CN111808791A - Reconstructed methyl engineering bacterium for synergistic assimilation of methanol by ribulose monophosphate pathway and serine circulation pathway and application thereof - Google Patents

Reconstructed methyl engineering bacterium for synergistic assimilation of methanol by ribulose monophosphate pathway and serine circulation pathway and application thereof Download PDF

Info

Publication number
CN111808791A
CN111808791A CN202010644619.1A CN202010644619A CN111808791A CN 111808791 A CN111808791 A CN 111808791A CN 202010644619 A CN202010644619 A CN 202010644619A CN 111808791 A CN111808791 A CN 111808791A
Authority
CN
China
Prior art keywords
hexulose
phosphate
gene
ala
coding gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
CN202010644619.1A
Other languages
Chinese (zh)
Inventor
杨松
陈文静
袁肖杰
莫旭华
马增新
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Agricultural University
Original Assignee
Qingdao Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Agricultural University filed Critical Qingdao Agricultural University
Priority to CN202010644619.1A priority Critical patent/CN111808791A/en
Publication of CN111808791A publication Critical patent/CN111808791A/en
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01001—Alcohol dehydrogenase (1.1.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01049—Glucose-6-phosphate dehydrogenase (1.1.1.49)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01075—Malonyl CoA reductase (malonate semialdehyde-forming)(1.2.1.75)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01001—Transketolase (2.2.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01002—Transaldolase (2.2.1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01006—Acetolactate synthase (2.2.1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01011—6-Phosphofructokinase (2.7.1.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01056—1-Phosphofructokinase (2.7.1.56)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01071—2-Oxoglutarate decarboxylase (4.1.1.71)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/02—Aldehyde-lyases (4.1.2)
    • C12Y401/02043—3-Hexulose-6-phosphate synthase (4.1.2.43)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y503/00—Intramolecular oxidoreductases (5.3)
    • C12Y503/01—Intramolecular oxidoreductases (5.3) interconverting aldoses and ketoses (5.3.1)
    • C12Y503/01027—6-Phospho-3-hexuloisomerase (5.3.1.27)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides a reconstructed methyl engineering bacterium for synergetically assimilating methanol by utilizing a ribulose monophosphate path and a serine circulating path and application thereof, belonging to the technical field of genetic engineering; the host bacteria of the reconstructed methyl engineering bacteria comprise methylotrophic bacteria naturally utilizing serine circulation to assimilate methanol; the exogenous genes introduced into the reconstructed methyl engineering bacteria comprise a coding gene of hexulose-6-phosphate synthase and a coding gene of hexulose-6-phosphate isomerase. The method takes methanol as a unique carbon source and energy source and methylotrophic bacteria which naturally utilizes a serine circulation path to assimilate the methanol as an initial host, introduces a gene hps for heterologous expression coding of the hexulose-6-phosphate synthase and a gene phi for heterologous expression coding of the hexulose-6-phosphate isomerase into the initial host, realizes the construction of a ribulose monophosphate path, and thus utilizes the ribulose monophosphate path and the serine circulation path to assimilate the methanol in a synergistic manner.

Description

Reconstructed methyl engineering bacterium for synergistic assimilation of methanol by ribulose monophosphate pathway and serine circulation pathway and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a reconstructed methyl engineering bacterium for synergetically assimilating methanol by utilizing a ribulose monophosphate pathway and a serine circulating pathway and application thereof.
Background
Methylotrophs (Methylotrophs) are a class of bacteria that can grow on organic carbon such as methane, methanol, formic acid, methylammonium and the like as a sole carbon and energy source. At present, methylotrophic bacteria are divided into two main types according to different assimilation and metabolism pathways, wherein one type is methylotrophic bacteria (such as Bacillus methylotrophus MGA3, Methylobacillus flagellatus KT and Methylococcus capsulatus Bath) which assimilate organic carbon-intermediate metabolite formaldehyde by utilizing a Ribulose monophosphate pathway (Ribulose monophosphonate pathway), and C6 intermediate metabolites (such as fructose-6-phosphate) generated by the assimilation process are converted into C3 intermediate metabolites (such as pyruvic acid) through an ED (Entner Doudoroff pathway) pathway and a Glycolysis pathway (Glycolsis, also called EMP pathway); another is methylotrophic bacteria (such as methylrubrum extrorques AM1, Methylosinus trichosporium OB3b) which assimilate the organic carbon-intermediate formate using the serine cycle pathway (Serineycete), which synthesizes the C2 intermediate, acetyl-coenzyme A, C3 intermediate (e.g., serine) and the C4 intermediate (e.g., malic acid). In recent years, a series of metabolic engineering improvement researches are carried out on methylotrophic bacteria M.exotorquens which utilize serine to cyclically assimilate organic carbon (such as methanol), so that the conversion of methanol into 2-hydroxyisobutyric acid, mesaconic acid, (2S) -methylsuccinic acid, alpha-lupinene, mevalonic acid and 3-hydroxypropionic acid is catalyzed, but the yield in a shake flask is generally lower and is obviously lower than that of traditional industrial strains (such as escherichia coli, bacillus subtilis and yeast) which take glucose as a carbon source substrate. One of the main reasons is that 3 molecules of NAD (P) H and 3 molecules of ATP are consumed for generating 1 molecule of acetyl coenzyme A in the cyclic assimilation process of the serine, so that the energy conversion rate is low, and a large amount of carbon is discharged in the process of completely dissimilating the formic acid to generate the carbon dioxide, so that the production capacity of a target product is limited. Compared to the serine cycle assimilation pathway, the ribulose monophosphate pathway consumes only 1 molecule of ATP per 1 molecule of pyruvate synthesized by the formaldehyde process and produces 3 molecules of nad (p) H. However, in the further formation of acetyl-CoA, pyruvate decarboxylation produces 1 molecule of carbon dioxide, resulting in a loss of 1/3 carbons, whereas serine cycles the assimilation of formate to acetyl-CoA is not carbon lost. Currently, methylotrophic bacteria capable of efficiently assimilating methanol are lacking.
Disclosure of Invention
The invention aims to provide a reconstructed methyl engineering bacterium for synergistically assimilating methanol by utilizing a ribulose monophosphate pathway and a serine circulating pathway and application thereof.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a reconstructed methyl engineering bacterium for synergistically assimilating methanol by utilizing a ribulose monophosphate pathway and a serine circulating pathway, wherein host bacteria of the reconstructed methyl engineering bacterium comprise Methylorus extrorquens AM1, Methylorus extrorquens PA1 or Methylosiussporium OB3 b; the exogenous genes introduced into the reconstructed methyl engineering bacteria comprise a coding gene of hexulose-6-phosphate synthase and a coding gene of hexulose-6-phosphate isomerase.
Preferably, the exogenous gene is introduced into the host bacterium by using a plasmid as a vector; the coding gene of the hexulose-6-phosphate synthase and the coding gene of the hexulose-6-phosphate isomerase are connected in series.
Preferably, the exogenous genes further include a gene encoding phosphofructokinase and a gene encoding glucose-6-phosphate dehydrogenase; the coding gene of the phosphofructokinase is connected in series with the 3' end of the hexulose-6-phosphate isomerase; the coding gene of the glucose-6-phosphate dehydrogenase is connected in series with the 3' end of the coding gene of the phosphofructokinase.
Preferably, the exogenous genes further include a gene encoding phosphofructokinase, a gene encoding transketolase, a gene encoding transaldolase and a gene encoding ribulose phosphate isomerase; the coding gene of the phosphofructokinase is connected in series with the 3' end of the hexulose-6-phosphate isomerase; the coding gene of phosphofructokinase, the coding gene of transketolase, the coding gene of transaldolase and ribulose phosphate isomerase are connected in series in sequence from 5 'to 3'.
Preferably, the exogenous genes further include a gene encoding phosphofructokinase, a gene encoding glucose-6-phosphate dehydrogenase, and a gene encoding malonyl-CoA reductase and the C-terminus thereof; a coding gene of the hexulose-6-phosphate synthase, a coding gene of the hexulose-6-phosphate isomerase, a coding gene of phosphofructokinase and a coding gene of glucose-6-phosphate dehydrogenase are introduced into the genome of the host bacterium; the coding gene and the C end of the malonyl coenzyme A reductase are introduced into the host bacterium by taking a plasmid as a vector.
Preferably, the exogenous genes further include a gene encoding phosphofructokinase, a gene encoding glucose-6-phosphate dehydrogenase, a gene encoding 2-ketoisovalerate decarboxylase, a gene encoding alcohol dehydrogenase, and a gene encoding acetolactate synthase; a coding gene of the hexulose-6-phosphate synthase, a coding gene of the hexulose-6-phosphate isomerase, a coding gene of phosphofructokinase and a coding gene of glucose-6-phosphate dehydrogenase are introduced into the genome of the host bacterium; the coding gene of the 2-ketoisovalerate decarboxylase, the coding gene of the alcohol dehydrogenase and the coding gene of the acetolactate synthase are connected in series in sequence, and plasmids are used as vectors and are introduced into the host bacteria.
Preferably, the hexulose-6-phosphate synthase comprises a first hexulose-6-phosphate synthase, a second hexulose-6-phosphate synthase or a third hexulose-6-phosphate synthase; the amino acid sequence of the first ketohexose-6-phosphate synthase is as shown in SEQ ID NO: 1 is shown in the specification; the amino acid sequence of the second hexulose-6-phosphate synthase is shown in SEQ ID NO: 2 is shown in the specification; the amino acid sequence of the third ketohexose-6-phosphate synthase is as shown in SEQ ID NO: 3 is shown in the specification; the hexulose-6-phosphate isomerase comprises a first hexulose-6-phosphate isomerase, a second hexulose-6-phosphate isomerase, or a third hexulose-6-phosphate isomerase; the amino acid sequence of the first hexulose-6-phosphate isomerase is shown as SEQ ID NO: 4 is shown in the specification; the amino acid sequence of the second hexulose-6-phosphate isomerase is shown as SEQ ID NO: 5 is shown in the specification; the amino acid sequence of the third hexulose-6-phosphate isomerase is shown as SEQ ID NO: and 6.
Preferably, the phosphofructokinase comprises a first phosphofructokinase or a second phosphofructokinase; the amino acid sequence of the first phosphofructokinase is shown as SEQ ID NO: 7 is shown in the specification; the amino acid sequence of the second phosphofructokinase is shown as SEQ ID NO: shown in fig. 8.
The invention provides application of the reconstructed methyl engineering bacteria in the scheme in high-efficiency assimilation of methanol.
The invention provides application of the reconstructed methyl engineering bacteria in the scheme in preparation of 3-hydroxypropionic acid.
The invention provides application of the restructured methyl engineering bacteria in the scheme in preparing isobutanol.
The invention has the beneficial effects that: the invention provides a reconstructed methyl engineering bacterium for synergistically assimilating methanol by utilizing a ribulose monophosphate pathway and a serine circulating pathway, wherein a host bacterium of the reconstructed methyl engineering bacterium comprises methylotrophic bacteria (methylobacterium methylrubrum exotrophus AM1, methylobacterium methylotrophus PA1 or methanotrophus trichosporium OB3b) naturally utilizing the serine circulating pathway to assimilate the methanol; the exogenous genes introduced into the reconstructed methyl engineering bacteria comprise a coding gene of hexulose-6-phosphate synthase and a coding gene of hexulose-6-phosphate isomerase. The method takes methanol as a unique carbon source and an energy source and methylotrophic bacteria which naturally utilize a serine circulation pathway to assimilate the methanol as an initial host, introduces a gene HPS for heterologous expression coding of Hexulose-6-phosphate synthase (HPS) and a gene PHI for heterologous expression coding of Hexulose-6-phosphate isomerase (PHI) into the initial host, realizes the construction of a ribulose monophosphate pathway, and utilizes the ribulose monophosphate pathway and the serine circulation pathway to assimilate the methanol synergistically. The ribulose monophosphate pathway has high carbon efficiency and generates a large amount of reducing power, and the synergistic assimilation of the ribulose monophosphate pathway and the serine circulation pathway is favorable for improving the assimilation efficiency of methanol.
Drawings
FIG. 1 is a conceptual diagram of the construction of a serine cycle pathway and a ribulose monophosphate pathway concerted assimilation pathway in Methylobacterium which naturally utilizes the serine cycle pathway; wherein, Methanol: methanol; formaldehydee: formaldehyde; formate: formic acid; ru 5P: ribulose-5-phosphate, ribulose-5-phosphate; he 6P: hexulose-6-phosphate, hexulose-6-phosphate; F6P: fructose-6-phosphate, fructose-6-phosphate; G6P: glucose-6-phosphate, glucose-6-phosphate; 6PGL: 6-phosphogluconolactone, 6-phosphogluconolactone; f1, 6P: fructose-1,6-biphosphate, fructose-1, 6-diphosphate; 2 PG: 2-phosphoglycerate, 2 phosphoglycerate; Acetyl-CoA: acetyl-coenzyme A; 3-HP: 3-hydroxypropinic acid, 3-hydroxypropionic acid;
FIG. 2 shows a pCM80 spectrum of hps-RBS-phi;
FIG. 3 shows a pCM80 spectrum of hpsBM-RBS-phiBM-RBS-pfkBM;
FIG. 4 is a pCM80 mass spectrum of hpsBM-RBS-phiBM-RBS-pfkBM-PmxaF-zwfBM;
FIG. 5 is a pCM80 mass spectrum of hpsBM-RBS-phiBM-RBS-pfkBM-PmxaF-tkt-tal-rpe;
FIG. 6 shows pCM80, mcr-Pmta 1-3616-mcr550-1219Mass spectrogram;
FIG. 7A is a metabolic model related to the assimilation of formaldehyde by coupling the ribulose monophosphate pathway under succinic acid culture conditions; figure 7B is a comparison of biomass accumulation of overexpressing hps and phi in m.exterquestam 1 Δ hprA; the bacteria use 62.5mM methanol and 15mM succinic acid as carbon sources, and the strain RS02 biomass with empty plasmid is defined as 1; (RS 02: M. exotques AM 1. delta. hprA:: pCM 80; RS 03: M. exotques AM 1. delta. hprA:: pCM 80-hpBM-linker-phi BM; RS 04: M. exotques AM 1. delta. hprA:: pCM 80-hpBM-phi BM; RS 05: M. exotques AM 1. delta. hprA:: pCM 80-hpBM-fusion-phi BM; RS 06: M. exotques AM 06. delta. hprA:: pCM 06. hphMF-linker-phi MF; RS 06: M. exotques AM 06. delta. hprM 06. hprHmF 06: pCM 06. exothMF-phi. PHiMF; pCM 06. exotques. phMC 06. phmRBS:: pCM 06. hprM. phmRBS 06. hprM. phmS 06. phmRBS 06. hprM. phmRBS 06. hprM. hprB: -phmRBS 06. hprPS.; data represent mean and standard deviation calculated from triplicates of three organisms, significance was calculated by T-test (. p.ltoreq.0.01;. p.ltoreq.0.05);
FIG. 8A shows a comparison of the growth of control strain RS01 (green circle), recombinant engineered methyl bacteria RS12 (purple cross), RS13 (orange diamond) and RS15 (blue triangle); FIG. 8B is a comparison of growth and methanol consumption of control strain RS01 (green circle) and recombinant engineered methyl bacterium RS16 (orange square); data represent mean and standard deviation calculated from three biological replicates; FIG. 8C is a comparison of the growth of control strain RS01 (green circle) and recombinant engineered methyl bacterium RS16B (orange square); data represent mean and standard deviation calculated from three biological replicates;
FIG. 9A shows the central metabolism of intermediate metabolites of recombinant engineered methyl bacteria RS16 and control bacteria RS 01; comparing intermediate metabolite changes of the ketopentose phosphate pathway, pentose phosphate pathway and the ED pathway; FIG. 9B shows the central metabolism of intermediate metabolites of recombinant engineered methyl bacteria RS16 and control bacteria RS 01; comparing intermediate metabolite changes of the serine cycle, EMC pathway and tricarboxylic acid cycle; data represent mean and standard deviation calculated from triplicates of three organisms, significance was calculated by T-test (. p.ltoreq.0.01;. p.ltoreq.0.05); wherein, Methanol: methanol; formaldehydee: formaldehyde; formate: formic acid; ru 5P: ribulose-5-phosphate, ribulose-5-phosphate; he 6P: hexulose-6-phosphate, hexulose-6-phosphate; F6P: fructose-6-phosphate, fructose-6-phosphate; G6P: glucose-6-phosphate, glucose-6-phosphate; 6PGL 6-phosphogluconoethanone, 6-phosphogluconoaldone; 6 PG: 6-phosphogluconate, 6-phosphogluconate; KDPG: 2-keto-3-deoxy-6-phosphogluconate, 2-keto-3-deoxy-6-phosphogluconate; ri 5P: ribose-5-phosphate, ribose-5-phosphate; xu 5P: xylulose-5-phosphate, xylulose-5-phosphate(ii) a Se 7P: sedoheptulose-7-phosphate, sedoheptulose-7-phosphate; E4P: erythrose-4-phosphate, erythrose-4-phosphate; f1, 6P: fructose-1,6-biphosphate, fructose-1, 6-diphosphate; G3P: glyceraldehyde-3-phosphate; DHAP: dihydroyacecetonephosate, dihydroxyacetone phosphate; 3 PG: 3-phosphoglycerate, 3-phosphoglycerate; 2 PG: 2-phosphoglycerate, 2-phosphoglycerate; PEP: phosphoenolpyruvate, phosphoenolpyruvate; OAA: oxaloacetate, oxaloacetate; 3-HB-CoA: 3-hydroxybutyryl-CoA, 3 hydroxybutyryl-CoA; thr: threoninine, threonine; asp: asparate, aspartic acid; Methylene-H4F: methylene-tetrahydrofolic acid; glycerate: glyceric acid; hydroxypruvate: hydroxy pyruvic acid; and (3) spring: serine; glycine: glycine; glyyxlate: glyoxylic acid; Malyl-CoA: malyl-coenzyme a; malate: malic acid; fumarate: fumaric acid; 4, sodium salt: succinic acid; Succinyl-CoA: succinyl-coenzyme A; α -Ketoglutarate: alpha-ketoglutaric acid; citrate: citric acid; pyruvate: pyruvic acid; alanine: alanine; valine: valine; Acetyl-CoA: acetyl-coenzyme A; Methylsuccinyl-CoA: methylsuccinyl-coenzyme A; Mesaconyl-CoA: zhongkanoyl coenzyme A;
FIG. 10A is the comparison of carotenoid contents of recombinant engineered methyl bacteria RS16 and control bacteria RS 01; FIG. 10B is a comparison of colony colors of carotenoids of recombinant engineered methyl bacteria RS16 and control bacteria RS 01;
FIG. 11A is a 3-hydroxypropionic acid synthesis pathway with acetyl-CoA as a precursor; FIG. 11B is a comparison of yields of 3-hydroxypropionic acid in recombinant bacteria RS19 and RS20 that heterologously express a synthetic pathway of 3-hydroxypropionic acid using recombinant methyl-engineered bacteria and wild-type bacteria as chassis, respectively; data represent mean and standard deviation calculated from three biological replicates; FIG. 11C is a comparison of growth and methanol consumption in recombinant bacteria RS19 and RS20, respectively, heterologously expressing a 3-hydroxypropionic acid synthesis pathway using recombinant methyl-engineered bacteria and wild-type bacteria as a chassis; data represent mean and standard deviation calculated from three biological replicates;
FIG. 12 shows the yield of 3-hydroxypropionic acid produced by fed-batch fermentation of recombinant bacteria RS20, which heterologously express the synthetic pathway of 3-hydroxypropionic acid, using recombinant methyl-engineered bacteria as a chassis;
FIG. 13 is a comparison of isobutanol yields in recombinant bacteria RS21 and RS22 of an isobutanol synthetic pathway heterologously expressed by using recombinant methyl engineering bacteria and wild type bacteria as chassis respectively.
Detailed Description
The invention provides a reconstructed methyl engineering bacterium for synergetically assimilating methanol by utilizing a ribulose monophosphate pathway and a serine circulating pathway, wherein a host bacterium of the reconstructed methyl engineering bacterium comprises a methylotrophic bacterium naturally assimilating methanol by utilizing the serine circulating pathway; the methylotrophic bacteria naturally utilizing serine recycling pathway to assimilate methanol comprise Methylobacterium methylorusus extorquens AM1, Methylobacterium methylorusus extorquens PA1 or Methylobacterium methylotrophus Trichosporium OB3 b; the exogenous genes introduced into the reconstructed methyl engineering bacteria comprise a coding gene of hexulose-6-phosphate synthase and a coding gene of hexulose-6-phosphate isomerase.
In the present invention, the host bacteria for reconstructing the methyl engineering bacteria include Methylobacterium methylorum exotrophus AM1(Methylobacterium exotrophus DSMZ 1338 from German culture Collection), Methylobacterium methylorum exotrophus PA1(Methylobacterium exotrophus DSMZ23939 from German culture Collection) or Methylobacterium methylustrichosporium OB3b (Methylocystis sp.ATCC 49243 from American type culture Collection). Methylobacterium M.extorquens AM1 was isolated from methylamine air pollutants in 1960, and can grow by using organic carbon compounds such as methanol and methylamine as unique carbon source and energy source, and multi-carbon substances such as acetic acid, pyruvic acid and succinic acid as carbon source. The methylobacterium m.exotques PA1 was isolated from leaves of Arabidopsis thaliana, and compared to m.exotques AM1, m.exotques PA1 as a host has the advantages of faster growth rate and simple genetic manipulation. Methanobacterium dichorosporium OB3b is a gram-negative bacterium that grows using Methane or methanol as the sole carbon and energy source and contains Methane Monooxygenase (MMO). In the present invention, a conceptual diagram for constructing a serine cycle pathway and a ribulose monophosphate pathway concerted assimilation pathway in Methylobacterium which naturally utilizes the serine cycle pathway is shown in FIG. 1.
In one embodiment of the present invention, the foreign gene is introduced into the host bacterium using a plasmid as a vector; the coding gene hps of the hexulose-6-phosphate synthase and the coding gene phi of the hexulose-6-phosphate isomerase are connected in series, the tandem direction being in the 5 'to 3' direction; the coding gene of the hexulose-6-phosphate synthase and the coding gene of the hexulose-6-phosphate isomerase are preferably connected in series in an in vitro splicing manner through a Protein Peptide flexible link (Peptide linker, ggcggcggctcc is shown in SEQ ID NO: 9), a protease fusion (Protein fusion, two proteins are simultaneously expressed by subtracting a stop codon of the previous gene) or a Ribosome binding site (RBS, aaggagatatacc is shown in SEQ ID NO: 10); the plasmid preferably comprises pCM 80; the insertion sites of the coding gene for the hexulose-6-phosphate synthase and the coding gene for the hexulose-6-phosphate isomerase into the high-copy expression plasmid pCM80 of Methylobacillus are preferably Hind III and BamH I. In the present invention, hps and phi are preferably derived from the promoter P which is unique in methylotrophic bacteriamxaFAs a promoter to drive transcription.
The invention introduces Hexulose-6-phosphate synthase (HPS) catalyzing condensation of formaldehyde and ribulose-5-phosphate to generate Hexulose-6-phosphate and Hexulose-6-phosphate isomerase (PHI) catalyzing isomerization of Hexulose-6-phosphate into methylotrophic bacteria naturally utilizing serine circulation, and can reconstruct ribulose monophosphate pathway, and further utilize ribulose monophosphate pathway and serine circulation pathway to synergistically assimilate formaldehyde and formic acid which are oxidation products of methanol. Because the synergistic assimilation approach more effectively assimilates the oxidation product of methanol and generates reducing power, the growth rate and intracellular intermediate metabolite concentration of the reconstructed methyl engineering bacteria are improved.
In the present invention, the hexulose-6-phosphate synthase preferably includes a first hexulose-6-phosphate synthase, a second hexulose-6-phosphate synthase and a third hexulose-6-phosphate synthase; the first hexulose-6-phosphate synthase, the second hexulose-6-phosphate synthase and the third hexulose-6-phosphate synthase are all derived from the strain with ribulose monophosphate pathway existing originally and have stronger catalytic substrate activity in the original strain.
In the present invention, the first ketohexose-6-phosphate synthase is derived from Bacillus methanolicus mga 3; the amino acid sequence of the first ketohexose-6-phosphate synthase is as shown in SEQ ID NO: 1 is shown.
In the present invention, the second ketohexose-6-phosphate synthase is derived from Methylobacillus flagellatus KT; the amino acid sequence of the second hexulose-6-phosphate synthase is shown in SEQ ID NO: 2, respectively.
In the present invention, the third hexulose-6-phosphate synthase is derived from Methylococcus capsulatus bath; the amino acid sequence of the third ketohexose-6-phosphate synthase is as shown in SEQ ID NO: 3, respectively.
In the present invention, the hexulose-6-phosphate isomerase preferably includes a first hexulose-6-phosphate isomerase, a second hexulose-6-phosphate isomerase, and a third hexulose-6-phosphate isomerase; the first hexulose-6-phosphate isomerase, the second hexulose-6-phosphate isomerase and the third hexulose-6-phosphate isomerase are all derived from the strain with the ribulose monophosphate pathway existing in the source, and the catalytic substrate activity is stronger in the strain with the source.
In the present invention, the first ketohexose-6-phosphate isomerase is derived from Bacillus methanolicus mga 3; the amino acid sequence of the first hexulose-6-phosphate isomerase is shown as SEQ ID NO: 4, respectively.
In the present invention, the second ketohexose-6-phosphate isomerase is derived from Methylobacillus flagellatus KT; the amino acid sequence of the second hexulose-6-phosphate isomerase is shown as SEQ ID NO: 5, respectively.
In the present invention, the tertiary ketohexose-6-phosphate isomerase is derived from Methylococcus capsulatus Banth; the amino acid sequence of the third hexulose-6-phosphate isomerase is shown as SEQ ID NO: and 6.
The present invention preferably employs a coding gene for a first hexulose-6-phosphate synthase (derived from B. methanolicus)Hps of MGA3 bacteriumBM) And a gene encoding a first hexulose-6-phosphate isomerase (phi from B. methanolica MGA3 bacterium)BM) The protein Peptide flexible connecting rod (Peptide linker) or the Ribosome Binding Site (RBS) is connected in series, so that the mixed carbon source can be more effectively utilized, and the biomass of the reconstructed methyl engineering bacteria is improved.
The foreign genes of the present invention are introduced into the host bacterium using a plasmid as a vector, and include a coding gene for hexulose-6-phosphate synthase and a coding gene for hexulose-6-phosphate isomerase, which are linked in series, and preferably further include a coding gene pfk for phosphofructokinase and a coding gene zwf for glucose-6-phosphate dehydrogenase; the coding gene of the phosphofructokinase is connected in series with the 3' end of the hexulose-6-phosphate isomerase; the coding gene of the glucose-6-phosphate dehydrogenase is connected in series with the 3' end of the coding gene of the phosphofructokinase.
Methylotrophic bacteria do not contain Phosphofructokinase (PFK) which catalyzes the phosphorylation of fructose-6-phosphate, and influence the synthesis of C3 intermediate metabolites, thereby preventing the regeneration of ribulose-5-phosphate through a carbon rearrangement pathway. The invention introduces an ATP-dependent phosphofructokinase coding gene into the reconstructed methyl engineering bacteria to irreversibly catalyze fructose-6-phosphate to produce fructose-1, 6-diphosphate, and further enhance the synthesis of ribulose-5-phosphate.
In the present invention, the phosphofructokinase preferably includes a first phosphofructokinase and a second phosphofructokinase; the first phosphofructokinase and the second phosphofructokinase are ATP dependent, cannot catalyze reversible reactions, and can drag metabolic flux from a six-carbon compound to a three-carbon compound.
In the present invention, the first phosphofructokinase is derived from Bacillus methanolicus MGA 3; the amino acid sequence of the first phosphofructokinase is shown as SEQ ID NO: shown at 7.
In the present invention, the second phosphofructokinase is derived from Escherichia coli; the amino acid sequence of the second phosphofructokinase is shown as SEQ ID NO: shown in fig. 8.
In the present invention, the exogenous gene further includes a gene zwf encoding glucose-6-phosphate dehydrogenase, and the gene encoding glucose-6-phosphate dehydrogenase is connected in series to the 3' end of the gene encoding phosphofructokinase. Transcribed by a special promoter in methylotrophic bacteria and connected in series with the 3' end of pfk in the exogenous gene in the scheme; the promoter specific to methylotrophic bacteria preferably comprises PmxaF、PcoxB、Pmetal_3616、PfumCOr PR/tetO。
In the present invention, enhancement of the Oxidative pentose phosphate pathway (Oxidative pentose phosphate pathway) is another strategy to enhance ribulose-5-phosphate regeneration. Glucose-6-phosphate dehydrogenase (G6 PD) is the rate-limiting enzyme of the oxidative pentose phosphate pathway, catalyzing the conversion of Glucose-6-phosphate to gluconolactone 6-phosphate. The gene for coding glucose-6-phosphate dehydrogenase introduced by the invention can strengthen the oxidative pentose phosphate pathway to generate ribulose-5-phosphate and provide a formaldehyde receptor for the ribulose monophosphate pathway. Meanwhile, the coenzymes of the glucose-6-phosphate dehydrogenase and the gluconic acid-6-phosphate dehydrogenase in the way are NADP +, NADPH can be effectively synthesized, and cell biomass synthesis and reduction product synthesis are facilitated.
In the present invention, the glucose-6-phosphate dehydrogenase is derived from Bacillus methanolica MGA 3; the amino acid sequence of the glucose-6-phosphate dehydrogenase is shown in Protein ID: AIE 59795.1.
The foreign gene of the present invention is introduced into the host bacterium using a plasmid as a vector, and the foreign gene includes a coding gene for hexulose-6-phosphate synthase and a coding gene for hexulose-6-phosphate isomerase, and the coding gene for hexulose-6-phosphate synthase and the coding gene for hexulose-6-phosphate isomerase are linked in series, and on this basis, the foreign gene of the present invention preferably further includes a coding gene for phosphofructokinase, a coding gene for transketolase, a coding gene for transaldolase and a coding gene for ribulose-phosphate isomerase; the coding gene of phosphofructokinase, the coding gene of transketolase, the coding gene of transaldolase and ribulose phosphate isomerase are connected in series in sequence from 5 'to 3'.
In the present invention, the coding gene of phosphofructokinase is shown in the above scheme.
In the present invention, the gene encoding transketolase, the gene encoding transaldolase and the gene encoding glucose-6-phosphate dehydrogenase are each transcribed from a promoter specific to methylotrophic bacteria and are ligated to the 3' -end of pfk in the foreign gene in the above-mentioned embodiment; the promoter specific to methylotrophic bacteria preferably comprises PmxaF、PcoxB、Pmetal_3616、PfumCOr PR/tetO。
The invention introduces Non-oxidative pentose phosphate pathway (Non-oxidative pentose phosphate pathway) genes coding Transketolase (TKT) and Transaldolase (TAL) into methylotrophic bacteria naturally utilizing serine circulation, can also promote ribulose-5-phosphate regeneration, and the process does not involve the problems of generation and consumption of energy and reducing power.
In the present invention, the transketolase tkt is derived from Methorubirum extrorquess AM 1; the amino acid sequence of the transketolase is shown in Protein ID: WP _ 015824574.1. In the present invention, the transaldolase tal is derived from Methylorubrum extrorquess AM 1; the amino acid sequence of the transaldolase is shown in Protein ID: WP _ 015824708.1. In the present invention, the ribulose phosphate isomerase rpe is derived from Methylorus extrorquens AM 1; the amino acid sequence of the ribulose phosphate isomerase is described in Protein ID: WP _ 015821423.1.
In another embodiment of the present invention, the exogenous genes preferably further include a gene encoding phosphofructokinase, a gene encoding glucose-6-phosphate dehydrogenase, and a gene encoding malonyl-CoA reductase and the C-terminus thereof; the coding gene of the hexulose-6-phosphate synthetase and the coding gene of the hexulose-6-phosphate isomerase are connected through RBS sequences, the 3' end is connected with the coding gene of phosphofructokinase through RBS sequences and PmxaFPromoter-initiated glucose-6-phosphate dehydrogenase coding geneIntroducing the fragment of the gene into a cel site of the genome of the host bacterium; preferably, the gene encoding hexulose-6-phosphate synthase and the gene encoding hexulose-6-phosphate isomerase are linked by a flexible protein peptide linkage, and the 3' end is linked to the gene encoding phosphofructokinase by an RBS sequence and by PmxaFIntroducing a segment of a gene coding for glucose-6-phosphate dehydrogenase started by a promoter into a cel site of the genome of the host bacterium; the coding gene of the malonyl coenzyme A reductase and the C end thereof are introduced into the host bacterium by taking a plasmid as a vector; the plasmid preferably comprises pCM 80; the insertion sites for malonyl-CoA and its C-terminus on pCM80 are preferably Hind III and BamH I.
In the invention, the coding gene of the malonyl coenzyme A reductase and the C end thereof are preferably derived from Thermoophthalmopsis Chloroflexus aurantiacaus; the amino acid sequence of the malonyl-coa reductase is found in ProteinID: WP _ 012258473.1.
In the practice of the present invention, the coding gene hps containing hexulose-6-phosphate synthase, the coding gene phi of RBS-linked hexulose-6-phosphate isomerase, the coding genes pfk and P of RBS-linked phosphofructokinase, were introduced based on the integration plasmid pCM433mxaFFragments of four genes of the promoter gene zwf of glucose-6-phosphate dehydrogenase and homology arms 1000bp upstream and downstream of the cel site are connected to the plasmid pCM433 by overlap PCR, and Bgl II and Sac I are preferably selected as insertion sites of the plasmid pCM 433. And (3) electrically transferring the recombinant plasmid into methylotrophic bacteria, screening the double-exchanged recombinant bacteria by using sucrose by using single-exchange recombinant bacteria obtained by tetracycline resistance screening, and finally obtaining the recombinant methylotrophic bacteria with hps, phi, pfk and zwf integrated on the cel site of the genome of the methylotrophic bacteria after PCR verification is successful.
Construction of the malonyl-CoA pathway in Methylobacterium synthesizes 3-HP, but 3-HP production is low due to intracellular precursor metabolites and NADPH supply limitations of reducing power. The Malonyl-CoA pathway begins with the conversion of Acetyl-CoA to Malonyl-CoA catalyzed by Acetyl-CoA carboxylase (ACC), followed by the synthesis of 3-HP by a two-step reduction reaction with a bifunctional Malonyl-CoA reductase (MCR). At the same time, the reaction catalyzed by MCR requires the consumption of two molecules of reducing power NADPH. The heterologous synthesis way is introduced into the reconstructed methyl engineering bacteria containing the synergistic assimilation way with the improved content of acetyl coenzyme A and NADPH, so that the yield of the 3-hydroxypropionic acid can be improved.
In another embodiment of the present invention, the exogenous genes preferably further include a gene encoding phosphofructokinase, a gene encoding glucose-6-phosphate dehydrogenase, a gene encoding 2-ketoisovalerate decarboxylase, a gene encoding alcohol dehydrogenase, and a gene encoding acetolactate synthase; the coding gene of the said hexulose-6-phosphate synthetase and the coding gene of the hexulose-6-phosphate isomerase are connected by RBS sequence, the 3' end is connected with the coding gene of phosphofructokinase by RBS sequence and PmxaFIntroducing a segment of a coding gene of glucose-6-phosphate dehydrogenase started by a promoter into a cel site of the genome of the host bacterium; the coding gene of the 2-ketoisovalerate decarboxylase, the coding gene of the alcohol dehydrogenase and the coding gene of the acetolactate synthase are sequentially connected in series by RBS, and plasmids are used as vectors and are introduced into the host bacteria; the plasmid preferably comprises pCM 80; the insertion sites of the coding gene of 2-ketoisovalerate decarboxylase, the coding gene of alcohol dehydrogenase and the coding gene of acetolactate synthase on pCM80 are preferably Hind III and Bgl II.
In the practice of the present invention, the integration of the hps, phi, pfk and zwf genes is as described above.
In the present invention, the 2-ketoisovalerate decarboxylase is preferably a 2-ketoacid decarboxylase (2-ketoisovalerate decarboxylase, KDC) derived from lactococcus lactis; the amino acid sequence of the 2-ketoisovalerate decarboxylase is shown in Genbank: CAG 34226.1; the Alcohol dehydrogenase is preferably an Alcohol Dehydrogenase (ADH) derived from Escherichia coli; the amino acid sequence of the alcohol dehydrogenase is shown in Genbank: AUY 27386.1; the Acetolactate synthase is preferably Acetolactate synthase (ALS) derived from Bacillus subtilis; the amino acid sequence of the acetolactate synthase is shown in Genbank: KOS 73351.1.
The biological synthesis of isobutanol takes 2-ketoisovalerate in the amino acid metabolism process as a precursor, and the precursor is decarboxylated into aldehyde and then dehydrogenated to generate isobutanol. 2-keto acid decarboxylase derived from Lactococcus lactis is introduced to catalyze 2-ketoisovalerate to generate isobutyraldehyde, alcohol dehydrogenase derived from Escherichia coli is introduced to catalyze isobutyraldehyde to generate isobutanol, and an isobutanol synthesis path is constructed. Meanwhile, the acetolactate synthase of Bacillus subtilis is overexpressed, the capability of decarboxylation of two molecules of pyruvic acid to form one molecule of 2-acetolactate is improved, and the flux of metabolic synthesis of 2-ketoisovalerate is favorably improved. The heterologous synthesis process is introduced into reconstructed methyl engineering bacteria with increased pyruvic acid and NADPH content to raise the yield of isobutanol.
The invention provides application of the reconstructed methyl engineering bacteria in the scheme in high-efficiency assimilation of methanol.
The invention provides application of the reconstructed methyl engineering bacteria in the scheme in preparation of 3-hydroxypropionic acid.
The invention provides application of the restructured methyl engineering bacteria in the scheme in preparing isobutanol.
In the invention, the application of the reconstructed methyl engineering bacteria in efficiently assimilating methanol, preparing 3-hydroxypropionic acid or preparing isobutanol preferably comprises the following steps: inoculating the reconstructed methyl engineering bacteria to a culture medium which takes methanol as a unique carbon source, and culturing under the conditions of dissolved oxygen of 35% and 30 ℃; the culture mode is preferably shake flask culture or fermentation tank culture, and the culture medium formula is preferably 5.06g/L K2HPO4，5.17g/L NaH2PO4；0.4095g/L MgSO4·7H2O，1g/L(NH4)2SO4；1mg/L Na2EDTA，0.1mg/L FeSO4·7H 20, trace element B: 0.14mg/L CaCl2·2H2O，0.1mg/LMnCl2·4H2O，0.02mg/L Na2MoO4·2H2O，0.03mg/L CuSO4·5H2O，0.32mg/L CoCl2·6H2O，0.44mg/L ZnSO4·7H2O; in the culture process, methanol is used as a unique carbon source (125mM) during shake flask culture, 50mL of liquid culture medium is added into a 250mL conical flask, the strain to be detected is inoculated, shaking culture is carried out at 30 ℃ and 250rpm until the OD of the later index is 1.5 +/-0.1, and in the culture process, the initial concentration of the methanol in the culture medium is preferably 120-130 mM and more preferably 123-125 mM during fermentation tank culture; in the culture medium (NH4)2SO4The concentration of the nitrogen source is preferably 0.8-1.2 g/L, and more preferably 1 g/L; after the reconstructed methyl engineering bacteria are inoculated to a culture medium, the initial OD600Preferably 0.1; when a fermentation tank is adopted for culture, the ventilation amount in the culture process is preferably 0.8-1.2L/min, more preferably 1L/min, and the stirring speed is preferably 500-800 rpm, more preferably 600 rpm; adding 25 volume percent of methanol in the fermentation process, wherein the flow rate is preferably 4.2ml/h (the concentration of the methanol is kept to be 0.5 to 1.0 volume percent), and adjusting the fermentation pH to be 6.80 +/-0.05 by using 1M NaOH aqueous solution; and (3) collecting and detecting the sample, namely collecting 1ml of bacterial liquid containing the 3-hydroxypropionic acid for the 3-hydroxypropionic acid, centrifuging for 10min at 10,000 Xg, and taking the upper culture solution for analysis and detection. 3-Hydroxypropionic acid was detected by Waters 2690 High Performance Liquid Chromatography (HPLC). For isobutanol, 1ml of isobutanol-containing bacterial solution was collected, and the centrifuged supernatant was extracted with ethyl acetate of the same volume and detected by Shimadzu GC17A-QP-2020 gas chromatography-mass spectrometer (GC-MS).
The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
1. The culture medium adopted in the embodiment of the invention is as follows: macroelement (2X): macroelement A: 5.06g/L K2HPO4，5.17g/L NaH2PO4(ii) a Macroelement B: 0.4095g/L MgSO4·7H2O，1g/L(NH4)2SO4(ii) a If a solid medium is prepared, thenTo macroelement B, agar was added at 30 g/L. Trace elements: 100mL of 1000X trace elements were prepared. Trace element A: 1gNa2EDTA，0.1g FeSO4·7H 20, adjusting the pH value to 4 by using 1M NaOH; trace element B: 0.14g CaCl2·2H2O，0.1gMnCl2·4H2O，0.02g Na2MoO4·2H2O，0.03g CuSO4·5H2O，0.32g CoCl2·6H2O，0.44gZnSO4·7H2And O, adjusting the pH value to 1-2 by using HCl. After filter sterilization, the cells were stored at 4 ℃ with a final concentration of 125mM methanol.
2. The intracellular metabolite extraction condition and the metabolite detection method in the embodiment of the invention are as follows: 50mL of liquid medium was added to a 250mL conical flask, the strain to be tested was inoculated, shake-cultured at 30 ℃ and 250rpm until OD becomes 1. + -. 0.1, 20mL of the cell suspension was collected rapidly and the liquid was removed with a 0.22 μm filter, and the collected cells were put into a 50mL centrifuge tube and stored in liquid nitrogen. Pouring 10ml of boiling water into a 50ml centrifuge tube quickly, placing the centrifuge tube into a water bath kettle at 100 ℃ for reaction for 10-15min, centrifuging the centrifuge tube at 5000rpm for 10min, taking out all supernate, quickly freezing the sample by using liquid nitrogen, freeze-drying the sample by using a freeze dryer, dissolving the freeze-dried sample by using 100 mu L of water, and analyzing the intracellular concentrations of the glucphosphate and acyl coenzyme A metabolites by using LC/MS (Orbitrap Fusion Lumos, Thermo Scientific, MA, USA) according to the following detection method: a chromatographic column: UPLC BEH Amide column (2.1 mm. times.100 mm. times.1.7 μm, Waters, MA, USA); mobile phase: aqueous phase (a): 5mM ammonium formate and 0.1% formic acid, organic phase (B): acetonitrile; elution procedure: 0-0.5 min, 90% B; 0.5-14 min, 90-45% of B; 14-14.01 min, 45% -20% of B; 17-17.01 min, 20-90% of B, 17.01-20 min and 90% of B; flow rate: 0.3 ml/min; sample introduction amount: 1 μ L mass spectrometry conditions: full scan, m/z 50-1000;
the method comprises the following steps of performing derivatization on a freeze-dried sample by using a silylation reagent, performing vacuum rotary evaporation on the sample of 50 mu L, performing derivatization reaction after the sample is anhydrous, and performing sample derivatization in two steps: (1) adding 35 μ L methoxyamine solution (25mg/mL) to react at 6 deg.C for 30min to oxidize keto functional group; (2) trisilylation: to each sample, 35. mu.L of TMS reagent (BSTFA/TMCS,99:1) was added and reacted at 30 ℃ for 90 min. After derivatization, the amino acids and carboxylic acids were analyzed by GC-MS (GC17A with QP-2020 mass spectrometer, Shimadzu, Kyoto, Japan) and detected as follows: a chromatographic column: rtx-5MS column (30 m.times.0.25 mm.times.0.25 μm, Restek, USA); sample inlet temperature: 280 ℃; chromatographic conditions are as follows: keeping the temperature at 60 ℃ for 0.25min, and increasing the temperature to 280 ℃ at 5 ℃/min for 10 min; mass spectrum conditions: full scan m/z40to 500.
3. The detection method of the 3-hydroxypropionic acid in the embodiment of the invention is as follows: adding 50mL of liquid culture medium into a 250mL conical flask, inoculating the strain to be detected, shaking at 30 ℃ and 250rpm until OD is 1.5 +/-0.1, collecting 1mL of bacterial liquid containing 3-hydroxypropionic acid, centrifuging at 10,000 Xg for 10min, and taking the upper layer of culture liquid for analysis and detection. 3-hydroxypropionic acid was detected by Waters 2690 High Performance Liquid Chromatography (HPLC) using a 2998 PDA detector and Aminex HPX-87H (300 mm. times.7.8 mm, Bio-Rad, Calif., USA) column under the following chromatographic conditions: wavelength: 210 nm; mobile phase: 5mM sulfuric acid; flow rate: 0.6 ml/min; temperature of the column box: 65 ℃; sample introduction amount: 30 μ l.
The isobutanol detection method in the examples is as follows: and qualitatively and quantitatively analyzing the content of the isobutanol in the sample by using a gas chromatography-mass spectrometer. Detection conditions are as follows: a chromatographic column: rtx-5ms capillary chromatography column (30 m.times.0.25 mm.times.0.25 μm), injection port temperature of 250 deg.C, detector temperature of 200 deg.C. The initial column temperature was maintained at 40 ℃ for 4min, and the temperature was raised to 250 ℃ at 40 ℃/min for 2.5 min. Sample introduction amount: 1 μ l.
4. The RT-qPCR analysis method in the embodiment of the invention is as follows: 6 single colonies were picked from each plate and cultured in 3mL of a liquid medium containing 123mM methanol as a carbon source at 30 ℃ and shaking-cultured at 200rpm until OD 1.0 was obtained. 3mL of the bacterial solution was added to 2 1.5mL centrifuge tubes and centrifuged at 9000rpm at 4 ℃ for 2min to extract total RNA. The reaction solution from which the genomic RNA was removed was added. After mixing, centrifuging briefly, and carrying out reverse transcription reaction. Using an Applied Biosystems 7500 Fast Real-Time PCRSystem, a two-step PCR amplification program was used: the first step is as follows: pre-denaturation, 30s at 95 ℃, 1 cycle; the second step is that: PCR reaction, 95 ℃ 5s, 60 ℃ 34s, 40 cycles lysis phase: 1 cycle of 95 ℃ for 15s, 60 ℃ for 1min and 95 ℃ for 15 s; respectively counting the target gene and the internal reference gene according to the cycle number reaching the threshold value in the fluorescent quantitative PCR processThe average Ct value is calculated for the Ct of the factor. Using the formula F2﹣ΔΔCtAnd calculating the ploidy relation between the experimental group and the control group. Calculating the difference in expression level (1) calculating the Δ Ct: sample Δ Ct ═ sample Ct-reference gene (rpsB) Ct; (2) comparison Δ Ct between different samples: delta Ct-experimental delta Ct-control delta Ct; (3) calculated fold difference in expression between different samples relative to the amount of difference in expression was 2-△△Ct。
5. The recombinant plasmids used in the examples of the present invention were as follows: and (3) carrying out one-step cloning connection on a target gene fragment obtained by PCR and a plasmid skeleton subjected to double enzyme digestion, and then transforming the target gene fragment into E.
pCM80, hps-RBS-phi; the mass spectrum is shown in FIG. 2; pCM80 (hps)BM-RBS-phiBM-RBS-pfkBM(ii) a The mass spectrum is shown in figure 3; pCM80 (hps)BM-RBS-phiBM-RBS-pfkBM-PmxaF-zwfBM(ii) a The mass spectrum is shown in FIG. 4;
pCM80::hpsBM-RBS-phiBM-RBS-pfkBM-PmxaF-tkt-tal-rpe mass spectrum as shown in figure 5;
pCM80::mcr-Pmeta1_3616-mcr550-1219(ii) a The mass spectrum is shown in FIG. 6.
Example 1 comparison of the origin and Gene ligation patterns of different hps and phi
This example provides a cell model for rapid screening of the source and gene linkage pattern of hps and phi using growth phenotype (FIG. 7A). The specific process is as follows: firstly, knocking out a key gene hpRA in a methylobacterium M.exotorquens AM1 serine circulating pathway, blocking an original one-carbon assimilation pathway, and obtaining a recombinant strain which can not grow by taking methanol as a unique carbon source. When hps and phi with different sources and gene linking modes are introduced into the recombinant strain and grow in a culture medium with succinic acid and methanol as mixed carbon sources, the recombinant strain containing the optimal hps and phi combination mode can grow by more effectively utilizing the mixed carbon sources, and the gene combination mode of optimally expressing the hps and phi in the methylobacterium is screened by observing the growth vigor of cells. The method comprises the following steps:
1. a gene hpRA of methylobacterium M.extorquens AM1 which naturally utilizes serine circulation to assimilate methanol is knocked out, the assimilation pathway of the methanol oxidation product formic acid is blocked, and the mutant strain cannot grow in a culture medium which takes methanol as a sole carbon source. Taking a methylobacterium M.exotronques AM1 strain with a gene hprA knocked out as an initial chassis, selecting heterologous genes hps and phi from Bacillus methanolica MGA3, Methylobacillus flagellatus KT and Methylobacillus capsulatus Bath, splicing the hps and the phi in vitro by three connection modes of a gene flexible connecting rod (linker), protease fusion (fusion) and a Ribosome Binding Site (RBS), and constructing the spliced genes hps and phi on an expression plasmid pCM80, wherein the hps and the phi are formed by PmxaFAs a promoter to drive transcription, various combinations of recombinant plasmids (pCM80-hps-phi) were transformed into mutant strains. Further, a cell model was designed for rapid screening of the combination of genes hps-phi using growth phenotype (FIG. 7A).
2. Culturing the recombinant bacteria (M.extorquens AM1 delta hpRA:: pCM80-hps-phi) which overexpress different hps and phi in the step 1 on a mixed carbon source of succinic acid (15mM) and methanol (60mM), wherein the biomass of the recombinant bacteria is obviously higher than that of a control strain (M.extorquens AM1 delta hpRA:: pCM80), which indicates that the cells synthesize ribulose-5-phosphate by using succinic acid to provide a key formaldehyde receptor for the ribulose monophosphate pathway, and the combination mode of different hps-phi (three connection modes in the step 1) causes obvious difference of the growth rate and the final OD value of the recombinant bacteria, so as to screen out the optimal combination of different sources of hexulose-6-phosphate synthetase and hexulose-6-phosphate isomerase under different gene connection modes. The results show that: hps from Methanolichus MGA3 bacteriumBM(encoding gene of first hexulose-6-phosphate synthetase, nucleotide sequence is shown in locus _ tag: BMMGA3_06845) and phiBM(encoding gene of the first hexulose-6-phosphate isomerase, nucleotide sequence is shown in locus _ tag: BMMGA3_ 06840). The biomass of the recombinant strains, RS03 (protein peptide flexible linkage) and RS04(RBS), which were linked by a protein peptide flexible linkage and an RBS, was highest (fig. 7B).
3. A recombinant plasmid (pCM) obtained by combining a gene encoding a first hexulose-6-phosphate synthase and a gene encoding a first hexulose-6-phosphate isomerase80-hps-phi) are respectively transferred into wild methylobacterium M.extorquens AM1 to obtain reconstructed methyl engineering bacteria for constructing RS12 and RS13 by using ribulose monophosphate path and serine circulation path to synergistically assimilate methanol oxidation products formaldehyde and formic acid, the synergistic assimilation path accelerates the assimilation efficiency of a methanol carbon source, and the specific growth rates of the two strains of bacteria are respectively 0.119 +/-0.002 h-1And 0.122. + -. 0.001h-1The growth rate was increased by 4.2% and 6.1% compared to wild type (fig. 8A).
Example 2
To further increase the efficiency of formaldehyde assimilation by the ribulose monophosphate pathway, the gene pfk encoding phosphofructokinase from E.coli and B.methanolicus MGA3 was overexpressed on pCM80 plasmid based on the reconstituted engineered methyl bacterium in example 1, and ligated to the 3' ends of hps and phi via RBS sequence (ataacaaccgttggggaggcatccc SEQ ID NO: 11) to yield recombinant plasmid pCM80:: hps and phiBM-RBS-phiBM-RBS-pfkBM(pfk derived from B. methanolicus MGA3BMSee locus _ tag: BMMGA3_ RS 16610; and expression of pfk from E.coliECSee locus _ tag: SH07_ RS01090), and constructing the reconstructed methyl engineering bacteria RS14 and RS 15. The growth rate of the genetic strain is 0.126 +/-0.002 h-1The increase was 8.7% compared to the control strain, and the strain did not further increase the growth rate (fig. 8A).
Further, hps was found in the recombinant plasmid pCM80BM-RBS-phiBM-RBS-pfkBMHeterologous expression of the gene zwf encoding glucose 6-phosphate dehydrogenase from B.methanolicas MGA3, using promoter-PmxaFStarting and connecting to the 3' end of pfk to obtain a recombinant plasmid pCM80 of hpsBM-RBS-phiBM-RBS-pfkBM-PmxaF-zwfBM(ii) a The nucleotide sequence of the gene zwf of the glucose 6-phosphate dehydrogenase is seen in locus _ tag, BMMGA 3-06850; the formaldehyde assimilation efficiency is further improved by strengthening the oxidized pentose phosphate pathway, and a new reconstructed methyl engineering strain RS16 is obtained. Glucose-6-phosphate dehydrogenase catalyzes glucose-6-phosphate to produce 6-phosphogluconolactone, which is a rate-limiting enzyme of the pentose phosphate oxidation pathway and reconstructs the growth rate of methyl engineering bacteriaThe rate is 0.134 +/-0.002 h-1Is improved by 16.4 percent compared with the wild type, and simultaneously the methanol consumption rate is 1.4 times of that of a control bacterium RS01 and reaches 18.48 +/-0.74 mmol/g-1·h-1(FIG. 8B).
Then in the constructed recombinant plasmid pCM80, hpsBM-RBS-phiBM-RBS-pfkBMOn the basis of further improving the efficiency of formaldehyde assimilation by strengthening the non-oxidized pentose phosphate pathway, the promoter-P is usedmxaFStarting to express the original genes tkt, tal and rpe of the methylobacterium (coding transketolase, transaldolase and ribulose phosphate isomerase respectively, the nucleotide sequence of the gene tkt is shown in logic _ tag: METD _ RS25355, the nucleotide sequence of the gene tal is shown in logic _ tag: METD _ RS25360, and the nucleotide sequence of the gene rpe is shown in logic _ tag: METD _ RS05005), and obtaining the new reconstructed methyl engineering strain RS 16B. Ribulose phosphate isomerase catalyzes xylulose-5-phosphate to generate ribulose-5-phosphate, the expression of the ribulose-5-phosphate enhances the generation of ribulose-5-phosphate to promote the assimilation of formaldehyde, and the growth rate of the reconstructed methyl engineering bacteria is 0.129 +/-0.002 h-1And 12.1% higher than that of the wild type (FIG. 8C).
Example 3
Metabonomics analysis and RT-qPCR analysis were performed on the reconstituted engineered methyl bacteria of example 2 for reconstituted engineered methyl bacteria RS16(M.extorquens AM1:: pCM80:: hps)BM-RBS-phiBM-RBS-pfkBM-PmxaF-zwfBM) Metabolomics analysis and RT-qPCR analysis were performed. The results are shown below: FIG. 9A shows the central metabolism of intermediate metabolites of recombinant engineered methyl bacteria RS16 and control bacteria RS 01; comparing intermediate metabolite changes of the ketopentose phosphate pathway, pentose phosphate pathway and the ED pathway; FIG. 9B shows the central metabolism of intermediate metabolites of recombinant engineered methyl bacteria RS16 and control bacteria RS 01; comparing intermediate metabolite changes of the serine cycle, EMC pathway and tricarboxylic acid cycle; intracellular concentrations of sedoheptulose 7-phosphate, 6-phosphogluconate, glyceraldehyde 3-phosphate/dihydroxyacetone phosphate, 3-phosphoglycerate/2-phosphoglycerate and pyruvate, which are intermediate metabolites of the ribulose monophosphate, pentose phosphate and glycolysis pathways, were increased 1.6 to 2.6 times, indicating that the above pathways are increased by a factor of 1.6 to 2.6The metabolic flux is increased, and a key intermediate metabolite, namely 2-keto-3-deoxy-6-phosphogluconate in the EntnerDodoroff pathway is not detected in both the reconstructed methyl engineering strain and the control strain, so that the synergistic assimilation pathway fails to strengthen the metabolic flux of the Entner Doudoroff pathway, and is consistent with the change of the metabolite, and further the metabolic flux is circularly performed through the pentose phosphate pathway through the ribulose monophosphate pathway at the time.
The expression of genes tkt, tal, pgl (coding 6-phosphogluconolactonase) and cbbA (coding fructose diphosphate aldolase) in the recombinant strain is up-regulated by 1.3-2.0 times, and edd (coding 6-phosphogluconodehydratase) is not obviously changed; the carotenoid content in the recombinant strain was increased 2.1 times (FIGS. 10A and 10B, wherein FIG. 10A is a comparison of carotenoid contents of recombinant engineered bacteria RS16 and control bacteria RS 01; FIG. 10B is a comparison of colony colors of carotenoid contents of recombinant engineered bacteria RS16 and control bacteria RS 01), due to the increased intracellular contents of glyceraldehyde-3-phosphate and pyruvic acid, which are precursors of carotenoid synthesis; phosphoenolpyruvate, aspartate, threonine, malate and acetyl-CoA were increased 2.1-3.5 fold in the recombinant strain because the increased intermediary metabolites in the glycolytic pathway pushed more metabolic flow into the downstream serine cycle pathway, consistent with a horizontal up-regulation of the expression of the genes ppc (coding for phosphoenolpyruvate carboxylase), mtkA (coding for phosphoenolpyruvate carboxylase) and mclA (Malyl-CoA lyase/-methyl Malyl-CoA lyase), in particular 3.2 fold up-regulation of the ppc gene coding for phosphoenolpyruvate carboxylase, promoting phosphoenolpyruvate carboxylation to oxaloacetate; in addition, the intracellular content of NADPH reducing power was 1.79. + -. 0.05nmol/mg of cell dry weight, which was 1.6 times that of the control strain.
The metabolic flow direction of glyceraldehyde-3-phosphate to fructose-6-phosphate is changed. In wild-type methylobacterium m.extrorquens AM1, fructose-1, 6-bisphosphatase catalyzes the conversion of fructose-1, 6-bisphosphate into fructose-6-phosphate, which is subsequently converted into pentose phosphate by transketolase to synthesize nucleic acids. Following the introduction of the ribulose monophosphate pathway, the transcriptional level of glpX, which encodes fructose-1, 6-bisphosphatase, was down-regulated by 75%, while the other isozyme gene cbbF (which encodes fructose-1, 6-bisphosphatase) was barely transcribed, indicating that the metabolic flux from the C3 intermediate metabolite towards the C6 intermediate metabolite is significantly diminished, with more metabolic flux due to the introduction of a heterologous phosphofructokinase directed to the downstream pathway to the C3 intermediate metabolite, entering the serine cycle pathway.
Example 4
Based on the integration plasmid pCM433, the coding gene hps containing hexulose-6-phosphate synthase, the coding gene phi of RBS-linked hexulose-6-phosphate isomerase, and the coding genes pfk and P of RBS-linked phosphofructokinase were ligatedmxaFThe fragments of the four genes encoding zwf, which is a promoter of glucose-6-phosphate dehydrogenase, and the homology arms 1000bp upstream and downstream of the cel site were ligated by overlap PCR to form a single fragment, which was then preferably Bgl II and Sac I at the pCM433 insertion site. And (3) electrically transferring the recombinant plasmid into methylotrophic bacteria, screening the double-exchanged recombinant bacteria by using sucrose by using single-exchange recombinant bacteria obtained by tetracycline resistance screening, and finally obtaining recombinant methyl engineering bacteria RS18 with hps, phi, pfk and zwf integrated on the cel site of the genome of the methylotrophic bacteria after PCR verification is successful. The reconstructed methyl engineering bacterium is taken as a chassis host, a gene mcr for coding malonyl coenzyme A reductase and a C end (the C end is nucleotide corresponding to 550bp to 1219 bp) thereof are expressed on a plasmid pCM80, the nucleotide sequence is shown in locus _ tag: CAUR _ RS13730, and 550-1219 bp of the mcr corresponding to the C end thereof are introduced into a 3-hydroxypropionic acid heterologous synthesis way (pCM 80-mcr-P)meta1_3616-mcr550-1219Mcr550-1219 is the C-terminus of mcr) to obtain strain RS20, adding 50ml of medium to a 250ml shake flask using 125mM methanol as a carbon source, inoculating the test strain, culturing at 30 ℃, 250rpm to the late exponential phase, taking the centrifuged supernatant of the medium, and detecting by HPLC, the results are shown in fig. 11A, fig. 11B and fig. 11C (fig. 11A is the 3-hydroxypropionic acid synthesis pathway based on acetyl-CoA; FIG. 11B is a comparison of yields of 3-hydroxypropionic acid in recombinant bacteria RS19 and RS20 in the 3-hydroxypropionic acid synthesis pathway in which recombinant methyl-engineered bacteria and wild-type bacteria are used as chassis; FIG. 11C shows the growth of recombinant bacteria RS19 and RS20 in the 3-hydroxypropionic acid synthesis pathway with recombinant methyl engineering bacteria and wild type bacteria as the chassisComparison with methanol consumption; data represent mean and standard deviation calculated from three biological replicates), the yield of 3-hydroxypropionic acid reached 91.2mg/L, while the amount of recombinant strain RS19 constructing the 3-hydroxypropionic acid synthesis pathway in wild-type Methylobacterium was only 29.3mg/L, and the synergistic pathway resulted in a 3.1-fold increase in yield.
Example 5
The reconstructed methyl engineering bacterium RS20 for producing 3-hydroxypropionic acid in example 4 was fed-batch cultured in a 2.5L fermentor (fermentation volume 1.8L) with an initial methanol concentration of 123mM and a shake flask seed solution OD of 1.0, and the initial OD after inoculation into the fermentor6000.1 percent of dissolved oxygen in the tank, coupling the aeration quantity and the stirring speed with the dissolved oxygen concentration, wherein the aeration quantity is 1L/min, the stirring speed range is 500-800 rpm, 25 percent by volume of methanol is fed during the fermentation process, the flow rate is 4.2ml/h (the methanol concentration is kept to be 0.5-1.0 percent), 1M NaOH aqueous solution is used for adjusting the fermentation pH to be 6.80 +/-0.05, the fermentation temperature is 30 ℃, (NH4)2SO4The concentration was 1 g/L. As a result, as shown in FIG. 12, the yield of 3-HP reached 0.726g/L in 97.5 hours, and the yield was 0.039g-1. The theoretical yield of 3-hydroxypropionic acid is 0.844g-1The actual yield is 4.6% of the theoretical yield and the biomass yield is 0.113 g.g-1。
Example 6
Based on the integration plasmid pCM433, the coding gene hps containing hexulose-6-phosphate synthase, the coding gene phi of RBS-linked hexulose-6-phosphate isomerase, and the coding genes pfk and P of RBS-linked phosphofructokinase were ligatedmxaFThe fragments of the four genes encoding zwf, which is a promoter of glucose-6-phosphate dehydrogenase, and the homology arms 1000bp upstream and downstream of the cel site were ligated by overlap PCR to form a single fragment, which was then preferably Bgl II and Sac I at the pCM433 insertion site. And (3) electrically transferring the recombinant plasmid to methylobacterium M.extorquens AM1, screening the double-exchanged recombinant bacteria by using sucrose by using single-exchange recombinant bacteria obtained by tetracycline resistance screening, and finally obtaining the recombinant methylotrophic bacteria RS18 with hps, phi, pfk and zwf integrated on the cel site of the genome of the methylotrophic bacteria after PCR verification is successful. The reconstructed methyl engineering bacterium is used as a chassis host, and is introduced to a plasmid pCM80Into 2-ketoisovalerate decarboxylase gene kivd (nucleotide sequence is shown in GenBank: AJ746364.1) derived from L.lactis, alcohol dehydrogenase gene yqhD (nucleotide sequence is shown in locus _ tag: YKEC1_0153) derived from E.coli and acetolactate synthase gene alss (nucleotide sequence is shown in locus _ tag: AEA11_02560) derived from B.subtilis, the genes are connected by RBS sequence to obtain recombinant plasmid pCM80-kivd-yqhD-alss, the recombinant plasmid is transformed into restructured methyl engineering bacteria and wild type methyl bacillus containing synergistic assimilation pathway to obtain strains RS22 and RS21, methanol is used as carbon source (125mM), adding 50ml culture medium into 250ml shake flask, inoculating strain to be tested, culturing at 30 deg.C and 250rpm to late stage of index, collecting centrifuged culture medium supernatant, extracting with equal volume of ethyl acetate, GC-MS detection shows that the yield of extracellular isobutanol is improved by 2.3 times and reaches 18.0mg/L as shown in figure 13.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Qingdao agricultural university
<120> reconstituted methyl engineering bacterium for synergistically assimilating methanol by utilizing ribulose monophosphate pathway and serine circulating pathway and application thereof
<160>11
<170>SIPOSequenceListing 1.0
<210>1
<211>211
<212>PRT
<213> Bacillus methanolicus (Bacillus methanolicus)
<400>1
Met Glu Leu Gln Leu Ala Leu Asp Leu Val Asn Ile Glu Glu Ala Lys
1 5 1015
Gln Val Val Ala Glu Val Gln Glu Tyr Val Asp Ile Val Glu Ile Gly
20 25 30
Thr Pro Val Ile Lys Ile Trp Gly Leu Gln Ala Val Lys Ala Val Lys
35 40 45
Asp Ala Phe Pro His Leu Gln Val Leu Ala Asp Met Lys Thr Met Asp
50 55 60
Ala Ala Ala Tyr Glu Val Ala Lys Ala Ala Glu His Gly Ala Asp Ile
65 70 75 80
Val Thr Ile Leu Ala Ala Ala Glu Asp Val Ser Ile Lys Gly Ala Val
85 90 95
Glu Glu Ala Lys Lys Leu Gly Lys Lys Ile Leu Val Asp Met Ile Ala
100 105 110
Val Lys Asn Leu Glu Glu Arg Ala Lys Gln Val Asp Glu Met Gly Val
115 120 125
Asp Tyr Ile Cys Val His Ala Gly Tyr Asp Leu Gln Ala Val Gly Lys
130 135 140
Asn Pro Leu Asp Asp Leu Lys Arg Ile Lys Ala Val Val Lys Asn Ala
145 150 155 160
Lys Thr Ala Ile Ala Gly Gly Ile Lys Leu Glu Thr Leu Pro Glu Val
165 170 175
Ile Lys Ala Glu Pro Asp Leu Val Ile Val Gly Gly Gly Ile Ala Asn
180 185 190
Gln Thr Asp Lys Lys Ala Ala Ala Glu Lys Ile Asn Lys Leu Val Lys
195 200 205
Gln Gly Leu
210
<210>2
<211>209
<212>PRT
<213> Methylobacterium flagellatum (Methylobacillus flagellatus)
<400>2
Val Ala Leu Thr Gln Met Ala Leu Asp Ser Leu Asp Phe Asp Ala Thr
1 5 10 15
Val Ala Leu Ala Glu Lys Val Ala Pro His Val Asp Ile Leu Glu Ile
20 25 30
Gly Thr Pro Cys Ile Lys His Asn Gly Ile Lys Leu Leu Glu Thr Leu
35 40 45
Arg Ala Lys Phe Pro Asn Asn Lys Ile Leu Val Asp Leu Lys Thr Met
50 55 60
Asp Ala Gly Phe Tyr Glu Ala Glu Pro Phe Phe Lys Ala Gly Ala Asp
65 70 75 80
Ile Thr Thr Val Leu Gly Val Ala Asp Leu Gly Thr Ile Lys Gly Val
85 9095
Ile Asp Ala Ala Asn Lys Tyr Gly Lys Lys Ala Gln Val Asp Leu Ile
100 105 110
Asn Val Ala Asp Lys Ala Glu Arg Thr Lys Glu Val Ala Lys Leu Gly
115 120 125
Ala His Ile Ile Gly Val His Thr Gly Leu Asp Gln Gln Ala Ala Gly
130 135 140
Gln Thr Pro Phe Ala Asp Leu Ala Thr Val Thr Gly Leu Asn Leu Gly
145 150 155 160
Leu Glu Val Ser Val Ala Gly Gly Val Lys Pro Ala Thr Val Lys Gln
165 170 175
Val Lys Asp Ala Gly Ala Thr Ile Ile Val Ala Gly Ala Ala Ile Tyr
180 185 190
Gly Ala Ala Asp Pro Ala Ala Ala Ala Ala Glu Ile Thr Ala Leu Ala
195 200 205
Lys
<210>3
<211>215
<212>PRT
<213> Methylococcus capsulatus (Methylococcus capsulatus)
<400>3
Met Ala Arg Pro Leu Ile Gln Leu Ala Leu Asp Thr Leu Asp Ile Pro
1 5 10 15
Gln Thr Leu Lys Leu Ala Ser Leu Thr Ala Pro Tyr Val Asp Ile Phe
20 25 30
Glu Ile Gly Thr Pro Ser Ile Lys His Asn Gly Ile Ala Leu Val Lys
35 40 45
Glu Phe Lys Lys Arg Phe Pro Asn Lys Leu Leu Leu Val Asp Leu Lys
50 55 60
Thr Met Asp Ala Gly Glu Tyr Glu Ala Thr Pro Phe Phe Ala Ala Gly
65 70 75 80
Ala Asp Ile Thr Thr Val Leu Gly Val Ala Gly Leu Ala Thr Ile Lys
85 90 95
Gly Val Ile Asn Ala Ala Asn Lys His Asn Ala Glu Val Gln Val Asp
100 105 110
Leu Ile Asn Val Pro Asp Lys Ala Ala Cys Ala Arg Glu Ser Ala Lys
115 120 125
Ala Gly Ala Gln Ile Val Gly Ile His Thr Gly Leu Asp Ala Gln Ala
130 135 140
Ala Gly Gln Thr Pro Phe Ala Asp Leu Gln Ala Ile Ala Lys Leu Gly
145 150 155 160
Leu Pro Val Arg Ile Ser Val Ala Gly Gly Ile Lys Ala Ser Thr Ala
165 170 175
Gln Gln Val Val Lys Thr Gly Ala Asn Ile Ile Val Val Gly Ala Ala
180 185 190
Ile Tyr Gly Ala Ala Ser Pro Ala Asp Ala Ala Arg Glu Ile Tyr Glu
195 200 205
Gln Val Val Ala Ala Ser Ala
210 215
<210>4
<211>184
<212>PRT
<213> Bacillus methanolicus (Bacillus methanolicus)
<400>4
Met Leu Thr Thr Glu Phe Leu Ala Glu Ile Val Lys Glu Leu Asn Ser
1 5 10 15
Ser Val Asn Gln Ile Ala Asp Glu Glu Ala Glu Ala Leu Val Asn Gly
20 25 30
Ile Leu Gln Ser Lys Lys Val Phe Val Ala Gly Ala Gly Arg Ser Gly
35 40 45
Phe Met Ala Lys Ser Phe Ala Met Arg Met Met His Met Gly Ile Asp
50 55 60
Ala Tyr Val Val Gly Glu Thr Val Thr Pro Asn Tyr Glu Lys Glu Asp
65 70 75 80
Ile Leu Ile Ile Gly Ser Gly Ser Gly Glu Thr Lys Ser Leu Val Ser
85 90 95
Met Ala Gln Lys Ala Lys Ser Ile Gly Gly Thr Ile Ala Ala Val Thr
100 105 110
Ile Asn Pro Glu Ser Thr Ile Gly Gln Leu Ala Asp Ile Val Ile Lys
115 120 125
Met Pro Gly Ser Pro Lys Asp Lys Ser Glu Ala Arg Glu Thr Ile Gln
130 135 140
Pro Met Gly Ser Leu Phe Glu Gln Thr Leu Leu Leu Phe Tyr Asp Ala
145 150 155 160
Val Ile Leu Arg Phe Met Glu Lys Lys Gly Leu Asp Thr Lys Thr Met
165 170 175
Tyr Gly Arg His Ala Asn Leu Glu
180
<210>5
<211>181
<212>PRT
<213> Methylobacterium flagellatum (Methylobacillus flagellatus)
<400>5
Met Asn Lys Tyr Gln Glu Leu Val Val Asn Lys Leu Thr Asn Val Ile
1 5 10 15
Asn Asn Thr Ala Glu Gly Tyr Asp Asp Lys Ile Leu Ser Met Val Asp
20 25 30
Ala Ala Gly Arg Thr Phe Leu Gly Gly Ala Gly Arg Ser Leu Leu Val
35 40 45
Ser Arg Phe Phe Ala Met Arg Leu Val His Ala Gly Tyr Gln Val Ser
50 55 60
Met Val Gly Glu Val Val Thr Pro Ser Ile Gln Ala Gly Asp Leu Phe
65 70 75 80
Ile Val Ile Ser Gly Ser Gly Ser Thr Glu Thr Leu Met Pro Leu Val
85 90 95
Arg Lys Ala Lys Ser Gln Gly Ala Lys Val Ile Val Ile Ser Met Lys
100 105 110
Ala Gln Ser Pro Met Ala Glu Leu Ala Asp Leu Val Val Pro Ile Gly
115 120 125
Gly Asn Asp Ala His Ala Phe Asp Lys Thr His Gly Met Pro Met Gly
130 135 140
Thr Ile Phe Glu Leu Ser Thr Leu Trp Phe Leu Glu Ala Thr Ile Ala
145 150 155 160
Lys Leu Ile Asp Gln Lys Gly Leu Thr Glu Glu Gly Met Arg Ala Ile
165 170 175
His Ala Asn Leu Glu
180
<210>6
<211>177
<212>PRT
<213> Methylococcus capsulatus (Methylococcus capsulatus)
<400>6
Met His Gln Lys Leu Ile Ile Asp Lys Ile Ser Gly Ile Leu Ala Ala
1 5 10 15
Thr Asp Ala Gly Tyr Asp Ala Lys Leu Thr Ala Met Leu Asp Gln Ala
20 25 30
Ser Arg Ile Phe Val Ala Gly Ala Gly Arg Ser Gly Leu Val Ala Lys
35 40 45
Phe Phe Ala Met Arg Leu Met His Gly Gly Tyr Asp Val Phe Val Val
50 55 60
Gly Glu Ile Val Thr Pro Ser Ile Arg Lys Gly Asp Leu Leu Ile Val
65 70 75 80
Ile Ser Gly Ser Gly Glu Thr Glu Thr Met Leu Ala Phe Thr Lys Lys
85 90 95
Ala Lys Glu Gln Gly Ala Ser Ile Ala Leu Ile Ser Thr Arg Asp Ser
100 105 110
Ser Ser Leu Gly Asp Leu Ala Asp Ser Val Phe Arg Ile Gly Ser Pro
115 120 125
Glu Leu Phe Gly Lys Val Val Gly Met Pro Met Gly Thr Val Phe Glu
130 135 140
Leu Ser Thr Leu Leu Phe Leu Glu Ala Thr Ile Ser His Ile Ile His
145 150 155 160
Glu Lys Gly Ile Pro Glu Glu Glu Met Arg Thr Arg His Ala Asn Leu
165 170 175
Glu
<210>7
<211>322
<212>PRT
<213> Bacillus methanolicus (Bacillus methanolicus)
<400>7
Met Asn Lys Ile Ala Val Leu Thr Ser Gly Gly Asp Ala Pro Gly Met
1 5 10 15
Asn Ala Ala Ile Arg Ala Val Val Arg Arg Gly Ile Phe Lys Gly Leu
20 25 30
Asp Val Tyr Gly Val Lys Asn Gly Tyr Lys Gly Leu Met Asn Gly Asn
35 40 45
Phe Val Ser Met Asn Leu Gly Ser Val Gly Asp Ile Ile His Arg Gly
50 55 60
Gly Thr Ile Leu Gln Thr Thr Arg Cys Lys Glu Phe Lys Thr Ala Glu
65 70 75 80
Gly Gln Gln Gln Ala Leu Ala Gln Leu Lys Lys Glu Gly Ile Asp Gly
85 90 95
Leu Ile Val Ile Gly Gly Asp Gly Thr Phe Glu Gly Ala Arg Lys Leu
100 105110
Thr Ala Gln Glu Phe Pro Thr Ile Gly Ile Pro Ala Thr Ile Asp Asn
115 120 125
Asp Ile Ala Gly Thr Glu Tyr Thr Ile Gly Phe Asp Thr Ala Val Asn
130 135 140
Thr Ala Val Glu Ala Ile Asp Lys Ile Arg Asp Thr Ala Ala Ser His
145 150 155 160
Asp Arg Ile Tyr Val Val Glu Val Met Gly Arg Asn Ala Gly Asp Ile
165 170 175
Ala Leu Trp Ala Gly Met Cys Ala Gly Ala Glu Ser Ile Ile Ile Pro
180 185 190
Glu Ala Asp His Asp Val Glu Asp Val Ile Asp Arg Ile Lys Gln Gly
195 200 205
Tyr Gln Arg Gly Lys Thr His Ser Ile Ile Val Val Ala Glu Gly Ala
210 215 220
Phe Asn Gly Val Gly Ala Ile Glu Ile Gly Arg Ala Ile Lys Glu Lys
225 230 235 240
Thr Gly Phe Asp Thr Lys Val Thr Ile Leu Gly His Ile Gln Arg Gly
245 250 255
Gly Ser Pro Ser Ala Tyr Asp Arg Met Met Ser Ser Gln Met Gly Ala
260 265270
Lys Ala Val Asp Leu Leu Val Glu Gly Lys Lys Gly Leu Met Val Gly
275 280 285
Leu Lys Asn Gly Gln Leu Ile His Thr Pro Phe Glu Glu Ala Ala Lys
290 295 300
Asp Lys His Thr Val Asp Leu Ser Ile Tyr His Leu Ala Arg Ser Leu
305 310 315 320
Ser Leu
<210>8
<211>320
<212>PRT
<213> Escherichia coli (Escherichia coli)
<400>8
Met Ile Lys Lys Ile Gly Val Leu Thr Ser Gly Gly Asp Ala Pro Gly
1 5 10 15
Met Asn Ala Ala Ile Arg Gly Val Val Arg Ser Ala Leu Thr Glu Gly
20 25 30
Leu Glu Val Met Gly Ile Tyr Asp Gly Tyr Leu Gly Leu Tyr Glu Asp
35 40 45
Arg Met Val Gln Leu Asp Arg Tyr Ser Val Ser Asp Met Ile Asn Arg
50 55 60
Gly Gly Thr Phe Leu Gly Ser Ala Arg Phe Pro Glu Phe Arg Asp Glu
65 70 75 80
Asn Ile Arg Ala Val Ala Ile Glu Asn Leu Lys Lys Arg Gly Ile Asp
85 90 95
Ala Leu Val Val Ile Gly Gly Asp Gly Ser Tyr Met Gly Ala Met Arg
100 105 110
Leu Thr Glu Met Gly Phe Pro Cys Ile Gly Leu Pro Gly Thr Ile Asp
115 120 125
Asn Asp Ile Lys Gly Thr Asp Tyr Thr Ile Gly Phe Phe Thr Ala Leu
130 135 140
Ser Thr Val Val Glu Ala Ile Asp Arg Leu Arg Asp Thr Ser Ser Ser
145 150 155 160
His Gln Arg Ile Ser Val Val Glu Val Met Gly Arg Tyr Cys Gly Asp
165 170 175
Leu Thr Leu Ala Ala Ala Ile Ala Gly Gly Cys Glu Phe Val Val Val
180 185 190
Pro Glu Val Glu Phe Ser Arg Glu Asp Leu Val Asn Glu Ile Lys Ala
195 200 205
Gly Ile Ala Lys Gly Lys Lys His Ala Ile Val Ala Ile Thr Glu His
210 215 220
Met Cys Asp Val Asp Glu Leu Ala His Phe Ile Glu Lys Glu Thr Gly
225 230 235 240
Arg Glu Thr Arg Ala Thr Val Leu Gly His Ile Gln Arg Gly Gly Ser
245 250 255
Pro Val Pro Tyr Asp Arg Ile Leu Ala Ser Arg Met Gly Ala Tyr Ala
260 265 270
Ile Asp Leu Leu Leu Ala Gly Tyr Gly Gly Arg Cys Val Gly Ile Gln
275 280 285
Asn Glu Gln Leu Val His His Asp Ile Ile Asp Ala Ile Glu Asn Met
290 295 300
Lys Arg Pro Phe Lys Gly Asp Trp Leu Asp Cys Ala Lys Lys Leu Tyr
305 310 315 320
<210>9
<211>12
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>9
ggcggcggct cc 12
<210>10
<211>16
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>10
tgaaaggaga tatacc 16
<210>11
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ataacaaccg ttggggaggc atccc 25

Claims (11)

1. A reconstructed methyl engineering bacterium for synergistically assimilating methanol by utilizing a ribulose monophosphate pathway and a serine circulating pathway, wherein host bacteria of the reconstructed methyl engineering bacterium comprise Methylobacterium methyloruber extorques AM1, Methylobacterium methyloruber extorques PA1 or Methylobacillus trichosporium OB3 b;
the exogenous genes introduced into the reconstructed methyl engineering bacteria comprise a coding gene of hexulose-6-phosphate synthase and a coding gene of hexulose-6-phosphate isomerase.
2. The restructured methyl engineering bacteria according to claim 1, wherein the foreign gene is introduced into the host bacteria by using a plasmid as a vector; the coding gene of the hexulose-6-phosphate synthase and the coding gene of the hexulose-6-phosphate isomerase are connected in series.
3. The reconstituted engineered methylotrophic bacterium according to claim 2, wherein the exogenous genes further comprise a gene encoding phosphofructokinase and a gene encoding glucose-6-phosphate dehydrogenase; the coding gene of the phosphofructokinase is connected in series with the 3' end of the hexulose-6-phosphate isomerase; the coding gene of the glucose-6-phosphate dehydrogenase is connected in series with the 3' end of the coding gene of the phosphofructokinase.
4. The reconstituted engineered methyl bacterium according to claim 2, wherein the exogenous genes further comprise a gene encoding phosphofructokinase, a gene encoding transketolase, a gene encoding transaldolase and a gene encoding ribulose phosphate isomerase; the coding gene of the phosphofructokinase is connected in series with the 3' end of the hexulose-6-phosphate isomerase; the coding gene of phosphofructokinase, the coding gene of transketolase, the coding gene of transaldolase and ribulose phosphate isomerase are connected in series in sequence from 5 'to 3'.
5. The engineered recombinant methylotrophic bacterium according to claim 1, wherein the exogenous genes further comprise a gene encoding phosphofructokinase, a gene encoding glucose-6-phosphate dehydrogenase, and a gene encoding malonyl-coa reductase, and C-terminal ends thereof;
a coding gene of the hexulose-6-phosphate synthase, a coding gene of the hexulose-6-phosphate isomerase, a coding gene of phosphofructokinase and a coding gene of glucose-6-phosphate dehydrogenase are introduced into the genome of the host bacterium;
the coding gene and the C end of the malonyl coenzyme A reductase are introduced into the host bacterium by taking a plasmid as a vector.
6. The reconstituted engineered methyl bacterium according to claim 1, wherein the exogenous genes further comprise a gene encoding phosphofructokinase, a gene encoding glucose-6-phosphate dehydrogenase, a gene encoding 2-ketoisovalerate decarboxylase, a gene encoding alcohol dehydrogenase, and a gene encoding acetolactate synthase;
a coding gene of the hexulose-6-phosphate synthase, a coding gene of the hexulose-6-phosphate isomerase, a coding gene of phosphofructokinase and a coding gene of glucose-6-phosphate dehydrogenase are introduced into the genome of the host bacterium;
the coding gene of the 2-ketoisovalerate decarboxylase, the coding gene of the alcohol dehydrogenase and the coding gene of the acetolactate synthase are connected in series in sequence, and plasmids are used as vectors and are introduced into the host bacteria.
7. The engineered bacterium of any one of claims 1 to 6, wherein the hexulose-6-phosphate synthase comprises a first hexulose-6-phosphate synthase, a second hexulose-6-phosphate synthase, or a third hexulose-6-phosphate synthase;
the amino acid sequence of the first ketohexose-6-phosphate synthase is as shown in SEQ ID NO: 1 is shown in the specification;
the amino acid sequence of the second hexulose-6-phosphate synthase is shown in SEQ ID NO: 2 is shown in the specification;
the amino acid sequence of the third ketohexose-6-phosphate synthase is as shown in SEQ ID NO: 3 is shown in the specification;
the hexulose-6-phosphate isomerase comprises a first hexulose-6-phosphate isomerase, a second hexulose-6-phosphate isomerase, or a third hexulose-6-phosphate isomerase;
the amino acid sequence of the first hexulose-6-phosphate isomerase is shown as SEQ ID NO: 4 is shown in the specification;
the amino acid sequence of the second hexulose-6-phosphate isomerase is shown as SEQ ID NO: 5 is shown in the specification;
the amino acid sequence of the third hexulose-6-phosphate isomerase is shown as SEQ ID NO: and 6.
8. The reconstituted engineered methyl bacterium according to any one of claims 2 to 6, wherein the phosphofructokinase comprises a first phosphofructokinase or a second phosphofructokinase;
the amino acid sequence of the first phosphofructokinase is shown as SEQ ID NO: 7 is shown in the specification;
the amino acid sequence of the second phosphofructokinase is shown as SEQ ID NO: shown in fig. 8.
9. The use of the engineered bacterium of any one of claims 1 to 8 in the efficient assimilation of methanol.
10. The use of the engineered bacterium of claim 5 for the preparation of 3-hydroxypropionic acid.
11. Use of the engineered bacterium of claim 6 for the preparation of isobutanol.
CN202010644619.1A 2020-07-07 2020-07-07 Reconstructed methyl engineering bacterium for synergistic assimilation of methanol by ribulose monophosphate pathway and serine circulation pathway and application thereof Withdrawn CN111808791A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010644619.1A CN111808791A (en) 2020-07-07 2020-07-07 Reconstructed methyl engineering bacterium for synergistic assimilation of methanol by ribulose monophosphate pathway and serine circulation pathway and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010644619.1A CN111808791A (en) 2020-07-07 2020-07-07 Reconstructed methyl engineering bacterium for synergistic assimilation of methanol by ribulose monophosphate pathway and serine circulation pathway and application thereof

Publications (1)

Publication Number Publication Date
CN111808791A true CN111808791A (en) 2020-10-23

Family

ID=72841801

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010644619.1A Withdrawn CN111808791A (en) 2020-07-07 2020-07-07 Reconstructed methyl engineering bacterium for synergistic assimilation of methanol by ribulose monophosphate pathway and serine circulation pathway and application thereof

Country Status (1)

Country Link
CN (1) CN111808791A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113151130A (en) * 2021-03-15 2021-07-23 西安交通大学 Genetically engineered bacterium and application thereof in preparation of isobutanol by bioconversion of methane

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113151130A (en) * 2021-03-15 2021-07-23 西安交通大学 Genetically engineered bacterium and application thereof in preparation of isobutanol by bioconversion of methane

Similar Documents

Publication Publication Date Title
Chu et al. Genetic improvement of Saccharomyces cerevisiae for xylose fermentation
EP2379730B1 (en) Method for the preparation of diols
Sasaki et al. Xylitol production by recombinant Corynebacterium glutamicum under oxygen deprivation
CA2879680A1 (en) Xylose isomerases and their uses
JP5564423B2 (en) Coryneform bacterium transformant with improved D-xylose utilization function
CN107771214B (en) Modified microorganisms for optimized 2,4-dihydroxybutyric acid production with increased 2,4-dihydroxybutyric acid excrements
CN109536398A (en) For the recombinant microorganism in the increased method of yield
Liao et al. The significance of proline on lignocellulose-derived inhibitors tolerance in Clostridium acetobutylicum ATCC 824
US10385322B2 (en) Mutant glutamate dehydrogenase for the conversion of homoserine into 4-hydroxy-2-ketobutyrate
CN105813625A (en) A method for producing acyl amino acids
CN109370967A (en) A kind of engineering bacteria and its application in tyrosol production
KR20140042888A (en) A pentose sugar fermenting cell
Gao et al. High-yield production of D-1, 2, 4-butanetriol from lignocellulose-derived xylose by using a synthetic enzyme cascade in a cell-free system
CN116083468A (en) Build with glucose, glycerol and CO 2 Method and strain of engineering bacteria of Ralstonia for producing inositol from carbon source
US20180030482A1 (en) Use of acetaldehyde in the fermentative production of ethanol
CN111808791A (en) Reconstructed methyl engineering bacterium for synergistic assimilation of methanol by ribulose monophosphate pathway and serine circulation pathway and application thereof
Zhang et al. Consolidated bioprocessing for bioethanol production by metabolically engineered cellulolytic fungus Myceliophthora thermophila
CN114480236A (en) Construction method of 2-KLG (bacillus gluconicum) production one-step strain chassis cell bank
CN112852859B (en) Method for improving synthesis capacity of filamentous fungi organic acid
CN111996157A (en) Gene engineering bacterium for efficiently producing 1, 3-propylene glycol and construction method and application thereof
CN114806998B (en) Ralstonia engineering bacterium for producing glucose and fermentation production method
JP4333088B2 (en) Production method of novel gene and target substance of Gluconobacter bacteria
CN114525215A (en) Recombinant strain for producing terpenoid, construction method thereof, method for producing terpenoid through fermentation and application of recombinant strain
CN113025506B (en) Recombinant filamentous fungus for producing ethanol and construction and application thereof
CN110499259B (en) Yarrowia lipolytica YW100-1 and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WW01 Invention patent application withdrawn after publication

Application publication date: 20201023

WW01 Invention patent application withdrawn after publication