CN111812172A - Electrode for proportional electrochemical biosensor and preparation method and application thereof - Google Patents
Electrode for proportional electrochemical biosensor and preparation method and application thereof Download PDFInfo
- Publication number
- CN111812172A CN111812172A CN202010684868.3A CN202010684868A CN111812172A CN 111812172 A CN111812172 A CN 111812172A CN 202010684868 A CN202010684868 A CN 202010684868A CN 111812172 A CN111812172 A CN 111812172A
- Authority
- CN
- China
- Prior art keywords
- electrode
- solution
- dspe
- peg
- cneu5gc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
-
- C—CHEMISTRY; METALLURGY
- C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
- C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
- C08G65/00—Macromolecular compounds obtained by reactions forming an ether link in the main chain of the macromolecule
- C08G65/02—Macromolecular compounds obtained by reactions forming an ether link in the main chain of the macromolecule from cyclic ethers by opening of the heterocyclic ring
- C08G65/32—Polymers modified by chemical after-treatment
- C08G65/329—Polymers modified by chemical after-treatment with organic compounds
- C08G65/331—Polymers modified by chemical after-treatment with organic compounds containing oxygen
- C08G65/332—Polymers modified by chemical after-treatment with organic compounds containing oxygen containing carboxyl groups, or halides, or esters thereof
- C08G65/3328—Polymers modified by chemical after-treatment with organic compounds containing oxygen containing carboxyl groups, or halides, or esters thereof heterocyclic
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Electrochemistry (AREA)
- Analytical Chemistry (AREA)
- Polymers & Plastics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses a proportional electrochemical biosensor electrode for detecting binding state N-glycolylneuraminic acid and a preparation method thereof. The proportional electrochemical biosensor adopts a three-electrode electrochemical system and comprises a working electrode, a reference electrode and a counter electrode; the working electrode comprises a substrate electrode and a modification layer formed on the surface of the substrate electrode, wherein the modification layer is a boric acid aptamer compound. The method is simple and rapid, has good repeatability and stability and high sensitivity, and can be used for linearly detecting the binding state N-glycolylneuraminic acid within the range of 2.186-360.396 ng/mL; the specificity is strong, the N-glycolylneuraminic acid in the binding state can be effectively distinguished from other saccharide derivatives in an actual sample, and good accuracy and practicability are shown.
Description
Technical Field
The invention belongs to the technical field of electroanalytical chemistry and electrochemical sensors, and particularly relates to a proportional electrochemical biosensor for detecting binding state N-glycolylneuraminic acid and a preparation method thereof.
Background
The N-Glycolylneuraminic Acid (Neu 5Gc for short) contained in the animal food is formed by catalyzing acetyl on the carbon 5 of CMP-Neu5Ac by CMP-Neu5Ac hydroxylase as a precursor of N-Glycolylneuraminic Acid (Neu5Ac for short). Neu5Gc is an animal product hazard factor, particularly red meat and milk and its preparations rich in Neu5Gc, and it has been established that dietary intake of Neu5Gc is a risk factor for long-term adverse health effects. Neu5Gc is present in glycoconjugates in most hind-mouth animals, but Neu5Gc is virtually absent from normal human tissues, and dietary absorption is the only possible route for exogenous Neu5Gc into human tissues. Unlike free Neu5Gc, which can be excreted in vitro through urine, the conjugated N-glycolyl neuraminic acid conjugate (CNeu5Gc), which exists mainly as a glycoconjugate, can be metabolically conjugated to tissues and is abnormally expressed in human cells, resulting in the development of various cancers, and it has been found that CNeu5Gc is observed at high levels in human ovarian, breast, colon, lung and prostate cancer diseases, etc.
Currently, the methods for detecting CNeu5Gc mainly include the following methods: high performance liquid chromatography, high performance liquid chromatography and liquid chromatography-mass spectrometry, capillary electrophoresis, immunoblotting, immunohistochemistry, flow cytometry, enzyme-linked immunosorbent assay, and the like. The liquid phase method is generally used for obtaining the content of the Neu5Gc in a bound state by measuring the content of total Neu5Gc and the content of free Neu5Gc in the animal food and then calculating the difference between the two contents. The method has complex pretreatment, needs hydrolysis and derivatization of samples, has expensive instruments, complex equipment operation and large workload, and is difficult to be used for real-time large-batch detection and analysis of CNeu5 Gc. Biological methods such as immunization mostly adopt antibodies as recognition units of Neu5Gc, the biological methods have strong specificity, but the various CNeu5Gc in animal food cannot be recognized in the detection process, and the methods are difficult to meet the requirement of daily rapid analysis.
Therefore, establishing a new simple, economic, sensitive, rapid, accurate and efficient analysis method of CNeu5Gc becomes a problem to be solved urgently. Electrochemical analysis methods have become a popular detection technique due to their high sensitivity, fast response and simple operation. The boronic acid aptamer complex serves as a capture element of CNeu5Gc to construct an effective biosensor, and the pH-assisted self-assembled lipid bilayer can achieve signal modification by hindering electron transfer from the solution to the electrode surface through its insulating properties. The CNeu5Gc in the animal food is detected by the method, and a novel electrochemical method is provided for detecting CNeu5 Gc.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a proportional electrochemical biosensor for detecting the binding state N-glycolylneuraminic acid and a preparation method thereof. The electrode interface modified with boronic acid aptamer chain that can detect CNeu5Gc was constructed using a pH-mediated self-assembly lipid bilayer. The CNeu5Gc can be captured by a boric acid part on an aptamer chain under the acidic pH condition, falls off under the alkaline condition and is recognized by the aptamer, the vacant boric acid part can be combined with a mixed phospholipid polyethylene glycol active ester derivative (DSPE-PEG-Gal) to form a lipid bilayer on the surface of an electrode through self-assembly, and the CHI660C electrochemical workstation is used as a detection means, so that the high-sensitivity and high-specificity analysis and detection of CNeu5Gc are realized.
A first object of the present invention is to provide an electrode for a proportional electrochemical biosensor, comprising: the electrode comprises a substrate electrode and a modification layer formed on the surface of the substrate electrode, wherein the modification layer is a boric acid aptamer compound shown in a formula III;
the sequence of DNA1 is:
AAAAAAAAAATGGTCATGCCGTACGGTGTACCCCCGGGTGTACGCGGTGTACGGCTACTTTCTCTGCGTGCTGAGGGTGATCGTTTTCGCAAAAAAAA。
further, the substrate electrode is a gold electrode or a glassy carbon electrode.
Further, when the substrate electrode is a gold electrode, the surface of the gold electrode is modified by the boric acid aptamer compound shown in formula III to obtain the boric acid aptamer compound/gold electrode, and the specific structure is shown in formula VIII:
further, when the substrate electrode is a glassy carbon electrode, the surface of the glassy carbon electrode is modified by the boric acid aptamer compound shown in formula III to obtain the boric acid aptamer compound/glassy carbon electrode, and the specific structure is shown in formula IX:
wherein R is2is-COOH or-NH2。
A second object of the present invention is to provide a method for preparing the electrode, including:
s1: pretreating the substrate electrode, polishing the substrate electrode by using aluminum powder after polishing the substrate electrode by using sand paper, and then sequentially carrying out ultrasonic treatment, purification and activation treatment to obtain the pretreated substrate electrode;
s2: modifying the compound shown in the formula (III) on the surface of the pretreated substrate electrode for 1-3 h to prepare a boric acid aptamer compound electrode; wherein the reaction system is 100. mu.L of a boric acid aptamer complex solution containing 10mM of PBS, 10mM of TECP and 2. mu.M in the reaction system, the pH value is 7.4, and the temperature is 37 ℃.
Further, the step S1 includes the following steps:
polishing the substrate electrode by using sand paper, polishing by using aluminum powder with the particle sizes of 1.0 mu m, 0.3 mu m and 0.05 mu m, then respectively carrying out ultrasonic treatment on the polished substrate electrode in absolute ethyl alcohol and ultrapure water for 5min, and then using prepared tiger fish, namely concentrated sulfuric acid: dropping 50 μ L of mixed solution of hydrogen peroxide in a volume ratio of 3:1 on the surface of each electrode to purify the substrate electrode and remove residual impurities; finally, 0.5M of H is used2SO4And activating, wherein the impedance of the substrate electrode is less than or equal to 100 omega.
Further, the preparation of the compound of formula iii in step S2 includes the following steps:
10mM of the compound of formula I is dissolved in 1mL of absolute ethanol and then diluted to 500. mu.M with PBS buffer pH 7.4; then 20 mul of 500 mul 4-carboxyphenylboronic acid is added into 10 mul mixed aqueous solution containing 1.95mg 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg N-hydroxysuccinimide for carboxyl activation, and the activation time is 30 min; adding 20 mu L of 50 mu M aptamer chain of formula II into the activated solution for reaction, wherein the reaction time is 3h, the reaction temperature is stabilized at 37 ℃, and 20 mu M boric acid aptamer compound BAAC of formula III can be obtained by using a gel column for purification;
the reaction formula is as follows:
it is a third object of the present invention to provide a proportional electrochemical biosensor comprising the above-mentioned electrode.
Furthermore, the proportional electrochemical biosensor adopts a three-electrode electrochemical system, and comprises a working electrode, a reference electrode and a counter electrode; the working electrode is a gold electrode or a glassy carbon electrode modified by the boric acid aptamer compound, the reference electrode is a saturated calomel electrode, and the counter electrode is a platinum wire electrode.
Still another object of the present invention is to provide the use of the above electrode in detecting N-glycolylneuraminic acid CNeu5Gc in bound form, specifically CNeu5Gc in food.
Further, the application comprises the following steps:
s1: modifying the surface of a substrate electrode modified by a boric acid aptamer compound by using a CNeu5Gc solution (pH is 6.0) to be detected at 37 ℃, and carrying out constant-temperature modification reaction for 3 h;
s2: dripping 10 μ L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution containing the compounds of the formula VII and the formula V on the surface of the substrate electrode obtained in the step S1, and immediately transferring the solution to PBS buffer solution with the pH value of 6.0 for reaction for 2.5 h;
s3: detecting current for the first time by using a three-electrode detection system of an electrochemical workstation, and recording the maximum current value I measured under the condition of pH 6.0pH6;
S4: cleaning the surface of the electrode detected by S3 by using a Tris-HCl buffer solution with the pH value of 9.0 and ultrapure water, and transferring the electrode to the Tris-HCl buffer solution with the pH value of 9.0 for 2 h;
s5: dripping 10 μ L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution on the surface of the electrode obtained in the step S4, and immediately transferring to Tris-HCl buffer solution with pH of 9.0 for reaction for 2.5 h;
s6: carrying out secondary current detection by using the three-electrode detection system of the electrochemical workstation again, and recording the maximum current value I measured under the condition of pH 9.0pH9;
S7: the ratio of the current I to the current I at acidic pH 6.0 to alkaline pH 9.0 ispH6/IpH9As a signal indicator, whereinpH6The maximum current value, I, measured at pH 6.0pH9The maximum current value measured under the condition of pH 9.0;
then, the content of CNeu5Gc in the sample can be calculated by introducing a linear equation as follows:
the linear equation: i-1.238 +0.803LogCCNeu5GcWherein I is the ratio of the currents obtained at acidic pH 6.0 and basic pH 9.0, and CCNeu5GcIs the concentration of CNeu5 Gc.
Further, the preparation steps of the mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution in the steps S2 and S4 include:
1) the compound of formula IV phospholipid polyethylene glycol active ester derivative DSPE-PEG-NH2And the phospholipid polyethylene glycol active ester derivative DSPE-PEG-NHS of the compound shown in the formula V are respectively dissolved in absolute ethyl alcohol by ultrasonic for 10 minutes to prepareThe obtained DSPE-PEG-NH was 11.1mM2Solution and 2mM DSPE-PEG-NHS solution;
2) 4.2432mg of galacturonic acid compound of formula VI is added to 100 μ L of a mixed aqueous solution containing 1.95mg of 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg of N-hydroxysuccinimide for carboxyl activation for 30min to obtain 200mM GalA solution;
3) taking 360 μ L of 11.1mM DSPE-PEG-NH prepared in step 1)2Adding the solution into 40 mu L of GalA solution activated in the step 2) for reaction, wherein the reaction time is 3h, the reaction temperature is 37 ℃, and diluting and purifying by using an agar-glucose gel G25FF desalting column to obtain a 2 mM-concentration phospholipid polyethylene glycol active ester derivative compound modified by galacturonic acid in the formula VII;
4) mixing the 2mM galacturonic acid modified phospholipid polyethylene glycol active ester derivative complex of formula VII prepared in the step 3) and the 2mM DSPE-PEG-NHS solution prepared in the step 1) according to the volume ratio of 1: 1, mixing to obtain mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution.
The reaction formula is as follows:
wherein the compound DSPE-PEG-NHS of the formula V does not participate in the reaction of the formula, but participates in the subsequent self-assembly.
Further, the electrochemical workstation in steps S3 and S6 has the following operating conditions: the sweep range of Cyclic Voltammetry (CV) was from 0.6V to-0.4V, the sweep rate was 100mV/s,differential Pulse Voltammetry (DPV) was scanned from 0.8V to-0.6V with an amplitude of 50mV, a pulse width of 50ms, a sweep rate of 100mV/s, and an electrolyte of 10mM [ Fe (CN)6]3/4-Containing 0.1M KCl.
Further, the three-electrode detection system in steps S3 and S6 is composed of a working electrode, a reference electrode and a counter electrode; wherein the working electrode is a gold electrode or a glassy carbon electrode modified by the boric acid aptamer compound, the reference electrode is a saturated calomel electrode, and the counter electrode is a platinum wire electrode
The mechanism adopted by the invention is as follows:
firstly, 4-carboxyphenylboronic acid is activated by carboxyl group through EDC and NHS and then is linked with DNA aptamer chain NH2-AAAAAAAAAATGGTCATGCCGTACGGTGTACCCCCGGGTGTACGCGGTGTACGGCTACTTTCTCTGCGTGCTGAGGGTGATCGTTTTCGCAAAAAAAA-SH (or COOH or NH)2) The reaction forms a Boronic Acid Aptamer Complex (BAAC) as a recognition capture unit for CNeu5Gc by modifying-SH (or-COOH or-NH) on the aptamer2) Binding on the surface of gold electrode (or glassy carbon electrode) to obtain BAAC/AuE (or BAAC/GCE), then modifying target CNeu5Gc with different concentrations on BAAC/AuE (or BAAC/GCE), binding target CNeu5Gc with boric acid in BAAC under acidic pH 6.0 to form borate ester bond to obtain CNeu5Gc/BAAC/AuE (or CNeu5Gc/BAAC/GCE), after which the added mixed phospholipid polyethylene glycol active ester derivative (DSPE-PEG-Gal) will not bind to boric acid to contain [ Fe (CN) ] with 0.1M KCl concentration of 5mM6]3/4-As an electrolyte, measuring the peak current value by using a CHI660C electrochemical workstation and adopting a Differential Pulse Voltammetry (DPV for short) to obtain an electrochemical signal under the acidic pH 6.0 condition; the electrode interface was cleaned using Tris-HCl buffer at pH 9.0 and deionized water, and CNeu5Gc/BAAC/AuE (or CNeu5Gc/BAAC/GCE) was soaked in buffer solution at pH 9.0 to release CNeu5Gc from BAAC boronic acid and capture it by aptamer, at which time the added DSPE-PEG-Gal will bind to boronic acid through galacturonic acid thereon and self-assemble to form Lipid Bilayer (Lipid Bilayer) on the electrode surface, yielding LB/CNeu5Gc/BAAC/AuE (or LB/CNeu5 Gc/BAAC/GCE). Reuse of [ Fe (CN) ]6]3/4-As an electrolyte, CHI660C electrochemical workstation was used to output an electrochemical signal under alkaline pH 9.0 conditions. The current ratio under the conditions of acidic pH 6.0 and alkaline pH 9.0 is used as a signal index to determine the content of the detected CNeu5Gc, so that the aim of quantitatively detecting CNeu5Gc is fulfilled.
The sensor is used for detecting through a CHI660C electrochemical workstation, a boric acid aptamer chain is modified on the surface of an electrode, bound N-glycolylneuraminic acid can be captured by a boric acid part on the aptamer chain under an acidic pH condition and falls off under an alkaline condition so as to be recognized by the aptamer, and the vacated boric acid part can be combined with a mixed phospholipid polyethylene glycol active ester derivative (DSPE-PEG-Gal) to form a lipid bilayer through self-assembly on the surface of the electrode. The lipid bilayer with good insulation reduces the current value by blocking the transfer of electrons from the solution to the electrode surface. The current ratio under acidic pH condition and alkaline pH condition is detected by CHI660C electrochemical workstation, so that the analysis and detection of the N-glycolylneuraminic acid in a binding state are realized. The method is simple and rapid, has good repeatability and stability and high sensitivity, and can be used for linearly detecting the binding state N-glycolylneuraminic acid within the range of 2.186-360.396 ng/mL; the specificity is strong, the N-glycolylneuraminic acid in the binding state can be effectively distinguished from other saccharide derivatives in an actual sample, and good accuracy and practicability are shown.
The invention has the beneficial effects that:
1. the proportional electrochemical biosensor for measuring CNeu5G has good selectivity, high sensitivity and wide detection range;
2. by modifying the BAAC on the surface of a gold electrode (or glassy carbon electrode), the boric acid part of the BAAC can be selectively combined with acidic sugar derivatives including CNeu5Ac and CNeu5Gc under the condition of acidic pH of 6.0; by adjusting the pH to 9.0, CNeu5Gc will be released from the boronic acid moiety of BAAC and due to the proximity effect, the aptamer moiety of BAAC can selectively capture the released CNeu5Gc, resulting in an increased specificity of the sensor;
3. the proportional electrochemical biosensor constructed by utilizing the pH value-regulated lipid bilayer self-assembly can reduce the deviation among a plurality of electrodes to the maximum extent, thereby enhancing the stability and repeatability;
4. according to the invention, the CHI660C electrochemical workstation is used for sequentially outputting current values under the conditions of acidic pH 6.0 and alkaline pH 9.0, and the current ratio of the two is used as a signal index to determine the content of the CNeu5G, so that the prepared sensor has high accuracy;
5. the invention utilizes CHI660C electrochemical workstation analysis method, has the advantages of simplicity, economy, sensitivity, rapidness, accuracy, high efficiency, low price of required instruments and equipment and the like, and can be widely applied to detection of CNeu5G in practical samples.
Drawings
FIG. 1 is a schematic diagram of a proportional electrochemical biosensor for detecting CNeu5Gc according to the present invention;
FIG. 2 is a graph showing the results of the quantitative determination of CNeu5Gc using example 1; wherein FIG. 2a is a differential pulse voltammetry profile at pH 6.0 in the presence of various concentrations of CNeu5Gc in the range of-0.6-0.8V;
FIG. 2b is a differential pulse voltammetry profile at pH 9.0 in the presence of various concentrations of CNeu5Gc, in the range of-0.6-0.8V; FIG. 2c shows the current ratio I at pH 6.0 and pH 9.0pH6/IpH9And between different CNeu5Gc concentrations; FIG. 2d is the current ratio I at pH 6.0 and pH 9.0pH6/IpH9A linear plot of CNeu5Gc concentration;
FIG. 3 is a graph showing the results of the specificity study of the proportional type electrochemical biosensor to which CNeu5Gc was tested in example 2;
FIG. 4 is a graph showing the anti-interference ability of the proportional electrochemical biosensor using the method of example 3 for detecting CNeu5 Gc.
Detailed description of the invention
The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that it would be apparent to those skilled in the art that several modifications and improvements can be made without departing from the inventive concept. All falling within the scope of the present invention.
The reagents used in the following examples are all commercially available.
Example 1: preparation of boronic acid aptamer complex BAAC
S1: 10mM of the compound of formula I (4-carboxyphenylboronic acid) was dissolved in 1mL of absolute ethanol and then diluted to 500. mu.M with PBS buffer pH 7.4;
s2: 20 mu L of the 500 mu M4-carboxyphenylboronic acid is added into 10 mu L of mixed aqueous solution containing 1.95mg 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg N-hydroxysuccinimide to carry out carboxyl activation for 30 min;
s3: and adding 20 mu L of 50 mu M aptamer chain of the formula II into the activated solution for reaction, wherein the reaction time is 3h, the reaction temperature is stabilized at 37 ℃, and the 20 mu M boric acid aptamer compound BAAC of the formula III can be obtained by using a gel column for purification.
The reaction formula is as follows:
Example 2: preparation of boronic acid aptamer complex/gold electrode
S1: after a gold electrode serving as a substrate electrode is ground by sand paper, aluminum powder with the particle sizes of 1.0 mu m, 0.3 mu m and 0.05 mu m is used for polishing, then the polished substrate electrode is respectively subjected to ultrasonic treatment for 5min in absolute ethyl alcohol and ultrapure water, and then prepared goby, namely concentrated sulfuric acid: dropping 50 μ L of mixed solution of hydrogen peroxide in a volume ratio of 3:1 on the surface of each electrode to purify the substrate electrode and remove residual impurities; finally, 0.5M of H is used2SO4Performing activation, the substrate is electrically connectedThe pole impedance is less than or equal to 100 omega.
S2: modifying the boric acid aptamer compound BAAC prepared in the example 1 on the surface of the pretreated substrate electrode for 3h to prepare a boric acid aptamer compound/gold electrode; wherein the reaction system comprises 10mM PBS, 10mM TECP and 2 μ M boric acid aptamer complex solution in each 100 μ L reaction system, the pH value is 7.4, and the temperature is 37 ℃.
The structure is shown as formula VIII:
example 3: preparation of boric acid aptamer complex/glassy carbon electrode
S1: grinding a glassy carbon electrode serving as a substrate electrode by using sand paper, polishing by using aluminum powder with the particle sizes of 1.0 mu m, 0.3 mu m and 0.05 mu m, performing ultrasonic treatment on the polished substrate electrode in absolute ethyl alcohol and ultrapure water for 5min, and then performing ultrasonic treatment on the polished substrate electrode by using prepared tiger fish, namely concentrated sulfuric acid: dropping 50 μ L of mixed solution of hydrogen peroxide in a volume ratio of 3:1 on the surface of each electrode to purify the substrate electrode and remove residual impurities; finally, 0.5M of H is used2SO4And activating, wherein the impedance of the substrate electrode is less than or equal to 100 omega.
S2: modifying the boric acid aptamer compound BAAC prepared in the example 1 on the surface of the pretreated substrate electrode for 3h to prepare a boric acid aptamer compound/glassy carbon electrode; wherein the reaction system is 100. mu.L of a boric acid aptamer complex solution containing 10mM of PBS, 10mM of TECP and 2. mu.M in the reaction system, the pH value is 7.4, and the temperature is 37 ℃.
The structure is shown as formula IX:
wherein R is2is-COOH or-NH2。
Example 4: preparation of mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution
S1: compound of formula IV (DSPE-PEG-NH)2) And the compound of formula V (DSPE-PEG-NHS) are respectively dissolved in absolute ethyl alcohol, and dissolved for 10 minutes by ultrasonic to respectively obtain 11.1mM DSPE-PEG-NH2Solution and 2mM DSPE-PEG-NHS solution;
s2: 4.2432mg of the compound of formula VI (galacturonic acid) was added to 100. mu.L of a mixed aqueous solution containing 1.95mg of 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg of N-hydroxysuccinimide for carboxyl activation for 30min to give a 200mM GalA solution;
s3: 360 μ L of 11.1mM DSPE-PEG-NH was taken2Adding the solution into 40 μ L of the activated solution for reaction, wherein the reaction time is 3h, the reaction temperature is 37 ℃, and diluting and purifying by using agar-glucose gel G25FF desalting column to obtain 2mM of the galacturonic acid modified phospholipid polyethylene glycol active ester derivative compound with the concentration of formula VII;
s4: mixing the 2mM galacturonic acid modified phospholipid polyethylene glycol active ester derivative complex of formula VII prepared in the step 3) and the 2mM DSPE-PEG-NHS solution prepared in the step 1) according to the volume ratio of 1: 1, mixing to obtain mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution.
The preparation reaction formula is as follows:
wherein, DSPE-PEG-NHS does not participate in the reaction of the formula, but participates in the subsequent self-assembly.
Example 5: method for detecting CNeu5Gc by proportional electrochemical biosensor
S1: immersing the modified electrode prepared in example 2 or 3 in 100 mu L of CNeu5Gc solution (pH 6.0) to be detected, and reacting at 37 ℃ for 3h to obtain CNeu5Gc/BAAC/AuE or CNeu5 Gc/BAAC/GCE;
s2: 10 μ L of a 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution prepared in example 4 was added dropwise to the surface of the substrate electrode obtained in step S1, and immediately transferred to PBS buffer solution with pH 6.0 for reaction for 2.5 h;
s3: carrying out primary DPV detection by using an electrochemical workstation (model CH1660C) three-electrode detection system, and assembling a working electrode, a reference electrode and a counter electrode to form an electrochemical biosensor for detecting CNeu5 Gc; wherein, the saturated calomel electrode is used as a reference electrode, and the platinum wire electrode is used as a counter electrode; the preset parameter conditions are as follows: differential Pulse Voltammetry (DPV) was scanned from 0.8V to-0.6V with an amplitude of 50mV, a pulse width of 50ms, a sweep rate of 100mV/s, and an electrolyte of 10mM [ Fe (CN)6]3/4-Containing 0.1M KCl.
All data were saved and the maximum current I measured at pH 6.0 was recordedpH6;
S4: cleaning the surface of the electrode detected by S3 by using a Tris-HCl buffer solution with the pH value of 9.0 and ultrapure water, and transferring the electrode to the Tris-HCl buffer solution with the pH value of 9.0 for 2 h;
s5: dripping 10 μ L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution on the surface of the electrode obtained in the step S4, and immediately transferring to Tris-HCl buffer solution with pH of 9.0 for reaction for 2.5 h;
s6: performing DPV again by using electrochemical workstation (model CH1660C) three-electrode detection system, storing all data, and recording maximum current value I measured under pH 9.0pH9;
S7: the current ratio of acidic pH 6.0 to alkaline pH 9.0 is used as a signal index, and the calculation method is as follows: i ═ IpH6/IpH9Wherein, IpH6The maximum current value measured at pH 6.0, and IpH9The maximum current value measured under the condition of pH 9.0;
then, the content of CNeu5Gc in the sample can be calculated by introducing a linear equation as follows:
I=1.238+0.803LogCCNeu5Gcwherein I is the ratio of the currents obtained at acidic pH 6.0 and basic pH 9.0, and CCNeu5GcIs the concentration of CNeu5 Gc.
Application example 1: quantitative determination of CNeu5Gc
Referring to A-D of FIG. 2, measurements of CNeu5Gc at various concentrations were performed.
CNeu5Gc (0, 2.816, 5.631, 11.262, 22.525, 45.050, 90.099, 180.198, 360.396 and 3603.960ng/mL) with different concentrations is dissolved in PBS buffer solution with pH 6.0 and respectively modified on the surface of BAAC/AuE (or BAAC/GCE), reaction is carried out for 3h at 37 ℃, after specific recognition, 10 mu L of 2mM DSPE-PEG-Gal is dripped on the surface of an electrode and immediately transferred into PBS buffer solution with pH 6.0, and after 2.5h, analysis and detection are carried out by using CHI660C electrochemical workstation. The electrode interface was cleaned using Tris-HCl buffer pH 9.0 and deionized water and transferred to Tris-HCl buffer pH 9.0 for 2h, after which 10. mu.L of 2mM DSPE-PEG-Gal was added dropwise to the electrode surface, and the modified electrode was immediately transferred to Tris-HCl buffer pH 9.0 for reaction for 2.5h and assayed again using the CHI660C electrochemical workstation. And (3) testing conditions are as follows: the sweep range of Cyclic Voltammetry (CV) was from 0.6V to-0.4V, the sweep rate was 100mV/s, the sweep range of Differential Pulse Voltammetry (DPV) was from 0.8V to-0.6V, the amplitude was 50mV, the pulse width was 50ms, the sweep rate was 100mV/s, and the electrolyte was 10mM [ Fe (CN)6]3/4-Containing 0.1M KCl.
FIG. 2(A) is a differential pulse voltammetry spectrum at pH 6.0 in the presence of various concentrations of CNeu5Gc, ranging from-0.6 to 0.8V. Under the acidic pH condition of 6.0, the cis-dihydroxy of Neu5Gc specifically binds to the boronic acid moiety in BAAC and is immobilized on the electrode surface, and at this time, DSPE-PEG-Gal added for the first time is little or can not realize self-assembly on the electrode surface, so the current value is high. FIG. 2(B) is a differential pulse voltammetry spectrum at pH 9.0 in the presence of various concentrations of CNeu5Gc, ranging from-0.6 to 0.8V. With the pH adjusted to 9.0, CNeu5Gc will be released from the boronic acid portion of BAAC,while the released CNeu5Gc can be selectively bound by the aptamer in BAAC, the exposed boronic acid group will capture DSPE-PEG-Gal, and self-assembly of lipid bilayer is achieved in aqueous solution to reduce the current value. FIG. 2(C) shows the current ratio I at pH 6.0 and pH 9.0pH6/IpH9And between different CNeu5Gc concentrations. FIG. 2(D) is a graph showing the current ratio I at pH 6.0 and pH 9.0pH6/IpH9Linear relationship with CNeu5Gc concentration, current ratio I with increasing CNeu5Gc concentrationpH6/IpH9Also rising, the current ratio is linearly related to the logarithm of the CNeu5Gc concentration in the CNeu5Gc concentration range from 2.816ng/mL to 360.396 ng/mL.
Application example 2: specificity test of electrochemical biosensor
In this example, referring to fig. 3, an electrochemical biosensor specificity study was performed:
to verify the specificity of the present assay for CNeu5Gc, it was evaluated using interfering substances, including glucose, fructose, Neu5Ac, Neu5Gc, CNeu5Ac, chitosan, bovine serum albumin, ovalbumin, and hemoglobin, but not CNeu5 Gc. The specificity of the proportional type electrochemical biosensor was demonstrated according to the procedure of example 4.
As shown in FIG. 3, the current ratio I of CNeu5GcpH6/IpH9This is highest compared to the various interferents, Neu5Gc times. This is because at pH 6.0, the acidic sugars (Neu5Ac and Neu5Gc) and the bound acidic sugars (CNeu5Ac and CNeu5Gc) can preferentially occupy the binding sites of the boronic acid in BAAC, resulting in that the later added DSPE-PEG-Gal cannot form self-assembly on the electrode surface, while BAAC has higher capture efficiency for CNeu5Gc and Neu5Gc due to proximity effect, and thus the two sugar derivatives show larger current, while several other sugar substances cannot form stable boronic ester bond with the boronic acid on BAAC at acidic pH, DSPE-PEG-Gal will self-assemble on the electrode surface to form lipid bilayer, and the electrons in the solution cannot transfer to the electrode surface due to the insulating property of lipid bilayer, resulting in smaller current; while the DSPE-PEG-Gal is added on the surface of the electrode under the condition of alkaline pH of 9.0Self-assembled lipid bilayers were formed on the surfaces, and weak current values were obtained. The results well demonstrate that the proportional electrochemical biosensor for analyzing CNeu5Gc established by the inventor has better selectivity and specificity.
Application example 3: anti-interference test of electrochemical biosensor
In this example, referring to fig. 4, a study of the interference rejection capability of the electrochemical biosensor was performed:
the anti-interference capability of the method is further studied by adding different interference substances (glucose, fructose, Neu5Ac, Neu5Gc, CNeu5Ac, chitosan, bovine serum albumin, ovalbumin and hemoglobin) into CNeu5 Gc. The anti-interference ability of the proportional type electrochemical biosensor was demonstrated according to the procedure of example 4.
As shown in FIG. 4, when we replaced CNeu5Gc with a mixture of CNeu5Gc and other sugars and derivatives at a concentration 10 times higher than that, the resulting current ratio I was obtainedpH6/IpH9The difference is almost negligible, which indicates that the interference substances do not interfere with the method in detecting CNeu5Gc, and the electrochemical biosensor has good anti-interference capability.
Application example 4: experimental detection research of practical samples:
the concentration of CNeu5Gc in fresh milk, chicken, pork, beef and egg was measured by the proportional electrochemical biosensor of this example using sample-adding recovery method, and averaged 3 times, as shown in the following table. The result shows that the proportional electrochemical biosensor for analyzing CNeu5Gc has better anti-interference capability and can be used for detecting CNeu5Gc in real samples.
The above example constructed an electrode interface modified with a boronic acid aptamer chain that could detect CNeu5Gc using a pH-mediated self-assembly lipid bilayer. The CNeu5Gc can be captured by a boric acid part on an aptamer chain under the acidic pH condition, falls off under the alkaline condition and is recognized by the aptamer, the vacant boric acid part can be combined with a mixed phospholipid polyethylene glycol active ester derivative (DSPE-PEG-Gal) to form a lipid bilayer on the surface of an electrode through self-assembly, and the CHI660C electrochemical workstation is used as a detection means, so that the high-sensitivity and high-specificity analysis and detection of CNeu5Gc are realized.
While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full scope of the invention.
Claims (13)
1. An electrode for a proportional electrochemical biosensor, comprising: the electrode comprises a substrate electrode and a modification layer formed on the surface of the substrate electrode, wherein the modification layer is a boric acid aptamer compound shown in a formula III;
the sequence of DNA1 is:
AAAAAAAAAATGGTCATGCCGTACGGTGTACCCCCGGGTGTACGCGGTGTACGGCTACTTTCTCTGCGTGCTGAGGGTGATCGTTTTCGCAAAAAAAA。
2. the proportional-type electrode for an electrochemical biosensor according to claim 1, wherein: the substrate electrode is a gold electrode or a glassy carbon electrode.
3. The proportional electrochemical biosensor electrode of claim 2, wherein: when the substrate electrode is a gold electrode, the surface of the gold electrode is modified by a boric acid aptamer compound shown in formula III to obtain the boric acid aptamer compound/gold electrode, and the specific structure is shown in formula VIII:
4. the proportional electrochemical biosensor electrode of claim 2, wherein: when the substrate electrode is a glassy carbon electrode, the surface of the glassy carbon electrode is modified by a boric acid aptamer compound shown in a formula III to obtain the boric acid aptamer compound/glassy carbon electrode, and the specific structure is shown as a formula IX:
wherein R is2is-COOH or-NH2。
5. A method of preparing an electrode according to any one of claims 1 to 4, comprising:
s1: pretreating the substrate electrode, polishing the substrate electrode by using aluminum powder after polishing the substrate electrode by using sand paper, and then sequentially carrying out ultrasonic treatment, purification and activation treatment to obtain the pretreated substrate electrode;
s2: modifying the compound shown in the formula (III) on the surface of the pretreated substrate electrode for 1-3 h to prepare a boric acid aptamer compound electrode; wherein the reaction system is 100. mu.L of a boric acid aptamer complex solution containing 10mM of PBS, 10mM of TECP and 2. mu.M in the reaction system, the pH value is 7.4, and the temperature is 37 ℃.
6. A proportional electrochemical biosensor comprising an electrode according to any one of claims 1 to 4.
7. The proportional electrochemical biosensor of claim 6, wherein: the proportional electrochemical biosensor adopts a three-electrode electrochemical system and comprises a working electrode, a reference electrode and a counter electrode; the working electrode is a modified gold electrode or a glassy carbon electrode, the reference electrode is a saturated calomel electrode, and the counter electrode is a platinum wire electrode.
8. Use of an electrode according to any of claims 1 to 4 for the detection of the bound form of N-glycolylneuraminic acid CNeu5 Gc.
9. Use according to claim 8, characterized in that: the use of said electrode for detecting CNeu5Gc in a food product.
10. Use according to claim 8, characterized in that: the application comprises the following steps:
s1: modifying the surface of a substrate electrode modified by a boric acid aptamer compound by using a CNeu5Gc solution (pH is 6.0) to be detected at 37 ℃, and carrying out constant-temperature modification reaction for 3 h;
s2: dripping 10 μ L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution on the surface of the substrate electrode obtained in the step S1, and immediately transferring the solution into PBS buffer solution with pH 6.0 for reaction for 2.5 h;
s3: detecting current for the first time by using a three-electrode detection system of an electrochemical workstation, and recording the maximum current value I measured under the condition of pH 6.0pH6;
S4: cleaning the surface of the electrode detected by S3 by using a Tris-HCl buffer solution with the pH value of 9.0 and ultrapure water, and transferring the electrode to the Tris-HCl buffer solution with the pH value of 9.0 for 2 h;
s5: dripping 10 μ L of 2mM mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution on the surface of the electrode obtained in the step S4, and immediately transferring to Tris-HCl buffer solution with pH of 9.0 for reaction for 2.5 h;
s6: carrying out secondary current detection by using the three-electrode detection system of the electrochemical workstation again, and recording the maximum current value I measured under the condition of pH 9.0pH9;
S7: by acidityCurrent ratio I ═ I at pH 6.0 to alkaline pH 9.0pH6/IpH9As a signal indicator, whereinpH6The maximum current value, I, measured at pH 6.0pH9The maximum current value measured under the condition of pH 9.0;
then, the content of CNeu5Gc in the sample can be calculated by introducing a linear equation as follows:
the linear equation: i-1.238 +0.803LogCCNeu5GcWherein I is the ratio of the currents obtained at acidic pH 6.0 and basic pH 9.0, and CCNeu5GcIs the concentration of CNeu5 Gc.
11. Use according to claim 8, characterized in that: the preparation steps of the mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution in the steps S2 and S4 comprise:
1) the compound of the formula IV DSPE-PEG-NH2And the compound DSPE-PEG-NHS of the formula V are respectively dissolved in absolute ethyl alcohol by ultrasound for 10 minutes to prepare 11.1mM DSPE-PEG-NH2Solution and 2mM DSPE-PEG-NHS solution;
2) 4.2432mg of galacturonic acid of the compound of formula VI is added into 100 μ L of a mixed aqueous solution containing 1.95mg of 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide and 7.05mg of N-hydroxysuccinimide for carboxyl activation for 30min to obtain 200mM GalA solution;
3) taking 360 μ L of 11.1mM DSPE-PEG-NH prepared in step 1)2Adding the solution into 40 mu L of GalA solution activated in the step 2) for reaction, wherein the reaction time is 3h, the reaction temperature is 37 ℃, and diluting and purifying by using an agar-glucose gel G25FF desalting column to obtain a 2 mM-concentration phospholipid polyethylene glycol active ester derivative compound modified by the galacturonic acid in the formula VII;
4) mixing the 2mM galacturonic acid modified phospholipid polyethylene glycol active ester derivative complex prepared in the step 3) and the 2mM DSPE-PEG-NHS solution prepared in the step 1) according to the volume ratio of 1: 1, mixing to obtain mixed phospholipid polyethylene glycol active ester derivative DSPE-PEG-Gal solution.
12. Use according to claim 8, characterized in that: the electrochemical work stations in the steps S3 and S6 have the following working conditions: the sweep range of Cyclic Voltammetry (CV) was from 0.6V to-0.4V, the sweep rate was 100mV/s, the sweep range of Differential Pulse Voltammetry (DPV) was from 0.8V to-0.6V, the amplitude was 50mV, the pulse width was 50ms, the sweep rate was 100mV/s, and the electrolyte was 10mM [ Fe (CN)6]3/4-Containing 0.1M KCl.
13. Use according to claim 8, characterized in that: the three-electrode detection system in the steps S3 and S6 consists of a working electrode, a reference electrode and a counter electrode; the working electrode is a gold electrode or a glassy carbon electrode modified by the boric acid aptamer compound, the reference electrode is a saturated calomel electrode, and the counter electrode is a platinum wire electrode.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010684868.3A CN111812172B (en) | 2020-07-16 | 2020-07-16 | Electrode for proportional electrochemical biosensor and preparation method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010684868.3A CN111812172B (en) | 2020-07-16 | 2020-07-16 | Electrode for proportional electrochemical biosensor and preparation method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN111812172A true CN111812172A (en) | 2020-10-23 |
CN111812172B CN111812172B (en) | 2022-12-06 |
Family
ID=72865447
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010684868.3A Active CN111812172B (en) | 2020-07-16 | 2020-07-16 | Electrode for proportional electrochemical biosensor and preparation method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111812172B (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102507689A (en) * | 2011-10-19 | 2012-06-20 | 青岛科技大学 | Manufacturing method and application of electrochemiluminescence sensor for detecting thrombin |
WO2016062101A1 (en) * | 2014-10-20 | 2016-04-28 | 中国人民解放军第三军医大学第一附属医院 | Modified electrode for detecting ndm-1 and preparation method therefor and use thereof |
CN110108773A (en) * | 2019-06-03 | 2019-08-09 | 郑州轻工业学院 | Electrochemical sensor electrodes and its preparation method and application |
CN110438202A (en) * | 2019-08-15 | 2019-11-12 | 青岛科技大学 | The preparation method of fibrin ferment optical electro-chemistry sensor of the one kind based on ring metal Ir (III) complex |
-
2020
- 2020-07-16 CN CN202010684868.3A patent/CN111812172B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102507689A (en) * | 2011-10-19 | 2012-06-20 | 青岛科技大学 | Manufacturing method and application of electrochemiluminescence sensor for detecting thrombin |
WO2016062101A1 (en) * | 2014-10-20 | 2016-04-28 | 中国人民解放军第三军医大学第一附属医院 | Modified electrode for detecting ndm-1 and preparation method therefor and use thereof |
CN110108773A (en) * | 2019-06-03 | 2019-08-09 | 郑州轻工业学院 | Electrochemical sensor electrodes and its preparation method and application |
CN110438202A (en) * | 2019-08-15 | 2019-11-12 | 青岛科技大学 | The preparation method of fibrin ferment optical electro-chemistry sensor of the one kind based on ring metal Ir (III) complex |
Non-Patent Citations (1)
Title |
---|
LIHONG SU等: "Fabrication of pH-Adjusted Boronic Acid−Aptamer Conjugate for Electrochemical Analysis of Conjugated N‑Glycolylneuraminic Acid", 《ACS APPL. MATER. INTERFACES 2020》 * |
Also Published As
Publication number | Publication date |
---|---|
CN111812172B (en) | 2022-12-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110618185B (en) | Ratiometric electrochemical detection method of ochratoxin A | |
Hou et al. | An ultrasensitive competitive immunosensor for impedimetric detection of microcystin-LR via antibody-conjugated enzymatic biocatalytic precipitation | |
KR101005559B1 (en) | Protein measurement apparatus by using biosensor | |
CN102735728B (en) | Electrochemical immunosensor, preparation method and use of electrochemical immunosensor | |
Xu et al. | Ultrasensitive electrochemical sensing of Hg2+ based on thymine-Hg2+-thymine interaction and signal amplification of alkaline phosphatase catalyzed silver deposition | |
CN103424448A (en) | Method for detecting trace ochratoxin A (OTA) by adopting electrochemical aptamer sensor | |
KR101721572B1 (en) | Biosensors for Glycosylated Hemoglobin using electrochemically active nano particles | |
CN104502593B (en) | The preparation method of the unmarked immunosensor of a kind of galvanochemistry stomach neoplasms tumor markers | |
CN101655473B (en) | Preparation method of nanogold immunoelectrode | |
CN103063833A (en) | Preparation method and application of unmarked immunosensor for rapidly detecting clenbuterol | |
CN101793862B (en) | L-cysteine/chitosan-modified electrochemical sensor and use thereof | |
CN111707721B (en) | Preparation method and application of 17 beta-estradiol electrochemiluminescence aptamer sensor | |
CN108709996B (en) | Preparation method and application of gold-palladium composite nanoenzyme immunosensor | |
CN108181371A (en) | The electrochemical sensing analytical method of ochratoxin A in simple and quick detection food | |
CN109085225A (en) | A kind of preparation method of the protein electrochemistry trace sensor of step sedimentation modification carbon electrode | |
CN113607792A (en) | Rapid blood fat detector and detection method | |
CN111812172B (en) | Electrode for proportional electrochemical biosensor and preparation method and application thereof | |
Wang et al. | Electrochemical immunoassay for α-fetoprotein through a phenylboronic acid monolayer on gold | |
CN113984863B (en) | Glycosylated hemoglobin detection method based on aptamer biosensor | |
CN104198706B (en) | A kind of preparation method of tumor marker electrochemical immunosensor | |
Liang et al. | A rGO-PAM-Fc/AuNPs nanosensing membrane in a light-addressable potentiometric biosensor for 1, 5-anhydroglucitol determination | |
CN111678962B (en) | Preparation method and application of aflatoxin electrochemical sensor | |
Huang et al. | Simultaneous detection of two tumor markers using electrochemical immunosensor based on ultrathin metal–organic framework derived nanosheets as redox probes | |
Sun et al. | Microdetermination of double-stranded DNA by linear sweep voltammetry with phenosafranine | |
CN114295703A (en) | High-sensitivity cytokine electrochemical aptamer sensor based on target-induced silver nanocluster probe |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |