CN111808976B - Method for identifying angelica alpine yak-derived components - Google Patents
Method for identifying angelica alpine yak-derived components Download PDFInfo
- Publication number
- CN111808976B CN111808976B CN202010932120.0A CN202010932120A CN111808976B CN 111808976 B CN111808976 B CN 111808976B CN 202010932120 A CN202010932120 A CN 202010932120A CN 111808976 B CN111808976 B CN 111808976B
- Authority
- CN
- China
- Prior art keywords
- primer
- yak
- daniang
- alpine
- mitochondria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention discloses a method for identifying a radix angelicae alpine yak-derived component. The method is used for identifying and distinguishing the Daniang alpine yak and other yaks based on 11 mitochondrial SNP locus combinations. The invention adopts 8 pairs of specific primers of the Daniang alpine yak, and judges the genotype of the 11 SNP sites by comparing whether the melting curve peak of 3 RT-PCR reactions has a corresponding positive peak type or not based on 2 triplex and 1 duplex real-time fluorescent quantitative PCR (RT-PCR) reactions which are carried out simultaneously, and finally judges whether the Daniang alpine yak is the Daniang alpine yak or not. The sequences of the 8 pairs of specific primers are shown as SEQ ID NO. 1-16. The method is rapid and simple, has visual and reliable results, and has important significance for improving the overall brand value of the Daniang alpine yak industry, protecting the diversity of yak varieties and the benefits of breeding and processing enterprises.
Description
Technical Field
The invention belongs to the technical field of molecular biology and food detection, and particularly relates to a method for identifying a high mountain yak-derived ingredient in swertia.
Background
The yaks are distributed in Qinghai-Tibet plateau and adjacent areas, and the total number of yaks in China accounts for more than 94% of the world. The yak meat has the characteristics of rich nutrition, high protein, low fat, bright red meat color and the like, and is a high-quality meat resource. The yak producing areas in China are numerous, mainly comprise Qinghai, Sichuan, Gansu, Tibet, Yunnan, Xinjiang and the like, and the yaks in all producing areas form different yak varieties through long-term natural selection and artificial breeding. According to the genetic diversity analysis of yaks, the yaks in China are divided into a cross mountain type and a Tibet plateau type, and according to the structural characteristics of appearance, shape, body type and the like, 13 yak varieties are determined at present, including jiulong yaks, wheat hollow yaks, Jinchuan yaks, Tianzhu white yaks and the like. However, systematic research on yaks in different areas is not carried out in China, and particularly, the value of Tibet yaks cannot be really excavated in Tibet areas.
The Xizang Dangxongxian county is a pure pastoral county, and yaks are the main local breeding variety. Developing the authenticity identification technology of the Daniang yaks, establishing a quick, effective and low-cost method for identifying the Daniang high-mountain yaks and the non-Daniang high-mountain yaks, being beneficial to the reasonable utilization of yak resources and the protection of the diversity of yak varieties, and having important significance for improving the overall brand value of the Daniang high-mountain yak industry and protecting famous and precious local characteristic varieties of yaks and breeding and processing enterprises thereof.
A Single Nucleotide Polymorphism (SNP) is a variation species occurring most frequently in a genome, and mainly refers to a DNA sequence polymorphism caused by a variation of a single nucleotide on a genome level. SNP is a recognized third-generation genetic marker and is an important research object in the fields of population genetic analysis, disease occurrence mechanism, drug research and development and the like. At present, a database and a tool which are efficient, accurate and convenient to operate are established for SNP research, and the method has high utilization value for showing the importance of SNP in the aspects of leading the development of the fields of genetic analysis, disease diagnosis and treatment and the like. The real-time fluorescent quantitative PCR (reverse-polymerase chain reaction, RT-PCR) technology has become the mainstream technology and research trend of animal-derived component detection, and especially the development of the multiplex PCR technology is one of the most effective ways to improve the efficiency and flux of adulteration identification detection and simplify the detection process.
At present, technologies for identifying the yak variety based on RT-PCR developed according to SNP locus research are few, and mitochondrial DNA is maternal inheritance and has traceability. The mitochondrial gene has the characteristics of high evolution rate, few non-coding regions, moderate mutation rate and the like, has certain polymorphism, and can be used as a marker gene. Therefore, by utilizing the technical advantages, a convenient, low-cost, rapid and high-throughput identification method is established, and the method has important significance for improving the working efficiency and the technical level.
Disclosure of Invention
The invention aims to provide a method for identifying a high mountain yak-derived ingredient in swertia.
Another purpose of the invention is to provide an SNP marker combination for identifying the yaks in the Dangzhong mountains and the application thereof.
In order to achieve the purpose, the invention provides an SNP marker combination for identifying the yaks in the Dangshan province, wherein the SNP marker combination consists of 11 SNP sites including SNP 1-SNP 11, and the physical position of each SNP site is determined by referring to the mitochondrial genome sequence GenBank of Qinghai plateau yaks, KR011113.1: the SNP1 is located on the mitochondria at 3130bp, the polymorphism is T/C, the Daniang alpine yak is T, and the non-Daniang alpine yak is C; the SNP2 is located on the 4258bp of mitochondria, the polymorphism is G/A, the Daniang high mountain yak is G, and the non-Daniang high mountain yak is A; the SNP3 is located on the 4421bp of mitochondria, the polymorphism is C/T, the Daniang high mountain yak is C, and the non-Daniang high mountain yak is T; the SNP4 is located on the mitochondria at 9954bp, the polymorphism is G/A, the Daniang alpine yak is G, and the non-Daniang alpine yak is A; SNP5 is located on the mitochondria at the 10077bp, the polymorphism is C/T, the Daniang high mountain yak is C, and the non-Daniang high mountain yak is T; the SNP6 is located on the 11420bp of mitochondria, the polymorphism is C/T, the Daniang alpine yak is C, and the non-Daniang alpine yak is T; the SNP7 is located on the 11921bp of mitochondria, the polymorphism is A/G, the Danaiong high mountain yak is A, and the non-Danaiong high mountain yak is G; the SNP8 is located on the mitochondria at 13101bp, the polymorphism is C/T, when the yak is a male high mountain yak, the yak is a non-male high mountain yak; the SNP9 is located at 13146bp on mitochondria, the polymorphism is A/T, the Daniang high mountain yak is A, and the non-Daniang high mountain yak is T; the SNP10 is located at 14409bp on mitochondria, the polymorphism is T/C, the Daniang alpine yak is T, and the non-Daniang alpine yak is C; the SNP11 is located on the mitochondria at 15371bp, the polymorphism is C/T, when the yak is a male alpine yak, the yak is a non-male alpine yak.
In a second aspect, the invention provides primers for detecting the SNP marker combination, including 8 pairs of primers, namely Primer 1 to Primer 8, as follows:
the Primer pair Primer 1 for detecting SNP6 consists of Primer 1F and Primer 1R, and the Primer sequences are shown as SEQ ID NO: 1-2;
the Primer pair Primer 2 for detecting SNP1 consists of Primer 2F and Primer 2R, and the Primer sequences are shown as SEQ ID NO. 3-4; wherein the Primer 2R comprises 1 base mismatch site, is located on 3131bp of mitochondria (GenBank: KR 011113.1), and has a normal base of A and a mismatched base of T;
primer 3 for detecting SNP8 and SNP9, which consists of Primer 3F and Primer 3R, and the Primer sequences are shown as SEQ ID NO: 5-6;
the Primer pair Primer 4 for detecting SNP10 consists of Primer 4F and Primer 4R, and the Primer sequences are shown as SEQ ID NO: 7-8; wherein the Primer 4R comprises 1 base mismatch site, is positioned on 14410bp of mitochondria (GenBank: KR 011113.1), has a normal base of T and has a mismatch base of G;
primer pair Primer 5 for detecting SNP11, which consists of Primer 5F and Primer 5R, and the Primer sequences are shown as SEQ ID NO. 9-10; wherein the Primer 5R comprises 1 base mismatch site, is located at 15372bp on mitochondria (GenBank: KR 011113.1), and has a normal base of C and a mismatch base of A;
primer 6 for detecting SNP2 and SNP3, which consists of Primer 6F and Primer 6R, and the Primer sequences are shown as SEQ ID NO: 11-12;
primer 7 for detecting SNP7, which consists of Primer 7F and Primer 7R, and the Primer sequences are shown as SEQ ID NO 13-14; wherein the Primer 7R comprises 1 base mismatch site, is located at 11922bp on mitochondria (GenBank: KR 011113.1), and has a normal base of T and a mismatch base of A;
In a third aspect, the present invention provides a detection reagent or a kit containing the primer, or a detection product comprising a primer, a probe, and the like for detecting the SNP marker combination.
In a fourth aspect, the invention provides application of the primer or a detection reagent or kit containing the primer in identification, breeding or source component identification of the yak in alpine region.
In a fifth aspect, the invention provides a method for identifying a high mountain yak-derived ingredient in swertia, which comprises the following steps: extracting DNA of a sample to be detected, carrying out real-time fluorescence quantitative PCR by using the primers, detecting genotypes of 11 SNP sites, and judging whether the sample to be detected contains the yak-derived ingredients in the Dang dynasty by comparing whether a melting curve peak of an amplification product has a corresponding positive peak type.
In the method, the Primer pairs Primer 1 to Primer 3 are preferably added to the same reaction well or reaction tube to perform triple real-time fluorescence quantitative PCR reaction;
adding Primer pairs Primer 4-Primer 6 into the same reaction hole or reaction tube, and carrying out triple real-time fluorescent quantitative PCR reaction;
adding Primer pair Primer 7 and Primer 8 into the same reaction hole or reaction tube, and carrying out double real-time fluorescence quantitative PCR reaction. The primers are grouped according to the Tm value of the product. The primers in the group have better specificity and no cross amplification. Different products in the same group correspond to different Tm values, and can be quickly and accurately distinguished by using an RT-PCR melting curve method.
The three reactions can be carried out simultaneously or separately.
Further, the real-time fluorescent quantitative PCR reaction system is as follows:
reaction system 1: 12.5 mu L of SYBR Green Master premix, 0.1-0.3 mu L of Primer 1F, 0.1-0.3 mu L of Primer 1R, 0.1-0.3 mu L of Primer 2F, 0.1-0.3 mu L of Primer 2R, 1.1-1.3 mu L of Primer 3F, 1.1-1.3 mu L of Primer 3R, 2 mu L of template DNA and deionized water to make up the system to 25 mu L; preferably, reaction system 1: 12.5. mu.L of SYBR Green Master premix, 0.2. mu.L of Primer 1F, 0.2. mu.L of Primer 1R, 0.2. mu.L of Primer 2F, 0.2. mu.L of Primer 2R, 1.2. mu.L of Primer 3F, 1.2. mu.L of Primer 3R, 2. mu.L of template DNA, and the balance of deionized water to 25. mu.L.
Reaction system 2: 12.5 mu L of SYBR Green Master premix, 0.3-0.5 mu L of Primer 4F, 0.3-0.5 mu L of Primer 4R, 0.1-0.3 mu L of Primer 5F, 0.1-0.3 mu L of Primer 5R, 0.4-0.6 mu L of Primer 6F, 0.4-0.6 mu L of Primer 6R, 2 mu L of template DNA and deionized water to make up the system to 25 mu L; preferably, reaction system 2: SYBR Green Master premix 12.5. mu.L, Primer 4F 0.4. mu.L, Primer 4R 0.4. mu.L, Primer 5F 0.2. mu.L, Primer 5R 0.2. mu.L, Primer 6F 0.5. mu.L, Primer 6R 0.5. mu.L, template DNA 2. mu.L, deionized water make up to 25. mu.L.
Reaction system 3: 12.5 mu L of SYBR Green Master premix, 0.3-0.5 mu L of Primer 7F, 0.3-0.5 mu L of Primer 7R, 0.4-0.6 mu L of Primer 8F, 0.4-0.6 mu L of Primer 8R, 2 mu L of template DNA and deionized water to make up the system to 25 mu L; preferably, reaction system 3: 12.5. mu.L of SYBR Green Master premix, 0.4. mu.L of Primer 7F, 0.4. mu.L of Primer 7R, 0.5. mu.L of Primer 8F, 0.5. mu.L of Primer 8R, 2. mu.L of template DNA, and a complement of deionized water to 25. mu.L.
Wherein the concentration of the template DNA was 0.5 ng/. mu.L, and the concentration of the primer was 5. mu.M.
The real-time fluorescent quantitative PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10 s, annealing at 57 ℃ and elongation for 45s for 30 cycles.
Preferably, the melting curve is prepared under the following conditions: heating to 95 deg.C at a rate of 0.02 deg.C/s at 95 deg.C for 1min, 65 deg.C for 1min, continuously monitoring fluorescence intensity, and cooling to 40 deg.C for 1 min; then, a melting curve is prepared by using the first negative derivative of the fluorescence signal with respect to temperature as the ordinate and the temperature as the abscissa.
Judging whether the sample to be detected contains the yak-derived ingredients in the high mountains of the Dangerg according to the number of the melting curve peaks and whether the melting curve peaks appear at corresponding positions;
amplification products corresponding to the Primer pairs Primer 1 to Primer 8 are respectively P1 to P8, and the melting curve peak Tm values are respectively as follows:
P1：73.1~75.2℃，P2：76.0~77.3℃，P3：79.0~80.0℃；
P4：69.5~72.8℃，P5：75.0~77.9℃，P6：78.5~80.0℃；
P7：76.2~78.1℃，P8：79.5~80.7℃。
by the technical scheme, the invention at least has the following advantages and beneficial effects:
according to the invention, the technology for identifying the yak variety based on the RT-PCR is developed according to the SNP sites, 8 pairs of primers with higher specificity are designed through the combination of 11 SNP sites, and the melting peak information of up to 8 amplification products can be obtained by only 3 reaction holes/reaction tubes in one group of RT-PCR detection, so that the high efficiency and high flux are realized, the detection process is simplified, and the judgment result is accurate.
The method provides a powerful tool for identifying the Daniang high-mountain yak, is beneficial to the reasonable utilization of yak resources and the protection of the diversity of yak varieties, and has important significance for improving the overall brand value of the Daniang high-mountain yak industry and protecting famous and precious local characteristic varieties of yaks and breeding and processing enterprises thereof.
Drawings
FIG. 1 is a peak spectrum of RT-PCR melting curve in the preferred embodiment of the present invention, and the reaction well A is a sample (part) of Daniang high mountain yak. All samples are shown with three product peaks corresponding to P1-P3.
FIG. 2 is a peak spectrum of RT-PCR melting curve in the preferred embodiment of the present invention, and the reaction well B is a sample (part) of Daniang alpine yak. All samples are shown with three product peaks corresponding to P4-P6.
FIG. 3 is a peak spectrum of RT-PCR melting curve in the preferred embodiment of the present invention, and the C reaction well is a sample (part) of Daniang alpine yak. Two product peaks corresponding to P7, P8 are shown for all samples.
FIG. 4 is a peak spectrum of RT-PCR melting curve in the preferred embodiment of the present invention, and A, B, C reaction wells are (partial) of Dang-male and non-Dang-male alpine yak samples. In the illustrated sample, the swertia alpine yak sample has all product peaks corresponding to P1-P8, and the non-swertia alpine yak sample lacks one product peak corresponding to P1-P8.
FIG. 5 is a peak spectrum of a melting curve of RT-PCR in a preferred embodiment of the present invention, and A, B, C reaction wells are (parts of) a commercial Dang dynasty yak sample. In the illustrated sample, the commercial dank yak sample has all product peaks corresponding to P1-P8.
FIG. 6 is a peak spectrum of a melting curve of RT-PCR in a preferred embodiment of the invention, and A, B, C reaction wells are (parts of) a commercial sample of a non-heroic yak. In the sample shown in the figure, the product peak corresponding to one P1-P8 is lacked in the sample of the commercial non-heroic yak.
Detailed Description
The invention provides an application of detecting the genotype of 11 SNP locus combinations in mitochondria of a yak sample to be detected in identification or auxiliary identification of whether the sample is a Daniang alpine yak or a non-Daniang alpine yak; whether the detected sample is the sample of the current yak can be judged by comparing whether the melting curve peak of the RT-PCR product has a corresponding peak type.
The invention adopts the following technical scheme:
the invention firstly provides a specific Primer combination for identifying the alpine yaks, wherein the Primer combination contains 8 pairs of specific Primer pairs (Primer 1-Primer 8) and totally contains 11 SNP sites.
The SNP loci are respectively as follows: 3130 base of KR011113.1 is located at 3130 th site of mitochondria, T is Yak in Dang-xiong mountain, and C is Yak in not Dang-xiong mountain; KR011113.1, 4258 is located on 4258 th base of mitochondria, G is from Heng high mountain yak, A is from non-Heng high mountain yak; KR011113.1, 4421 is located at 4421 th basic group on mitochondria, and when the yak is male, the yak is C, and when the yak is not male, the yak is T; 9954, KR011113.1: 9954 is located at 9954 th base on mitochondria, and the Hengxiong alpine yak is G and the Nongxiong alpine yak is A; KR011113.1, 10077 is located at 10077 th base of mitochondria, and when the yak is a male high mountain yak, the yak is a non-male high mountain yak, the yak is C; KR011113.1: 11420 is located at 11420 th base of mitochondria, and when the yak is a male high mountain yak, the yak is a non-male high mountain yak, the yak is C; KR011113.1, 11921 is located at 11921 th base of mitochondria, the yak in Dang xiong mountain is A, the yak in not Dang xiong mountain is G; KR011113.1, 13101 is located on 13101 th base of mitochondria, and when the yak is a male high mountain yak, the yak is a non-male high mountain yak, the yak is a C; KR011113.1, 13146 is located at 13146 th base of mitochondria, and the yak in Dang-Xiong mountain is A and the yak in not Dang-Xiong mountain is T; KR011113.1, 14409 is located at 14409 th base of mitochondria, and the yak in Dang-Xiong mountain is T and the yak in not Dang-Xiong mountain is C; KR011113.1: 15371 is located at 15371 th base of mitochondria, and is C when the yak is male and T when the yak is not male.
The invention further provides a detection reagent or a kit containing the specific primer combination and application of the detection reagent or the kit in identifying the anoplophora yak.
The method comprises the steps of amplifying positive samples of the yaks in the alpine region to obtain 8 amplification products respectively, placing primers shown by Primer 1-Primer 3 corresponding to amplification products P1-P3 in a reaction hole A, placing primers shown by Primer 4-Primer 6 corresponding to amplification products P4-P6 in a reaction hole B, placing primers shown by Primer 7-Primer 8 corresponding to amplification products P7 and P8 in a reaction hole C, and simultaneously carrying out RT-PCR reactions of 2 triples and 1 doublet.
The specific primer sequences of the A reaction wells are as follows:
the specific primers required for amplification of product P1 were (SEQ ID NOS: 1-2):
Primer 1F：5'- CCTGATACTAATAGCTAGCCAACAT -3'
Primer 1R：5'- TGGTACTAGTGTTGCTTCAAATAGG -3'
the specific primers required for amplification of product P2 were (SEQ ID NOS: 3-4):
Primer 2F：5'- TGGAGCTTTAACTAACCAACCC -3'
Primer 2R：5'- GAGGTCACCCCAACCGAAACAA -3'
the specific primers required for amplification of product P3 were (SEQ ID NOS: 5-6):
Primer 3F：5'- AATTATATCATTTCTACTC -3'
Primer 3R：5'- GTTATATAAAACTGCTTGT -3'
the specific primer sequences of the reaction wells B are as follows:
the specific primers required for amplification of product P4 were (SEQ ID NOS: 7-8):
Primer 4F：5'- CAAACCAAAAAGGCCTAATC -3'
Primer 4R：5'- TGCTAATGAGAATTGTAATTAGGACA -3'
the specific primers required for amplification of product P5 were (SEQ ID NOS: 9-10):
Primer 5F：5'- AACGGAGCTTCAATATTCTTTATCT -3'
Primer 5R：5'- TACTCCAATATTTCATGTTTCTATG -3'
the specific primers required for amplification of product P6 were (SEQ ID NOS: 11-12):
Primer 6F：5'- AGAATCAGAGCTAGTCTCG -3'
Primer 6R：5'- GGAATAATATTGTGAGTAGCAG -3'
c reaction hole each specificity primer sequence as follows:
the specific primers required for amplification of product P7 were (SEQ ID NOS: 13-14):
Primer 7F：5'- TCAATCTGCCTCCGTCAAACG -3'
Primer 7R：5'- TGCTATGTGGCTTACAGAAGAGTTT -3'
the specific primers required for amplification of product P8 were (SEQ ID NOS: 15-16):
Primer 8F：5'- CCTGAGCCCATCATAGTCTG -3'
Primer 8R：5'- ACGAAAAAAGTTGAGCCGTAGAC -3'
the real-time fluorescent quantitative PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10 s, annealing at 57 ℃ and elongation for 45s for 30 cycles.
The Tm values of melting curve peaks of the amplification product fragments P1-P8 of the 8 pairs of specific primer pairs are as follows:
the method for identifying whether the yak to be detected is the yak in the Dang Xiong mountain is further provided by the invention, the Primer 1-Primer 8 Primer combination provided by the invention is utilized, the DNA of meat or meat products to be detected is used as a template, 2 triple and 1 double RT-PCR reactions are simultaneously carried out, and whether an unknown yak sample is the yak in the Dang Xiong mountain is judged according to the number of melting curve peaks and whether the peaks appear at corresponding positions.
The preparation method of the template comprises the following steps: mixing the meat or meat product with the sterilized and deionized double distilled water in a ratio of 1:4, and homogenizing the mixture for 10 to 15 minutes by a tissue homogenizer at 10000 to 12000 r/min to prepare tissue homogenate. The total DNA of the sample genome was extracted using a tissue DNA extraction kit.
Further, in the RT-PCR method, the 25 muL RT-PCR reaction system is as follows:
the real-time fluorescent quantitative PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10 s, annealing at 57 ℃ and elongation for 45s for 30 cycles.
The RT-PCR melting curve conditions are as follows: heating to 95 deg.C at a rate of 0.02 deg.C/s for 95 deg.C, 1min, 65 deg.C, 1min, continuously monitoring fluorescence intensity, and cooling to 40 deg.C for 1 min. And taking the first negative derivative of the fluorescence signal to the temperature as the ordinate and the temperature as the abscissa to obtain a melting curve peak diagram.
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions as recommended by the manufacturer's instructions.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The main apparatus comprises: real-time fluorescent PCR instruments (Roche 480 II, Switzerland), high-speed desktop centrifuges (Eppendorf 5417R, Germany), micropipettes (2.5. mu.L, 10. mu.L, 100. mu.L, 1000. mu.L), homogenizers (Omni Prep, USA), fluorescence microplate readers (Bio tek Synergy H4, USA), and the like. The main reagents are as follows: DNA extraction kits for blood and animal tissue were purchased from Qiagen; SYBR Green I Master premix was purchased from Roche; the primers were synthesized by Enwei fundi (Shanghai) trade Co., Ltd.
Example 1 ability of SNP site combination to discriminate Dang Xiong alpine yaks
The total number of pig mitochondrial genes is 218 through NCBI website (https:// www.ncbi.nlm.nih.gov /) downloading, sample sequencing and other modes, and the method is used for constructing the identification method of the yak in the Dangzhong mountain, wherein 95 yak mitochondrial genes are obtained through the NCBI website downloading, and 123 mitochondrial genes are obtained through DNA sequencing of the yak meat sample. Amplifying and sequencing swertia alpina yak samples and non-swertia alpina yak samples (sampling areas are Qinghai Christian county, Qinghai Qilian county, Sichuan Hongyuan county and Gansu) to obtain mitochondrial DNA sequence information.
And (3) carrying out sequence information processing and SNP site screening by using a Python compiling program, selecting SNP sites which are conservative for the yaks in the same place and have high polymorphism for other non-yaks in the same place, and selecting 11 sites from 896 sites to be used as a characteristic marker for identifying whether the yaks in the same place are yaks in the same place. The identification accuracy rate is theoretically more than 93.8%.
8 pairs of specific primers (Table 1, SEQ ID NO: 1-16) were designed based on the above 11 SNP sites, as follows:
example 2 RT-PCR reaction System and test results
1. DNA extraction
DNA of swertia alpina yak and non-swertia alpina yak (sampled regions are Qinghai Christian county, Qinghai Qilian county, Sichuan Hongyuan county and Gansu, respectively) is extracted by using a DNA extraction kit for DNeasy animal tissues, and the operation is performed according to the kit specification, or other extraction methods which are recognized to have the same effect are adopted. And (3) measuring the light absorption values of the extracted DNA at 260 nm and 280 nm by using a fluorescence microplate reader, and calculating the concentration and the purity of the DNA. The quality-control DNA was adjusted to a concentration of 0.5 ng/. mu.L and stored at-20 ℃ for further use.
2. Primer sequences
The specific primer sequences of the A reaction wells are as follows:
specific primers required for amplification of product P1 were:
Primer 1F：5'- CCTGATACTAATAGCTAGCCAACAT -3'
Primer 1R：5'- TGGTACTAGTGTTGCTTCAAATAGG -3'
specific primers required for amplification of product P2 were:
Primer 2F：5'- TGGAGCTTTAACTAACCAACCC -3'
Primer 2R：5'- GAGGTCACCCCAACCGAAACAA -3'
specific primers required for amplification of product P3 were:
Primer 3F：5'- AATTATATCATTTCTACTC -3'
Primer 3R：5'- GTTATATAAAACTGCTTGT -3'
the specific primer sequences of the reaction wells B are as follows:
specific primers required for amplification of product P4 were:
Primer 4F：5'- CAAACCAAAAAGGCCTAATC -3'
Primer 4R：5'- TGCTAATGAGAATTGTAATTAGGACA -3'
specific primers required for amplification of product P5 were:
Primer 5F：5'- AACGGAGCTTCAATATTCTTTATCT -3'
Primer 5R：5'- TACTCCAATATTTCATGTTTCTATG -3'
specific primers required for amplification of product P6 were:
Primer 6F：5'- AGAATCAGAGCTAGTCTCG -3'
Primer 6R：5'- GGAATAATATTGTGAGTAGCAG -3'
c reaction hole each specificity primer sequence as follows:
specific primers required for amplification of product P7 were:
Primer 7F：5'- TCAATCTGCCTCCGTCAAACG -3'
Primer 7R：5'- TGCTATGTGGCTTACAGAAGAGTTT -3'
specific primers required for amplification of product P8 were:
Primer 8F：5'- CCTGAGCCCATCATAGTCTG -3'
Primer 8R：5'- ACGAAAAAAGTTGAGCCGTAGAC -3'
3. RT-PCR reaction optimization experiment
And (3) comparing the peaks of the fusion products of the same sample in each optimization experiment, and selecting a reaction system corresponding to the optimal peak shape of the sample by integrating all the samples to determine the optimal reaction system.
3.1 reaction System optimization experiment
Placing the primers shown by Primer 1-Primer 3 in the reaction hole A, placing the primers shown by Primer 4-Primer 6 in the reaction hole B, placing the primers shown by Primer 7-Primer 8 in the reaction hole C, and simultaneously carrying out RT-PCR reactions of 2 triplets and 1 doublet. Wherein, 2 μ L of template DNA with the concentration of 0.5ng/μ L is fixed and added, the addition amount of 0.1-1.5 μ L of each primer group (with the concentration of 5 μmol/L) is tried, and deionized water is filled to 25 μ L, so that the proportion of each primer group is optimized.
3.2 reaction condition optimization experiment
The annealing and elongation temperatures (56 ℃, 58 ℃, 60 ℃, 62 ℃), the annealing elongation times (15 s, 30s, 45s, 60 s) and the cycle numbers (25, 30, 35, 40) were optimized.
4. Optimization of RT-PCR reaction
Placing the primers shown by the primers 1 to 3 in the reaction hole A, placing the primers shown by the primers 4 to 6 in the reaction hole B, placing the primers shown by the primers 7 to 8 in the reaction hole C, and simultaneously performing 2 times of triple and 1 time of double RT-PCR reactions, wherein a 25 mu L RT-PCR reaction system is shown in Table 2:
the RT-PCR melting curve conditions are as follows: heating to 95 deg.C at a rate of 0.02 deg.C/s for 95 deg.C, 1min, 65 deg.C, 1min, continuously monitoring fluorescence intensity, and cooling to 40 deg.C for 1 min. And taking the first negative derivative of the fluorescence signal to the temperature as the ordinate and the temperature as the abscissa to obtain a melting curve peak diagram.
5. Melting curve analysis
Comparing the peak diagrams of RT-PCR melting curves of A, B, C reaction wells (fig. 1-4), wherein the positive alpine yak sample should have all product peaks P1-P8, and the corresponding Tm values of the melting curves are as follows (table 3):
example 3 sample testing and method accuracy review
1. Collecting sample, preparing template
50 yaks in the Daniang mountain and 50 yaks in the non-Daniang mountain are collected respectively and used for verifying the accuracy of the method. According to the DNA extraction method in the example 2, DNA of the anomala alpine yak and the anomala alpine yak is respectively extracted, and the DNA concentration and the purity are calculated. And (5) diluting the concentration of the DNA samples to 0.5 ng/mu L to be used as a detection template.
2. Multiple RT-PCR reaction verification
Referring to the RT-PCR reaction procedure in example 2, RT-PCR melting curve analysis was performed on 100 samples of DNA templates, synchronously or separately, in A, B, C reaction wells, to calculate Tm values and count the number of melting curve peaks.
3. Sample validation and method accuracy
All 8 melting curve product peaks have corresponding positive peak types, and then the yak is judged to be the alpine yak; and the yaks without any product peak are judged to be non-heroic alpine yaks (figures 5-6). The determination accuracy is shown in table 4:
of the total 100 samples, 18 false positives were determined, and the remaining 82 samples were determined to be correct, with an overall accuracy of 82%. Wherein, all 50 samples of the Dangzhong alpine yaks are judged correctly, and the positive judgment accuracy is 100%; the judgment of 32 samples of the anorthose alpine yaks is correct, and the negative judgment accuracy rate is 64%.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> China meat food comprehensive research center
<120> identification method of angelica alpine yak-derived components
<130> KHP201114978.3YS
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cctgatacta atagctagcc aacat 25
<210> 2
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tggtactagt gttgcttcaa atagg 25
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tggagcttta actaaccaac cc 22
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gaggtcaccc caaccgaaac aa 22
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aattatatca tttctactc 19
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gttatataaa actgcttgt 19
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
caaaccaaaa aggcctaatc 20
<210> 8
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tgctaatgag aattgtaatt aggaca 26
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
aacggagctt caatattctt tatct 25
<210> 10
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tactccaata tttcatgttt ctatg 25
<210> 11
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
agaatcagag ctagtctcg 19
<210> 12
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ggaataatat tgtgagtagc ag 22
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tcaatctgcc tccgtcaaac g 21
<210> 14
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
tgctatgtgg cttacagaag agttt 25
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cctgagccca tcatagtctg 20
<210> 16
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
acgaaaaaag ttgagccgta gac 23
Claims (8)
1. The detection primer for identifying the SNP marker combination of the Dang Xiong Gaoshan yak is characterized in that the SNP marker combination for identifying the Dang Xiong Gaoshan yak consists of 11 SNP sites of SNP 1-SNP 11, and the physical position of each SNP site is determined by referring to the mitochondrial genome sequence GenBank of Qinghai plateau yak, KR011113.1: the SNP1 is located on the mitochondria at 3130bp, the polymorphism is T/C, the Daniang alpine yak is T, and the non-Daniang alpine yak is C; the SNP2 is located on the 4258bp of mitochondria, the polymorphism is G/A, the Daniang high mountain yak is G, and the non-Daniang high mountain yak is A; the SNP3 is located on the 4421bp of mitochondria, the polymorphism is C/T, the Daniang high mountain yak is C, and the non-Daniang high mountain yak is T; the SNP4 is located on the mitochondria at 9954bp, the polymorphism is G/A, the Daniang alpine yak is G, and the non-Daniang alpine yak is A; SNP5 is located on the mitochondria at the 10077bp, the polymorphism is C/T, the Daniang high mountain yak is C, and the non-Daniang high mountain yak is T; the SNP6 is located on the 11420bp of mitochondria, the polymorphism is C/T, the Daniang alpine yak is C, and the non-Daniang alpine yak is T; the SNP7 is located on the 11921bp of mitochondria, the polymorphism is A/G, the Danaiong high mountain yak is A, and the non-Danaiong high mountain yak is G; the SNP8 is located on the mitochondria at 13101bp, the polymorphism is C/T, when the yak is a male high mountain yak, the yak is a non-male high mountain yak; the SNP9 is located at 13146bp on mitochondria, the polymorphism is A/T, the Daniang high mountain yak is A, and the non-Daniang high mountain yak is T; the SNP10 is located at 14409bp on mitochondria, the polymorphism is T/C, the Daniang alpine yak is T, and the non-Daniang alpine yak is C; the SNP11 is located on the mitochondria at 15371bp, the polymorphism is C/T, when the yak is C, the yak is T;
the detection primers comprise 8 pairs of primers including a Primer pair Primer 1-Primer 8, and specifically comprise the following components:
the Primer pair Primer 1 for detecting SNP6 consists of Primer 1F and Primer 1R, and the Primer sequences are shown as SEQ ID NO: 1-2;
the Primer pair Primer 2 for detecting SNP1 consists of Primer 2F and Primer 2R, and the Primer sequences are shown as SEQ ID NO. 3-4; wherein the Primer 2R comprises 1 base mismatch site which is positioned on the 3131bp on mitochondria, the normal base is A, and the mismatch base is T;
primer 3 for detecting SNP8 and SNP9, which consists of Primer 3F and Primer 3R, and the Primer sequences are shown as SEQ ID NO: 5-6;
the Primer pair Primer 4 for detecting SNP10 consists of Primer 4F and Primer 4R, and the Primer sequences are shown as SEQ ID NO: 7-8; wherein the Primer 4R comprises 1 base mismatch site, is positioned on the 14410bp of mitochondria, has a normal base of T and a mismatch base of G;
primer pair Primer 5 for detecting SNP11, which consists of Primer 5F and Primer 5R, and the Primer sequences are shown as SEQ ID NO. 9-10; wherein the Primer 5R comprises 1 base mismatch site, is located at 15372bp on mitochondria, has a normal base C and a mismatch base A;
primer 6 for detecting SNP2 and SNP3, which consists of Primer 6F and Primer 6R, and the Primer sequences are shown as SEQ ID NO: 11-12;
primer 7 for detecting SNP7, which consists of Primer 7F and Primer 7R, and the Primer sequences are shown as SEQ ID NO 13-14; wherein the Primer 7R comprises 1 base mismatch site, is positioned on the 11922bp on mitochondria, has a normal base of T and a mismatch base of A;
primer 8 used for detecting SNP4 and SNP5, which consists of Primer 8F and Primer 8R, and the Primer sequences are shown as SEQ ID NO: 15-16;
wherein the base mismatching site is determined by referring to the Qinghai plateau yak mitochondrial genome sequence GenBank: KR 011113.1.
2. A detection reagent or kit comprising the primer of claim 1.
3. The primer of claim 1 or the detection reagent or the kit of claim 2, wherein the primer is used for identifying, breeding or identifying the source components of the yak.
4. The identification method of the angelica alpine yak-derived component is characterized by comprising the following steps: extracting DNA of a sample to be detected, and detecting genotypes of 11 SNP sites by using the primer of claim 1 to perform real-time fluorescent quantitative PCR;
adding Primer pairs Primer 1-Primer 3 into the same reaction hole or reaction tube, and carrying out triple real-time fluorescent quantitative PCR reaction;
adding Primer pairs Primer 4-Primer 6 into the same reaction hole or reaction tube, and carrying out triple real-time fluorescent quantitative PCR reaction;
adding Primer 7 and Primer 8 of the Primer pair into the same reaction hole or reaction tube, and carrying out double real-time fluorescence quantitative PCR reaction;
the three reactions can be carried out synchronously or respectively;
and judging whether the sample to be detected contains the yak source ingredients of the Dang dynasty according to the number of the melting curve peaks and whether the melting curve peaks appear at corresponding positions, and judging the yak of the Dang dynasty if all 8 melting curve product peaks have corresponding positive peak types.
5. The method of claim 4, wherein the real-time fluorescent quantitative PCR reaction system comprises:
reaction system 1: 12.5 mu L of SYBR Green Master premix, 0.1-0.3 mu L of Primer 1F, 0.1-0.3 mu L of Primer 1R, 0.1-0.3 mu L of Primer 2F, 0.1-0.3 mu L of Primer 2R, 1.1-1.3 mu L of Primer 3F, 1.1-1.3 mu L of Primer 3R, 2 mu L of template DNA and deionized water to make up the system to 25 mu L;
reaction system 2: 12.5 mu L of SYBR Green Master premix, 0.3-0.5 mu L of Primer 4F, 0.3-0.5 mu L of Primer 4R, 0.1-0.3 mu L of Primer 5F, 0.1-0.3 mu L of Primer 5R, 0.4-0.6 mu L of Primer 6F, 0.4-0.6 mu L of Primer 6R, 2 mu L of template DNA and deionized water to make up the system to 25 mu L;
reaction system 3: 12.5 mu L of SYBR Green Master premix, 0.3-0.5 mu L of Primer 7F, 0.3-0.5 mu L of Primer 7R, 0.4-0.6 mu L of Primer 8F, 0.4-0.6 mu L of Primer 8R, 2 mu L of template DNA and deionized water to make up the system to 25 mu L;
wherein the concentration of the template DNA was 0.5 ng/. mu.L, and the concentration of the primer was 5. mu.M.
6. The method of claim 4, wherein the real-time fluorescent quantitative PCR reaction conditions are: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 10 s, annealing at 57 ℃ and elongation for 45s for 30 cycles.
7. The method according to claim 4, wherein the melting curve is prepared under the following conditions: heating to 95 deg.C at a rate of 0.02 deg.C/s at 95 deg.C for 1min, 65 deg.C for 1min, continuously monitoring fluorescence intensity, and cooling to 40 deg.C for 1 min; then, a melting curve is prepared by using the first negative derivative of the fluorescence signal with respect to temperature as the ordinate and the temperature as the abscissa.
8. The method according to any one of claims 4 to 7, wherein the amplification products for Primer pairs Primer 1 to Primer 8 are P1 to P8, respectively, and the melting curve peak Tm values are as follows:
P1：73.1~75.2℃，P2：76.0~77.3℃，P3：79.0~80.0℃；
P4：69.5~72.8℃，P5：75.0~77.9℃，P6：78.5~80.0℃；
P7：76.2~78.1℃，P8：79.5~80.7℃。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010932120.0A CN111808976B (en) | 2020-09-08 | 2020-09-08 | Method for identifying angelica alpine yak-derived components |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010932120.0A CN111808976B (en) | 2020-09-08 | 2020-09-08 | Method for identifying angelica alpine yak-derived components |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111808976A CN111808976A (en) | 2020-10-23 |
| CN111808976B true CN111808976B (en) | 2020-12-25 |
Family
ID=72860032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010932120.0A Active CN111808976B (en) | 2020-09-08 | 2020-09-08 | Method for identifying angelica alpine yak-derived components |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111808976B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108251540A (en) * | 2018-02-07 | 2018-07-06 | 西藏自治区农牧科学院畜牧兽医研究所 | The application of yak full-length genome SNP site and detection primer sets and kit |
-
2020
- 2020-09-08 CN CN202010932120.0A patent/CN111808976B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108251540A (en) * | 2018-02-07 | 2018-07-06 | 西藏自治区农牧科学院畜牧兽医研究所 | The application of yak full-length genome SNP site and detection primer sets and kit |
Non-Patent Citations (5)
| Title |
|---|
| Diversity Analysis of Chinese Tibetan Naqu Yak (Bos grunniens) Populations Using mtDNA;Wang-Dui Basang等;《Pakistan J. Zool.》;20180831;第50卷(第6期);2051-2057 * |
| GenBank：KR011113.1;GUO，X.;《NCBI》;20150511;全文 * |
| Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene;Q.Q.Song等;《Genetics and Molecular Research》;20150313;第14卷(第1期);1763-1770 * |
| 中国耗牛线粒体DNA多态性及遗传分化;涂正超 等;《遗传学报》;19981231;第25卷(第3期);205-212 * |
| 中国部分牦牛品种线粒体DNA遗传多态性研究;赖松家 等;《遗传学报》;20050531;第32卷(第5期);463-470 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111808976A (en) | 2020-10-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105969879B (en) | Primer group for high-throughput detection of AhFAD2A gene mutation site typing and detection method | |
| CN107523643A (en) | A kind of method and its dedicated kit of ox KCNJ12 gene Cs NV marks auxiliary detection growth traits | |
| CN107385028B (en) | Target sequence complementary quenching probe for detecting beta globin gene point mutation and kit thereof | |
| CN112195264A (en) | SNP (Single nucleotide polymorphism) locus and primer set for identifying purity of tomato hybrid and application | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN107338287B (en) | Kit and method for detecting sheep BMPR-IB gene A746G mutation by Taqman-MGB probe | |
| CN107287283B (en) | High-throughput detection kit for multiple SNP sites related to children susceptibility diseases and use method thereof | |
| CN114606332B (en) | SNP locus for judging pulp hardness of watermelon, hf-KASP1 marker and application thereof | |
| CN111808976B (en) | Method for identifying angelica alpine yak-derived components | |
| CN111378781A (en) | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application | |
| CN113564266B (en) | SNP typing genetic marker combination, detection kit and application | |
| CN116083592A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN113355449B (en) | Elytrigia elongata 3E chromosome specific codominant KASP molecular marker and application thereof | |
| CN112251535B (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN115044682A (en) | Molecular marker related to growth traits of Hu sheep, detection method and application thereof | |
| CN112111579B (en) | Identification method of Tan sheep derived components | |
| CN108330213B (en) | Method for simultaneously carrying out HBV DNA quantification, genotyping and RT region mutation detection | |
| CN103757110B (en) | A kind of vibrio cholerae analyzes parting kit | |
| CN112111580B (en) | Identification method of Qingyu pig source components | |
| CN107083429B (en) | A kind of SNP parting kit and its application for the detection of atrial fibrillation tumor susceptibility gene | |
| CN108642190A (en) | Forensic medicine composite detection kit based on 14 autosome SNP genetic markers | |
| CN114717336B (en) | Molecular marker related to sheep viscera weight and application thereof | |
| CN111850142B (en) | Difference INDEL between commercial bumblebee and wild bumblebee, molecular marker and application thereof | |
| CN115323060B (en) | Fish nuclear gene molecular marker primer, molecular marker and molecular marker database | |
| CN116574793A (en) | Rapid typing kit for halothane genes of pigs and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |