu5Gc.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a proportional electrochemical biosensor for detecting binding state N-glycolylneuraminic acid and a preparation method thereof. An electrode interface modified with a boronic acid aptamer chain and capable of detecting CNeu5Gc is constructed by using a pH-mediated self-assembled lipid bilayer. CNeu5Gc can be captured by a boric acid part on an aptamer chain under an acidic pH condition, falls off under an alkaline condition and is recognized by the aptamer, the vacant boric acid part can be combined with a mixed phospholipid polyethylene glycol active ester derivative (DSPE-PEG-Gal) to form a lipid bilayer on the surface of an electrode through self-assembly, and a CHI660C electrochemical workstation is used as a detection means, so that high-sensitivity and high-specificity analysis and detection of CNeu5Gc are realized.
A first object of the present invention is to provide an electrode for a proportional electrochemical biosensor, comprising: the electrode comprises a substrate electrode and a modification layer formed on the surface of the substrate electrode, wherein the modification layer is a boric acid aptamer compound shown in a formula III;
Figure BDA0002587169710000021
wherein R is 1 is-SH, -COOH or-NH 2 ；
Figure BDA0002587169710000022
Which represents a DNA1 having a sequence represented by,
the sequence of DNA1 is:
AAAAAAAAAATGGTCATGCCGTACGGTGTACCCCCGGGTGTACGCGGTGTACGGCTACTTTCTCTGCGTGCTGAGGGTGATCGTTTTCGCAAAAAAAA。
further, the substrate electrode is a gold electrode or a glassy carbon electrode.
Further, when the substrate electrode is a gold electrode, the surface of the gold electrode is modified by the boric acid aptamer compound shown in formula III to obtain the boric acid aptamer compound/gold electrode, and the specific structure is shown in formula VIII:
Figure BDA0002587169710000031
further, when the substrate electrode is a glassy carbon electrode, the surface of the glassy carbon electrode is modified by the boric acid aptamer compound shown in formula III to obtain the boric acid aptamer compound/glassy carbon electrode, and the specific structure is shown in formula IX:
Figure BDA0002587169710000032
wherein R is 2 is-COOH or-NH 2 。
A second object of the present invention is to provide a method for preparing the electrode, including:
s1: pretreating the substrate electrode, polishing the substrate electrode by using abrasive paper, polishing the substrate electrode by using aluminum powder, and then sequentially performing ultrasonic treatment, purification and activation treatment to obtain the pretreated substrate electrode;
s2: modifying the compound shown in the formula (III) on the surface of the pretreated substrate electrode for 1-3 h to prepare a boric acid aptamer compound electrode; wherein the reaction system is 100 μ L of a boric acid aptamer complex solution containing 10mM PBS, 10mM TECP and 2 μ M in the reaction system, the pH is =7.4, and the temperature is 37 ℃.
Further, the step S1 includes the following steps:
polishing the substrate electrode by using sand paper, polishing by using aluminum powder with the particle sizes of 1.0 mu m, 0.3 mu m and 0.05 mu m, then respectively carrying out ultrasonic treatment on the polished substrate electrode in absolute ethyl alcohol and ultrapure water for 5min, and then using prepared tiger fish, namely concentrated sulfuric acid: hydrogen peroxide =1, and 50 μ L of the mixture is dropped on each electrode surface to purify the substrate electrode and remove the residual impurities; finally, 0.5M of H is used 2 SO 4 And activating, wherein the impedance of the substrate electrode is less than or equal to 100 omega.
Further, the preparation of the compound of formula iii in step S2 comprises the following steps:
dissolving 10mM of the compound of formula I in 1mL of absolute ethanol, followed by dilution to 500. Mu.M with PBS buffer pH 7.4; then 20 mul of 500 mul 4-carboxyphenylboronic acid is added into 10 mul mixed aqueous solution containing 1.95mg 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg N-hydroxysuccinimide to carry out carboxyl activation for 30min; adding 20 mu L of 50 mu M aptamer chain of formula II into the activated solution for reaction, wherein the reaction time is 3h, the reaction temperature is stabilized at 37 ℃, and 20 mu M boric acid aptamer compound BAAC of formula III can be obtained by using a gel column for purification;
Figure BDA0002587169710000041
the reaction formula is as follows:
Figure BDA0002587169710000042
it is a third object of the present invention to provide a proportional electrochemical biosensor comprising the above-mentioned electrode.
Furthermore, the proportional electrochemical biosensor adopts a three-electrode electrochemical system, and comprises a working electrode, a reference electrode and a counter electrode; the working electrode is a gold electrode or a glassy carbon electrode modified by a boric acid aptamer compound, the reference electrode is a saturated calomel electrode, and the counter electrode is a platinum wire electrode.
The invention also aims to provide the application of the electrode in detecting the combined N-glycolylneuraminic acid CNeu5Gc, in particular to CNeu5Gc in food.
Further, the application comprises the following steps:
s1: modifying the surface of a substrate electrode modified by a boric acid aptamer compound by using a CNeu5Gc solution (pH = 6.0) to be detected at 37 ℃, and carrying out constant-temperature modification reaction for 3h;
s2: dripping 10 mu L of 2mM solution of mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal containing the compounds of the formulas VII and V on the surface of the substrate electrode obtained in the step S1, and immediately transferring the solution to PBS buffer solution with the pH value of 6.0 for reaction for 2.5h;
Figure BDA0002587169710000051
s3: detecting current for the first time by using a three-electrode detection system of an electrochemical workstation, and recording the maximum current value I measured under the condition of pH 6.0 pH6 ；
S4: cleaning the surface of the electrode detected by S3 by using a Tris-HCl buffer solution with the pH value of 9.0 and ultrapure water, and transferring the electrode to the Tris-HCl buffer solution with the pH value of 9.0 for 2 hours;
s5: dripping 10 mu L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution on the surface of the electrode obtained in the step S4, and immediately transferring the solution into Tris-HCl buffer solution with the pH value of 9.0 for reaction for 2.5h;
s6: carrying out secondary current detection by using the three-electrode detection system of the electrochemical workstation again, and recording the maximum current value I measured under the condition of pH 9.0 pH9 ；
S7: current ratio I = I at acidic pH 6.0 to basic pH 9.0 pH6 /I pH9 As a signal indicator, wherein pH6 The maximum current value, I, measured at pH 6.0 pH9 The maximum current value measured under the condition of pH 9.0;
then, the content of CNeu5Gc in the object to be detected can be calculated by introducing a linear equation, wherein the linear equation is as follows:
the linear equation: i =1.238+0.803LogC CNeu5Gc Wherein I is the ratio of the currents obtained at acidic pH 6.0 to basic pH 9.0, and C CNeu5Gc Is the concentration of CNeu5Gc.
Further, the preparation steps of the mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution in the steps S2 and S4 comprise:
1) The compound of formula IV phospholipid polyethylene glycol active ester derivative DSPE-PEG-NH 2 And the phospholipid polyethylene glycol active ester derivative DSPE-PEG-NHS of the compound shown in the formula V are respectively dissolved in absolute ethyl alcohol by ultrasonic for 10 minutes to obtain 11.1mM DSPE-PEG-NH 2 Solution and 2mM DSPE-PEG-NHS solution;
Figure BDA0002587169710000061
2) Adding 4.2432mg of galacturonic acid of formula VI to 100 μ L of a mixed aqueous solution containing 1.95mg of 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg of N-hydroxysuccinimide for carboxyl activation for 30min to obtain 200mM GalA solution;
Figure BDA0002587169710000062
3) Taking 360 μ L of 11.1mM DSPE-PEG-NH prepared in step 1) 2 Adding the solution into 40 mu L of GalA solution activated in the step 2) for reaction, wherein the reaction time is 3h, the reaction temperature is 37 ℃, and diluting and purifying by using agar-glucose gel G25FF desalting column to obtain 2 mM-concentration phospholipid polyethylene glycol active ester derivative compound modified by galacturonic acid in the formula VII;
Figure BDA0002587169710000071
4) Mixing the 2mM galacturonic acid modified phospholipid polyethylene glycol active ester derivative complex of formula VII prepared in the step 3) and the 2mM DSPE-PEG-NHS solution prepared in the step 1) according to the volume ratio of 1:1, mixing to obtain mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution.
The reaction formula is as follows:
Figure BDA0002587169710000072
wherein the compound DSPE-PEG-NHS of formula V does not participate in the reaction of the above formula, but participates in the subsequent self-assembly.
Further, the electrochemical workstation in steps S3 and S6 has the following operating conditions: the sweep range of Cyclic Voltammetry (CV) was from 0.6V to-0.4V, the sweep rate was 100mV/s, the sweep range of Differential Pulse Voltammetry (DPV) was from 0.8V to-0.6V, the amplitude was 50mV, the pulse width was 50ms, the sweep rate was 100mV/s, and the electrolyte was 10mM [ Fe (CN) ] 6 ] 3/4- Containing 0.1M KCl.
Further, the three-electrode detection system in steps S3 and S6 is composed of a working electrode, a reference electrode and a counter electrode; wherein the working electrode is a gold electrode or a glassy carbon electrode modified by the boric acid aptamer compound, the reference electrode is a saturated calomel electrode, and the counter electrode is a platinum wire electrode
The mechanism adopted by the invention is as follows:
firstly, 4-carboxyphenylboronic acid is activated by carboxyl group through EDC and NHS and then is linked with DNA aptamer chain NH 2 <xnotran> -AAAAAAAAAATGGTCATGCCGTACGGTGTACCCCCGGGTGTACGCGGTGTACGGCTACTTTCTCTGCGTGCTGAGGGTGATCGTTTTCGCAAAAAAAA-SH ( COOH NH </xnotran> 2 ) The reaction forms a Boronic Acid Aptamer Complex (BAAC) as a recognition capture unit for CNeu5Gc by modifying-SH (or-COOH or-NH) on the Aptamer 2 ) Binding on the surface of gold electrode (or glassy carbon electrode) to obtain BAAC/AuE (or BAAC/GCE), then modifying different concentrations of object CNeu5Gc on BAAC/AuE (or BAAC/GCE), binding object CNeu5Gc with boric acid in BAAC under acidic pH 6.0 to form borate bond to obtain CNeu5Gc/BAAC/AuE (or CNeu5 Gc/BAAC/GCE), thereafter adding mixed phospholipid polyethylene glycol active ester derivative (DSPE-PEG-Gal) which can not bind to boric acid to contain [ Fe (CN) with 0.1M KCl concentration of 5mM 6 ] 3/4- As an electrolyte, measuring the magnitude of a peak current value by using a CHI660C electrochemical workstation and adopting a Differential Pulse Voltammetry (DPV for short) as an electrochemical signal under the acidic pH 6.0 condition; the interface of the electrode is cleaned by using Tris-HCl buffer solution with pH 9.0 and deionized water, CNeu5Gc/BAAC/AuE (or CNeu5 Gc/BAAC/GCE) is soaked in buffer solution with pH 9.0, CNeu5Gc is released from BAAC boric acid and captured by aptamer, DSPE-PEG-Gal added at the time is combined with boric acid through galacturonic acid on the DSPE-PEG-Gal and self-assembles to form a Lipid Bilayer (Lipid Bilayer) on the surface of the electrode, and LB/CNeu5Gc/BAAC/AuE (or LB/CNeu5 Gc/BAAC/GCE) is obtained. Reuse [ Fe (CN) 6 ] 3/4- As an electrolyte, CHI660C electrochemical workstation was used to output an electrochemical signal under alkaline pH 9.0 conditions. And determining the content of the CNeu5Gc by taking the current ratio of the acidic pH value of 6.0 to the alkaline pH value of 9.0 as a signal index, thereby realizing the purpose of quantitatively detecting the CNeu5Gc.
The sensor is used for detecting through a CHI660C electrochemical workstation, a boric acid aptamer chain is modified on the surface of an electrode, bound N-glycolylneuraminic acid can be captured by a boric acid part on the aptamer chain under an acidic pH condition and falls off under an alkaline condition so as to be recognized by the aptamer, and the vacated boric acid part can be combined with a mixed phospholipid polyethylene glycol active ester derivative (DSPE-PEG-Gal) to form a lipid bilayer through self-assembly on the surface of the electrode. The lipid bilayer having good insulation properties reduces the current value by preventing electrons from transferring from the solution to the electrode surface. The current ratio of the CHI660C electrochemical workstation to the N-glycolylneuraminic acid under the acidic pH condition and the alkaline pH condition is detected, so that the analysis and the detection of the binding state N-glycolylneuraminic acid are realized. The method is simple and rapid, has good repeatability and stability and high sensitivity, and can linearly detect the binding state N-glycolylneuraminic acid within the range of 2.186-360.396 ng/mL; the specificity is strong, the N-glycolylneuraminic acid in the binding state can be effectively distinguished from other saccharide derivatives in an actual sample, and good accuracy and practicability are shown.
The invention has the beneficial effects that:
1. the proportional electrochemical biosensor for measuring CNeu5G has good selectivity, high sensitivity and wide detection range;
2. according to the invention, BAAC is modified on the surface of a gold electrode (or a glassy carbon electrode), and under the condition of acidic pH 6.0, a boric acid part of the BAAC can be selectively combined with acidic sugar derivatives, including CNeu5Ac and CNeu5Gc; by adjusting the pH to 9.0, cneu5gc will be released from the boronic acid moiety of BAAC, and due to the proximity effect, the aptamer moiety of BAAC can selectively capture the released CNeu5Gc, resulting in an increase in the specificity of the sensor;
3. the proportional electrochemical biosensor constructed by utilizing the pH value-regulated lipid bilayer self-assembly can reduce the deviation among a plurality of electrodes to the maximum extent, thereby enhancing the stability and repeatability;
4. the method utilizes the CHI660C electrochemical workstation to output current values under the conditions of acidic pH 6.0 and alkaline pH 9.0 in sequence, and uses the current ratio of the two as a signal index to determine the content of the CNeu5G, so that the manufactured sensor has higher accuracy;
5. the invention utilizes the CHI660C electrochemical workstation analysis method, has the advantages of simplicity, economy, sensitivity, rapidness, accuracy, high efficiency, low price of required instruments and equipment and the like, and can be widely applied to the detection of CNeu5G in practical samples.
Drawings
FIG. 1 is a schematic diagram of a proportional electrochemical biosensor for detecting CNeu5Gc according to the present invention;
FIG. 2 is a graph showing the results of the quantitative determination of CNeu5Gc using example 1; wherein, FIG. 2a is a differential pulse voltammetry spectrum in the range of-0.6-0.8V at pH 6.0 and in the presence of various concentrations of CNeu5Gc;
FIG. 2b is a differential pulse voltammetry profile at pH 9.0 in the presence of various concentrations of CNeu5Gc, in the range of-0.6-0.8V; FIG. 2c shows the current ratio I at pH 6.0 and pH 9.0 pH6 /I pH9 And between different CNeu5Gc concentrations; FIG. 2d is the current ratio I at pH 6.0 and pH 9.0 pH6 /I pH9 A linear plot of CNeu5Gc concentration;
FIG. 3 is a graph showing the results of the specificity study of a proportional electrochemical biosensor for detecting CNeu5Gc using example 2;
FIG. 4 is a graph showing the anti-interference ability results of the proportional electrochemical biosensor detecting CNeu5Gc in application example 3.
Detailed description of the preferred embodiment
The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that it would be apparent to those skilled in the art that several modifications and improvements can be made without departing from the inventive concept. All falling within the scope of the present invention.
The reagents used in the following examples are commercially available.
Example 1: preparation of boronic acid aptamer complex BAAC
S1: 10mM of the compound of formula I (4-carboxyphenylboronic acid) was dissolved in 1mL of absolute ethanol and then diluted to 500. Mu.M with PBS buffer pH 7.4;
s2: adding 20 μ L of the 500 μ M4-carboxyphenylboronic acid into 10 μ L of a mixed aqueous solution containing 1.95mg1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg N-hydroxysuccinimide for carboxyl activation for 30min;
s3: and adding 20 mu L of 50 mu M aptamer chain of the formula II into the activated solution for reaction, wherein the reaction time is 3h, the reaction temperature is stabilized at 37 ℃, and the 20 mu M boric acid aptamer compound BAAC of the formula III can be obtained by using a gel column for purification.
The reaction formula is as follows:
Figure BDA0002587169710000111
wherein, the
Figure BDA0002587169710000112
<xnotran> DNA1, DNA1 AAAAAAAAAATGGTCATGCCGTACGGTGTACCCCCGGGTGTACGCGGTGTACGGCTACTTTCTCTGCGTGCTGAGGGTGATCGTTTTCGCAAAAAAAA. </xnotran>
Example 2: preparation of boronic acid aptamer complex/gold electrode
S1: after a gold electrode serving as a substrate electrode is ground by sand paper, aluminum powder with the particle sizes of 1.0 mu m, 0.3 mu m and 0.05 mu m is used for polishing, then the polished substrate electrode is respectively subjected to ultrasonic treatment in absolute ethyl alcohol and ultrapure water for 5min, and then the prepared giant salamander, namely concentrated sulfuric acid: hydrogen peroxide =1, and 50 μ L is dropped on each electrode surface to decontaminate the substrate electrode and remove residual impurities; finally, 0.5M of H is used 2 SO 4 And activating, wherein the impedance of the substrate electrode is less than or equal to 100 omega.
S2: modifying the boric acid aptamer compound BAAC prepared in the example 1 on the surface of the pretreated substrate electrode for 3h to prepare a boric acid aptamer compound/gold electrode; wherein, the reaction system is a boric acid aptamer complex solution containing 10mM PBS, 10mM TECP and 2 μ M in each 100 μ L reaction system, the pH is =7.4, and the temperature is 37 ℃.
The structure is shown as formula VIII:
Figure BDA0002587169710000121
example 3: preparation of boric acid aptamer complex/glassy carbon electrode
S1: grinding a glassy carbon electrode serving as a substrate electrode by using sand paper, polishing by using aluminum powder with the particle sizes of 1.0 mu m, 0.3 mu m and 0.05 mu m, performing ultrasonic treatment on the polished substrate electrode in absolute ethyl alcohol and ultrapure water for 5min, and then performing ultrasonic treatment on the polished substrate electrode by using prepared tiger fish, namely concentrated sulfuric acid: hydrogen peroxide =1, and 50 μ L of the mixture is dropped on each electrode surface to purify the substrate electrode and remove the residual impurities; finally, 0.5M of H is used 2 SO 4 And activating, wherein the impedance of the substrate electrode is less than or equal to 100 omega.
S2: modifying the boric acid aptamer compound BAAC prepared in the example 1 on the surface of the pretreated substrate electrode for 3h to prepare a boric acid aptamer compound/glassy carbon electrode; wherein the reaction system is 100 μ L of a boric acid aptamer complex solution containing 10mM PBS, 10mM TECP and 2 μ M in the reaction system, the pH is =7.4, and the temperature is 37 ℃.
The structure is shown as formula IX:
Figure BDA0002587169710000131
wherein R is 2 is-COOH or-NH 2 。
Example 4: preparation of mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution
S1: a compound of formula IV (DSPE-PEG-NH) 2 ) And the compound of formula V (DSPE-PEG-NHS) are respectively dissolved in absolute ethyl alcohol, and dissolved for 10 minutes by ultrasonic to respectively obtain 11.1mM DSPE-PEG-NH 2 Solution and 2mM DSPE-PEG-NHS solution;
Figure BDA0002587169710000132
s2: adding 4.2432mg of compound of formula VI (galacturonic acid) into 100 μ L of mixed aqueous solution containing 1.95mg1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg of N-hydroxysuccinimide, and activating for 30min to obtain 200mM GalA solution;
Figure BDA0002587169710000133
s3: 360 μ L of 11.1mM DSPE-PEG-NH was taken 2 Adding the solution into 40 μ L of the activated solution for reaction at 37 deg.C for 3h to obtain 2mM galacturonic acid modified phospholipid polyethylene glycol active ester derivative compound of formula VII by diluting and purifying with Sepharose G25FF desalting column;
Figure BDA0002587169710000141
s4: mixing the 2mM galacturonic acid modified phospholipid polyethylene glycol active ester derivative complex of formula VII prepared in the step 3) and the 2mM DSPE-PEG-NHS solution prepared in the step 1) according to the volume ratio of 1:1, mixing to obtain mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution.
The preparation reaction formula is as follows:
Figure BDA0002587169710000142
wherein DSPE-PEG-NHS does not participate in the reaction of the above formula, but participates in the subsequent self-assembly.
Example 5: method for detecting CNeu5Gc by proportional electrochemical biosensor
S1: immersing the modified electrode prepared in the embodiment 2 or 3 in 100 mu L of CNeu5Gc solution (pH = 6.0) of the object to be detected, and reacting at 37 ℃ for 3h to obtain CNeu5Gc/BAAC/AuE or CNeu5Gc/BAAC/GCE;
s2: dripping 10 mu L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution prepared in example 4 on the surface of the substrate electrode obtained in the step S1, and immediately transferring the solution into PBS buffer solution with the pH of 6.0 for reaction for 2.5h;
s3: carrying out primary DPV detection by using an electrochemical workstation (model CH 1660C) three-electrode detection system, and assembling a working electrode, a reference electrode and a counter electrode to form an electrochemical biosensor for detecting CNeu5Gc; wherein, the saturated calomel electrode is used as a reference electrode, and the platinum wire electrode is used as a counter electrode; the preset parameter conditions are as follows: differential Pulse Voltammetry (DPV) was scanned from 0.8V to-0.6V with an amplitude of 50mV, a pulse width of 50ms, a sweep rate of 100mV/s, and an electrolyte of 10mM [ Fe (CN) ] 6 ] 3/4- Containing 0.1M KCl.
All data were saved and the maximum current I measured at pH 6.0 was recorded pH6 ；
S4: cleaning the surface of the electrode detected by S3 by using a Tris-HCl buffer solution with the pH value of 9.0 and ultrapure water, and transferring the electrode to the Tris-HCl buffer solution with the pH value of 9.0 for 2 hours;
s5: dripping 10 mu L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution on the surface of the electrode obtained in the step S4, and immediately transferring the electrode to Tris-HCl buffer solution with the pH value of 9.0 for reaction for 2.5 hours;
s6: performing DPV for the second time by using a three-electrode detection system of an electrochemical workstation (model CH 1660C), storing all data, and recording the maximum current value I measured under the condition of pH 9.0 pH9 ；
S7: the current ratio of acidic pH 6.0 to alkaline pH 9.0 is used as a signal index, and the calculation method is as follows: i = I pH6 /I pH9 Wherein, I pH6 The maximum current value measured at pH 6.0, and I pH9 The maximum current value measured under the condition of pH 9.0;
then, the content of CNeu5Gc in the object to be detected can be calculated by introducing a linear equation, wherein the linear equation is as follows:
I＝1.238+0.803LogC CNeu5Gc wherein I is the ratio of the currents obtained at acidic pH 6.0 and basic pH 9.0, and C CNeu5Gc Is the concentration of CNeu5Gc.
Application example 1: quantitative determination of CNeu5Gc
Referring to A-D of FIG. 2, measurements of CNeu5Gc at different concentrations were performed.
CNeu5Gc (0, 2.816, 5.631, 11.262, 22.525, 45.050, 90.099, 180.198, 360.396 and 3603.960 ng/mL) with different concentrations is dissolved in PBS buffer solution with pH 6.0 and respectively modified on the surface of BAAC/AuE (or BAAC/GCE), reacted for 3h at 37 ℃, after specific recognition, 10 uL of 2mM DSPE-PEG-Gal is dripped on the surface of an electrode and immediately transferred into PBS buffer solution with pH 6.0, and analyzed and detected by a CHI660C electrochemical workstation after 2.5 h. The electrode interface was cleaned with Tris-HCl buffer pH 9.0 and deionized water and transferred to Tris-HCl buffer pH 9.0 for 2h, after which 10. Mu.L of 2mM DSPE-PEG-Gal was added drop wise to the electrode surface, and the modified electrode was immediately transferred to Tris-HCl buffer pH 9.0 for reaction for 2.5h, again assayed using the CHI660C electrochemical workstation. And (3) testing conditions: the sweep range of Cyclic Voltammetry (CV) was from 0.6V to-0.4V, the sweep rate was 100mV/s, the sweep range of Differential Pulse Voltammetry (DPV) was from 0.8V to-0.6V, the amplitude was 50mV, the pulse width was 50ms, the sweep rate was 100mV/s, and the electrolyte was 10mM [ Fe (CN) ] 6 ] 3/4- Containing 0.1M KCl.
FIG. 2 (A) is a differential pulse voltammetry spectrum in the range of-0.6-0.8V at pH 6.0 in the presence of various concentrations of CNeu5Gc. Under the condition of acidic pH 6.0, the cis-dihydroxy of Neu5Gc is specifically bound to the boric acid part in BAAC and fixed on the surface of the electrode, and at the moment, DSPE-PEG-Gal added for the first time is little or can not realize self-assembly on the surface of the electrode, so the current value is higher. FIG. 2 (B) is a differential pulse voltammetry spectrum at pH 9.0 in the presence of various concentrations of CNeu5Gc, ranging from-0.6 to 0.8V. With the pH adjusted to 9.0, cneu5gc will be released from the boronic acid moiety of BAAC, and the released CNeu5Gc can be selectively bound by the aptamer in BAAC, while the exposed boronic acid group will capture DSPE-PEG-Gal, achieving self-assembly of lipid bilayer in aqueous solution and thus decreasing the current value. FIG. 2 (C) shows the current ratio I at pH 6.0 and pH 9.0 pH6 /I pH9 And the column histogram between different CNeu5Gc concentrations. FIG. 2 (D) is a graph showing the current ratio I at pH 6.0 and pH 9.0 pH6 /I pH9 Linear relationship with CNeu5Gc concentration, current ratio I with increasing CNeu5Gc concentration pH6 /I pH9 Also in the rising, CNeu5Gc concentration range from 2.816ng/mL to 360.396ng/mL, the current ratio is linearly related to the logarithm of CNeu5Gc concentration.
Application example 2: specificity test of electrochemical biosensor
In this example, referring to fig. 3, an electrochemical biosensor specificity study was performed:
to verify the specificity of the present invention for detecting CNeu5Gc, it has been evaluated with interfering substances, including glucose, fructose, neu5Ac, neu5Gc, CNeu5Ac, chitosan, bovine serum albumin, ovalbumin, and hemoglobin, but not CNeu5Gc. The specificity of the proportional type electrochemical biosensor was demonstrated according to the procedure of example 4.
As shown in FIG. 3, the current ratio I of CNeu5Gc pH6 /I pH9 This is highest compared to the various interferents, neu5Gc times. This is because at pH 6.0, the acidic sugars (Neu 5Ac and Neu5 Gc) and the bound acidic sugars (CNeu 5Ac and CNeu5 Gc) can preferentially occupy the binding site of the boronic acid in BAAC, resulting in that the later added DSPE-PEG-Gal cannot form self-assembly on the electrode surface, while BAAC has higher capture efficiency for CNeu5Gc and Neu5Gc due to proximity effect, and thus the two sugar derivatives show larger current, while several other sugar substances cannot combine with the boronic acid on BAAC to form stable boronic ester bond in acidic pH, DSPE-PEG-Gal will self-assemble on the electrode surface to form lipid bilayer, and the electrons in the solution cannot transfer to the electrode surface due to the insulating property of the lipid bilayer, resulting in smaller current; while under the alkaline pH condition of 9.0, the added DSPE-PEG-Gal forms a self-assembled lipid bilayer on the surface of the electrode, and a weaker current value is obtained. The result well proves that the proportional electrochemical biosensor for analyzing CNeu5Gc has better selectivity and specificity.
Application example 3: anti-interference test of electrochemical biosensor
In this example, referring to fig. 4, a study of the interference rejection capability of the electrochemical biosensor was performed:
the interference resistance of the method is further studied by adding different interference substances (glucose, fructose, neu5Ac, neu5Gc, CNeu5Ac, chitosan, bovine serum albumin, ovalbumin and hemoglobin) into CNeu5Gc. The anti-interference ability of the proportional type electrochemical biosensor was demonstrated according to the procedure of example 4.
As shown in FIG. 4, when we replaced CNeu5Gc with a mixture of CNeu5Gc and other sugars and derivatives at a concentration 10 times higher than that, the resulting current ratio I was obtained pH6 /I pH9 The difference is almost negligible, which shows that the interference substances do not interfere the method in detecting CNeu5Gc, and the electrochemical biosensor has good anti-interference capability.
Application example 4: experimental detection research of practical samples:
the concentration of CNeu5Gc in fresh milk, chicken, pork, beef and eggs was measured by the proportional electrochemical biosensor of this example using sample-adding recovery method, and averaged 3 times, see the following table. The result shows that the established proportional electrochemical biosensor for analyzing CNeu5Gc has better anti-interference capability and can be used for detecting CNeu5Gc in a real sample.
Figure BDA0002587169710000181
The above examples construct electrode interfaces modified with boronic acid aptamer chains that can detect CNeu5Gc using pH-mediated self-assembly of lipid bilayers. CNeu5Gc can be captured by a boric acid part on an aptamer chain under an acidic pH condition, falls off under an alkaline condition and is recognized by the aptamer, the vacant boric acid part can be combined with a mixed phospholipid polyethylene glycol active ester derivative (DSPE-PEG-Gal) to form a lipid bilayer on the surface of an electrode through self-assembly, and a CHI660C electrochemical workstation is used as a detection means, so that high-sensitivity and high-specificity analysis and detection of CNeu5Gc are realized.
While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full scope of the invention.

Claims (4)

1. An electrode is applied to detection of combined N-glycolylneuraminic acid CNeu5Gc, and comprises a substrate electrode and a modification layer formed on the surface of the substrate electrode, wherein the modification layer is a boric acid aptamer compound shown in a formula III;
Figure FDA0003896157690000011
wherein R is 1 is-SH, -COOH or-NH 2 ；
Figure FDA0003896157690000012
It is shown that the DNA1 is a DNA,
the sequence of DNA1 is:
<xnotran> AAAAAAAAAATGGTCATGCCGTACGGTGTACCCCCGGGTGTACGCGGTGTACGGCTACTTTCTCTGCGTGCTGAGGGTGATCGTTTTCGCAAAAAAAA; </xnotran> The method is characterized in that: the application comprises the following steps:
s1: modifying the pH =6.0 of a CNeu5Gc solution to be detected on the surface of a substrate electrode modified by a boric acid aptamer compound at 37 ℃, and carrying out constant-temperature modification reaction for 3h;
s2: dripping 10 mu L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution on the surface of the substrate electrode obtained in the step S1, and immediately transferring the solution into PBS buffer solution with the pH value of 6.0 for reaction for 2.5h; the mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution comprises a galacturonic acid modified phospholipid polyethylene glycol active ester derivative compound shown in formula VII and a compound shown in formula V, DSPE-PEG-NHS;
Figure FDA0003896157690000013
s3: detecting current for the first time by using a three-electrode detection system of an electrochemical workstation, and recording the maximum current value I measured under the condition of pH 6.0 pH6 ；
S4: cleaning the surface of the electrode detected by S3 by using Tris-HCl buffer solution with pH of 9.0 and ultrapure water, and transferring the electrode surface into Tris-HCl buffer solution with pH of 9.0 for 2 hours;
s5: dripping 10 mu L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution on the surface of the electrode obtained in the step S4, and immediately transferring the solution into Tris-HCl buffer solution with the pH value of 9.0 for reaction for 2.5h;
s6: performing secondary current detection by using the three-electrode detection system of the electrochemical workstation again, and recording the maximum current value I measured under the condition of pH 9.0 pH9 ；
S7: current ratio I = I at acidic pH 6.0 to basic pH 9.0 pH6 /I pH9 As a signal indicator, wherein pH6 The maximum current value, I, measured at pH 6.0 pH9 The maximum current value measured under the condition of pH 9.0;
then, the content of CNeu5Gc in the object to be detected can be calculated by introducing a linear equation, wherein the linear equation is as follows:
the linear equation: i =1.238+0.803LogC CNeu5Gc Wherein I is the ratio of the currents obtained at acidic pH 6.0 and basic pH 9.0, and C CNeu5Gc Is the concentration of CNeu5Gc.
2. Use according to claim 1, characterized in that: the preparation steps of the mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution in the steps S2 and S5 comprise:
1) The compound of the formula IV DSPE-PEG-NH 2 And the compound DSPE-PEG-NHS of the formula V are respectively dissolved in absolute ethyl alcohol by ultrasound for 10 minutes to prepare 11.1mM DSPE-PEG-NH 2 Solution and 2mM DSPE-PEG-NHS solution;
Figure FDA0003896157690000021
2) Adding 4.2432mg of galacturonic acid of the compound of formula VI to 100 μ L of a mixed aqueous solution containing 1.95mg of 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg of N-hydroxysuccinimide for carboxyl activation for 30min to obtain a 200mM GalA solution;
Figure FDA0003896157690000031
3) Taking 360 μ L of 11.1mM DSPE-PEG-NH prepared in step 1) 2 Adding the solution into 40 mu L of GalA solution activated in the step 2) for reaction, wherein the reaction time is 3h, the reaction temperature is 37 ℃, and diluting and purifying by using an agar-glucose gel G25FF desalting column to obtain a 2 mM-concentration phospholipid polyethylene glycol active ester derivative compound modified by the galacturonic acid in the formula VII;
Figure FDA0003896157690000032
4) Mixing the 2mM galacturonic acid modified phospholipid polyethylene glycol active ester derivative complex prepared in the step 3) and the 2mM DSPE-PEG-NHS solution prepared in the step 1) according to the volume ratio of 1:1 to obtain mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution.
3. Use according to claim 1, characterized in that: the electrochemical work station in the steps S3 and S6 has the working conditions that: the sweep range of cyclic voltammetry CV was from 0.6V to-0.4V, the sweep rate was 100mV/s, the sweep range of differential pulse voltammetry DPV was from 0.8V to-0.6V, the amplitude was 50mV, the pulse width was 50ms, the sweep rate was 100mV/s, and the electrolyte was 10mM [ Fe (CN) 6 ] 3/4- Contains 0.1MKCl.
4. Use according to claim 1 or 3, characterized in that: the three-electrode detection system in the steps S3 and S6 consists of a working electrode, a reference electrode and a counter electrode; the working electrode is a gold electrode or a glassy carbon electrode modified by a boric acid aptamer compound, the reference electrode is a saturated calomel electrode, and the counter electrode is a platinum wire electrode.
CN202010684868.3A 2020-07-16 2020-07-16 Electrode for proportional electrochemical biosensor and preparation method and application thereof Active CN111812172B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010684868.3A CN111812172B (en) 2020-07-16 2020-07-16 Electrode for proportional electrochemical biosensor and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010684868.3A CN111812172B (en) 2020-07-16 2020-07-16 Electrode for proportional electrochemical biosensor and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN111812172A CN111812172A (en) 2020-10-23
CN111812172B true CN111812172B (en) 2022-12-06

Family

ID=72865447

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010684868.3A Active CN111812172B (en) 2020-07-16 2020-07-16 Electrode for proportional electrochemical biosensor and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN111812172B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102507689A (en) * 2011-10-19 2012-06-20 青岛科技大学 Manufacturing method and application of electrochemiluminescence sensor for detecting thrombin
WO2016062101A1 (en) * 2014-10-20 2016-04-28 中国人民解放军第三军医大学第一附属医院 Modified electrode for detecting ndm-1 and preparation method therefor and use thereof
CN110108773A (en) * 2019-06-03 2019-08-09 郑州轻工业学院 Electrochemical sensor electrodes and its preparation method and application
CN110438202A (en) * 2019-08-15 2019-11-12 青岛科技大学 The preparation method of fibrin ferment optical electro-chemistry sensor of the one kind based on ring metal Ir (III) complex

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102507689A (en) * 2011-10-19 2012-06-20 青岛科技大学 Manufacturing method and application of electrochemiluminescence sensor for detecting thrombin
WO2016062101A1 (en) * 2014-10-20 2016-04-28 中国人民解放军第三军医大学第一附属医院 Modified electrode for detecting ndm-1 and preparation method therefor and use thereof
CN110108773A (en) * 2019-06-03 2019-08-09 郑州轻工业学院 Electrochemical sensor electrodes and its preparation method and application
CN110438202A (en) * 2019-08-15 2019-11-12 青岛科技大学 The preparation method of fibrin ferment optical electro-chemistry sensor of the one kind based on ring metal Ir (III) complex

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Fabrication of pH-Adjusted Boronic Acid−Aptamer Conjugate for Electrochemical Analysis of Conjugated N‑Glycolylneuraminic Acid;Lihong Su等;《ACS Appl. Mater. Interfaces 2020》;20200117;第12卷;第7650-7657页EXPERIMENTAL SECTION、RESULTS AND DISCUSSION和CONCLUSIONS，Supporting Information *

Also Published As

Publication number Publication date
CN111812172A (en) 2020-10-23

Similar Documents

Publication Publication Date Title
CN110618185B (en) Ratiometric electrochemical detection method of ochratoxin A
CN108982630B (en) Preparation method and application of sandwich type electrochemical immunosensor for detecting prostate specific antigen
KR101005559B1 (en) Protein measurement apparatus by using biosensor
CN111175364B (en) Preparation method of ratiometric electrochemical aptamer sensor for simultaneously detecting aflatoxin B1 and ochratoxin A
Xu et al. Ultrasensitive electrochemical sensing of Hg2+ based on thymine-Hg2+-thymine interaction and signal amplification of alkaline phosphatase catalyzed silver deposition
Zhang et al. Label-free immunoassay for chloramphenicol based on hollow gold nanospheres/chitosan composite
KR101721572B1 (en) Biosensors for Glycosylated Hemoglobin using electrochemically active nano particles
CN103424448A (en) Method for detecting trace ochratoxin A (OTA) by adopting electrochemical aptamer sensor
CN101655473B (en) Preparation method of nanogold immunoelectrode
CN110006968B (en) Preparation method and application of electrochemical biosensor for detecting mercury ions based on rapid scanning cyclic voltammetry technology
CN108709996B (en) Preparation method and application of gold-palladium composite nanoenzyme immunosensor
CN104502593A (en) Preparation method of electrochemical mark-free immunosensor of gastric cancer tumor marker
CN105954345A (en) Method for electrochemically determining content of vitamins in fruit juice
CN111707721B (en) Preparation method and application of 17 beta-estradiol electrochemiluminescence aptamer sensor
CN108181371A (en) The electrochemical sensing analytical method of ochratoxin A in simple and quick detection food
Hua et al. A highly selective “turn-on” electroanalysis strategy with reduced copper metal–organic frameworks for sensing histamine and histidine
CN114813872A (en) Electrochemical/colorimetric dual-mode GP73 detection method based on H-rGO-Mn3O4 nanoenzyme
CN110018210A (en) A method of directly quickly detecting uric acid
CN109085225A (en) A kind of preparation method of the protein electrochemistry trace sensor of step sedimentation modification carbon electrode
Liu et al. A novel electrochemical immunosensor for ochratoxin A with hapten immobilization on thionine/gold nanoparticle modified glassy carbon electrode
CN105527277B (en) A kind of preparation method and application of estrone molecule trace electrochemical luminescence sensor
CN113607792A (en) Rapid blood fat detector and detection method
CN107102052B (en) Based on the uric acid electrochemical sensor containing active copper carbon dots and its application
CN111812172B (en) Electrode for proportional electrochemical biosensor and preparation method and application thereof
CN113984863B (en) Glycosylated hemoglobin detection method based on aptamer biosensor

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant