CN111793643A - Silkworm fibroin heavy chain expression system for expressing target protein distributed in silk fibroin and sericin, preparation method and application - Google Patents
Silkworm fibroin heavy chain expression system for expressing target protein distributed in silk fibroin and sericin, preparation method and application Download PDFInfo
- Publication number
- CN111793643A CN111793643A CN202010691454.3A CN202010691454A CN111793643A CN 111793643 A CN111793643 A CN 111793643A CN 202010691454 A CN202010691454 A CN 202010691454A CN 111793643 A CN111793643 A CN 111793643A
- Authority
- CN
- China
- Prior art keywords
- heavy chain
- silk
- fibroin
- silkworm
- expression system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 49
- 230000014509 gene expression Effects 0.000 title claims abstract description 47
- 102000004169 proteins and genes Human genes 0.000 title claims abstract description 30
- 108010022355 Fibroins Proteins 0.000 title claims abstract description 28
- 108010013296 Sericins Proteins 0.000 title claims abstract description 18
- 108010064995 silkworm fibroin Proteins 0.000 title claims description 14
- 238000002360 preparation method Methods 0.000 title abstract description 7
- 241000255789 Bombyx mori Species 0.000 claims abstract description 58
- 101710197767 Fibroin heavy chain Proteins 0.000 claims abstract description 24
- 108091034057 RNA (poly(A)) Proteins 0.000 claims abstract description 15
- 239000013598 vector Substances 0.000 claims description 49
- 239000013612 plasmid Substances 0.000 claims description 15
- 210000004436 artificial bacterial chromosome Anatomy 0.000 claims description 9
- 108090000790 Enzymes Proteins 0.000 claims description 8
- 102000004190 Enzymes Human genes 0.000 claims description 8
- 238000002347 injection Methods 0.000 claims description 7
- 239000007924 injection Substances 0.000 claims description 7
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 101001052041 Bombyx mori Fibroin heavy chain Proteins 0.000 claims description 5
- 108091008146 restriction endonucleases Proteins 0.000 claims description 5
- 239000002773 nucleotide Substances 0.000 claims description 4
- 125000003729 nucleotide group Chemical group 0.000 claims description 4
- 230000007704 transition Effects 0.000 claims description 4
- 238000004519 manufacturing process Methods 0.000 claims 5
- 210000004907 gland Anatomy 0.000 abstract description 31
- 230000009261 transgenic effect Effects 0.000 abstract description 29
- 238000004458 analytical method Methods 0.000 abstract description 9
- 108010048367 enhanced green fluorescent protein Proteins 0.000 abstract description 9
- 238000001514 detection method Methods 0.000 abstract description 6
- 238000011161 development Methods 0.000 abstract description 6
- 230000009286 beneficial effect Effects 0.000 abstract description 4
- 230000015572 biosynthetic process Effects 0.000 abstract description 4
- 230000007246 mechanism Effects 0.000 abstract description 4
- 241000238631 Hexapoda Species 0.000 abstract description 3
- 239000003292 glue Substances 0.000 abstract description 3
- 238000009366 sericulture Methods 0.000 abstract description 3
- 238000012217 deletion Methods 0.000 abstract description 2
- 230000037430 deletion Effects 0.000 abstract description 2
- 230000007774 longterm Effects 0.000 abstract description 2
- 108020004414 DNA Proteins 0.000 description 11
- 238000010367 cloning Methods 0.000 description 10
- 239000012634 fragment Substances 0.000 description 8
- 238000011160 research Methods 0.000 description 8
- 238000002073 fluorescence micrograph Methods 0.000 description 7
- 238000000034 method Methods 0.000 description 7
- 238000005516 engineering process Methods 0.000 description 6
- 239000013605 shuttle vector Substances 0.000 description 6
- 238000001262 western blot Methods 0.000 description 6
- 210000001161 mammalian embryo Anatomy 0.000 description 5
- 238000000520 microinjection Methods 0.000 description 5
- 230000003321 amplification Effects 0.000 description 4
- 230000018109 developmental process Effects 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 238000010222 PCR analysis Methods 0.000 description 3
- 108700019146 Transgenes Proteins 0.000 description 3
- 210000004027 cell Anatomy 0.000 description 3
- 238000010276 construction Methods 0.000 description 3
- 239000000539 dimer Substances 0.000 description 3
- 235000013601 eggs Nutrition 0.000 description 3
- WSFSSNUMVMOOMR-UHFFFAOYSA-N Formaldehyde Chemical compound O=C WSFSSNUMVMOOMR-UHFFFAOYSA-N 0.000 description 2
- 102000003886 Glycoproteins Human genes 0.000 description 2
- 108090000288 Glycoproteins Proteins 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 150000001875 compounds Chemical class 0.000 description 2
- 238000001218 confocal laser scanning microscopy Methods 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 150000007523 nucleic acids Chemical group 0.000 description 2
- 238000002415 sodium dodecyl sulfate polyacrylamide gel electrophoresis Methods 0.000 description 2
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 description 1
- 241000255794 Bombyx mandarina Species 0.000 description 1
- 208000034454 F12-related hereditary angioedema with normal C1Inh Diseases 0.000 description 1
- 101710124870 Fibroin light chain Proteins 0.000 description 1
- 241000255777 Lepidoptera Species 0.000 description 1
- 241001590997 Moolgarda engeli Species 0.000 description 1
- 241000283973 Oryctolagus cuniculus Species 0.000 description 1
- 108010076504 Protein Sorting Signals Proteins 0.000 description 1
- 241000382353 Pupa Species 0.000 description 1
- 102000008579 Transposases Human genes 0.000 description 1
- 108010020764 Transposases Proteins 0.000 description 1
- 239000007983 Tris buffer Substances 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 210000004899 c-terminal region Anatomy 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 210000002472 endoplasmic reticulum Anatomy 0.000 description 1
- 238000001917 fluorescence detection Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 239000011521 glass Substances 0.000 description 1
- 230000012447 hatching Effects 0.000 description 1
- 208000016861 hereditary angioedema type 3 Diseases 0.000 description 1
- 238000010562 histological examination Methods 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 238000007852 inverse PCR Methods 0.000 description 1
- 230000009456 molecular mechanism Effects 0.000 description 1
- 231100000252 nontoxic Toxicity 0.000 description 1
- 230000003000 nontoxic effect Effects 0.000 description 1
- 238000002205 phenol-chloroform extraction Methods 0.000 description 1
- 229920002401 polyacrylamide Polymers 0.000 description 1
- 230000008488 polyadenylation Effects 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 230000003252 repetitive effect Effects 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 230000009897 systematic effect Effects 0.000 description 1
- LENZDBCJOHFCAS-UHFFFAOYSA-N tris Chemical compound OCC(N)(CO)CO LENZDBCJOHFCAS-UHFFFAOYSA-N 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
- DGVVWUTYPXICAM-UHFFFAOYSA-N β‐Mercaptoethanol Chemical compound OCCS DGVVWUTYPXICAM-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
- A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
- A01K67/0337—Genetically modified Arthropods
- A01K67/0339—Genetically modified insects, e.g. Drosophila melanogaster, medfly
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/05—Animals modified by non-integrating nucleic acids, e.g. antisense, RNAi, morpholino, episomal vector, for non-therapeutic purpose
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/70—Invertebrates
- A01K2227/706—Insects, e.g. Drosophila melanogaster, medfly
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/01—Animal expressing industrially exogenous proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/103—Plasmid DNA for invertebrates
- C12N2800/105—Plasmid DNA for invertebrates for insects
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Husbandry (AREA)
- Animal Behavior & Ethology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a fibroin heavy chain expression system for expressing target protein by fibroin and sericin, a preparation method and application thereof, wherein the expression system contains a fibroin heavy chain promoter 3 at the 5' end; the 3' end is an expression frame of a heavy chain gene poly (A) sequence, the system is utilized to express exogenous protein, and through identification and detection analysis of transgenic silkworms, the existence of EGFP is detected in silk glands and cocoon silk, and a silk glue layer is also distributed in the cocoon silk, which shows that the N end is not an essential factor for the formation of silk under the condition that the C end does not exist, and the protein can be distributed in the silk glue layer due to the deletion of the C end. The analysis of the N-terminal of the silk fibroin provides experimental and theoretical basis for the silk forming mechanism of the silk, is beneficial to creating a real practical silkworm silk gland bioreactor, keeps the sustainable development of the silk industry, and promotes the long-term development of the sericulture and insect discipline in China.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to a silkworm silk fibroin heavy chain expression system for expressing that target protein is distributed in fibroin and sericin; also relates to a preparation method and application of the system.
Background
The main components of silkworm cocoon silk are two proteins, namely fibroin (fibroin) and sericin (sericin), wherein the fibroin is the main component of the cocoon silk and accounts for about 82% of the weight of the cocoon silk. The silk fibroin is synthesized by Posterior Silk Gland (PSG) cells of silkworm, the sericin is synthesized by Middle Silk Gland (MSG) cells, and the silk and the sericin are gathered in the middle silk gland, and finally are squeezed by the Anterior Silk Gland (ASG) to spin and cocoon. The silk fibroin is composed of three proteins of 350-kDa heavy chain protein (H-chain), 26-kDa light chain protein (L-chain) and 30-kDa fibrihemamerin/P25 (fhx). These proteins first form fibroin basic units in a certain ratio (H-chain: L-chain: fhx ═ 6: 6: 1) in posterior silk gland cells, and then the fibroin basic units are secreted into the lumen of the silk gland. Wherein the fibroin basic unit is composed of 6 disulfide-bonded heavy chain, light chain (H-L) dimers and 1P 25 glycoprotein molecule. The H-L dimer forms a disulfide bond between Cys-172 of Fib-L and Cys-c20 of Fib-H. One P25 glycoprotein and six H-L dimers form the silk basic unit on the endoplasmic reticulum through non-covalent interactions with the N-terminal domain (NTD) of the heavy chain. Heavy chain protein is the most predominant component in the fibroin unit, up to 92%, and is responsible for the superior mechanical properties of cocoon filaments, whereas light chain protein accounts for only about 7%, fhx for about 1%. And the fibroin heavy chain is composed of 12 crystalline regions in the middle, 11 non-crystalline regions and two conserved hydrophilic N-terminal domains (NTD) and C-terminal domains (CTD) at two ends.
Since the silkworm genome frame map is firstly completed by the leadership of the Chinese silkworm genome planning research group, the method not only establishes the international status of domestic silkworm functional genome research, but also provides a new opportunity for the development of silk industry and insect discipline. The major efforts at the functional genomics stage include: the identification and cloning of main functional genes, the elucidation of the molecular mechanism of important biological traits and the final realization of the artificial regulation and creation of important economic traits. The most important character of silkworm is that the silk gland of silkworm can synthesize large amount of spun silk protein in short time and high efficiency. By utilizing the characteristics of the silk gland of the silkworm, the high-efficiency expression of the foreign protein in the silk gland is always the aim pursued by many technical workers in the sericulture and the biological science. However, there are still many details about the research on the filamentation mechanism, which require the scientific research workers to analyze, and especially what the various elements of the silk fibroin heavy chain, which accounts for the largest proportion of cocoon silk and is mainly responsible for the mechanical properties of silk, play in the silk formation process needs to be further researched.
The silkworm embryo microinjection transgene technology of the transposon piggyBac from lepidoptera is successful in Japan initially, and through the efforts of researchers, the silkworm embryo microinjection transgene technology which is systematic and complete is also established, and a good foundation is laid for the development of the research. In the research reports of the silkworm embryo microinjection transgene technology by utilizing transposon piggyBac, the complete N end and the complete C end (LBS) of a fibroin heavy chain are reported, but the method for expressing foreign protein by utilizing a silkworm fibroin heavy chain expression system (the complete N end and no C end) is not reported, so that the effect of the fibroin heavy chain element N, C end is further researched, and an experimental and theoretical basis is provided for the research of a silk filamentation mechanism.
Disclosure of Invention
In view of the above, the present invention aims to provide a silkworm fibroin heavy chain expression system for expressing that target proteins are distributed in silk fibroin and sericin; the second purpose of the invention is to provide a recombinant vector containing the silkworm fibroin heavy chain expression system; the third object of the present invention is to provide a method for preparing the recombinant vector; the fourth purpose of the invention is to provide the application of the silkworm fibroin heavy chain expression system or the recombinant vector in expressing target protein through fibroin and sericin.
In order to achieve the purpose, the invention provides the following technical scheme:
1. expressing a silkworm fibroin heavy chain expression system with target protein distributed in fibroin and sericin, wherein the silkworm fibroin heavy chain expression system contains a target gene expression frame, and the 5' end of the expression frame is a fibroin heavy chain promoter 3Fib-H P3; the 3' end is a heavy chain gene poly (A) sequence; the nucleotide of the fibroin heavy chain promoter 3Fib-H P3 is shown as SEQ ID NO. 1; the nucleotide sequence of the chain gene poly (A) sequence is shown as SEQ ID NO. 2.
2. A recombinant vector containing the silkworm fibroin heavy chain expression system.
Preferably, the bombyx mori fibroin heavy chain expression system is obtained by connecting a target gene expression cassette into a pSLfa1180fa vector through BamHI and HindIII enzyme cutting sites.
Preferably, the bombyx mori fibroin heavy chain expression system is obtained by connecting a target gene expression cassette into enzyme cutting sites of AscI and FseI of a pBac [3 xP 3DsRedaf ] vector.
3. The recombinant vector is obtained by connecting a target gene expression frame into a pSLfa1180fa vector through BamHI and HindIII enzyme cutting sites.
Preferably, the preparation method is as follows: firstly, a heavy chain gene poly (A) sequence is connected into a pSLfa1180fa vector through BamHI and SalI enzyme cutting sites to obtain a pSL-poly (A) plasmid, then a target gene is connected into the pSL-poly (A) plasmid through XbaI and BamHI to obtain a transition vector containing the target gene, and finally a fibroin heavy chain promoter 3Fib-H P3 is connected into the transition vector containing the target gene through BamHI and HindIII to obtain the domestic fibroin heavy chain expression system pSL-poly (A) -target gene-Fib-H P3.
Preferably, the fibroin heavy chain promoter 3 is obtained by taking SEQ ID NO.3 and SEQ ID NO.4 as primers and bacterial artificial chromosome clone containing a silk fibroin gene of a silkworm variety p50 as a template through PCR amplification.
Preferably, the heavy chain gene poly (A) sequence is obtained by taking the sequences shown in SEQ ID NO.5 and SEQ ID NO.6 as primers and bacterial artificial chromosome clone containing silk fibroin gene of silkworm variety p50 as a template through PCR amplification.
Preferably, the preparation method is as follows: the recombinant vector obtained in claim 3 was inserted into the piggyBac-derived vector pBac [3 XP 3DsRedaf ] vector using restriction enzymes AscI and FseI to form a final injection vector.
4. The use of the bombyx mori fibroin heavy chain expression system or the recombinant vector of claim 1 in expressing target proteins through silk fibroin and sericin.
The invention has the beneficial effects that: the invention discloses a domestic fibroin heavy chain expression system, which comprises a fibroin heavy chain promoter 3 at the 5' end; the 3' end is an expression frame of a heavy chain gene poly (A) sequence, the system (N end is complete and no C end) is used for expressing exogenous protein, through identification and detection analysis of transgenic silkworms, the existence of EGFP is detected in silk glands and cocoon silk is found, and a sericin layer in the cocoon silk is also distributed, which shows that the N end is not necessary for the formation of the silkworms under the condition that the C end does not exist, and the protein can be distributed in the sericin layer due to the deletion of the C end. The analysis of the N-terminal of the silk fibroin provides experimental and theoretical basis for the silk forming mechanism of the silk, is beneficial to creating a real practical silkworm silk gland bioreactor, keeps the sustainable development of the silk industry, and promotes the long-term development of the sericulture and insect discipline in China.
Drawings
In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:
FIG. 1 is a diagram showing the structure of a transgenic vector (A: a shuttle vector pSLfa1180fa containing a multiple cloning site; B: piggyBac-derived vector pBac [3 XP 3DsRed ], C: the resulting final injection vector pBac [3 XP 3-DsRed-SV40-poly (A) -EGFP-Fib-H P3])
FIG. 2 shows fluorescence screening of the obtained transgenic silkworms (A: observation results of the compound eyes of the wild-type and transgenic silkworms under White light and red fluorescence, a: wild-type White light, B: wild-type red fluorescence, c: White light of the transgenic silkworms, d: red light of the transgenic silkworms, B: observation of the wild-type and transgenic silkworm cocoons under White light and green fluorescence, a: wild-type White light, B: White light of the transgenic silkworms, c: wild-type green fluorescence, d: green fluorescence of the transgenic silkworms, WT: wild-type, TS-H-NG: transgenic silkworms, White light, RFP-fluorescent: red fluorescence, GFP-fluorescent: green fluorescence, GFPstd: green fluorescence protein standard)
FIG. 3 shows an SDS-PAGE electrophoresis and a Western blotting of EGFP (A: SDS-PAGE electrophoresis; B: Western blotting).
FIG. 4 is a whole fluorescence image of silk gland of five-year-old silkworm 2 days (a: white light image of wild silk gland; b: white light image of transgenic silk gland; c: green fluorescence image of wild silk gland; d: green fluorescence image of transgenic silk gland; e: green fluorescence magnification image of transgenic silk gland).
FIG. 5 is a five-instar five-day silk gland and cocoon silk frozen section image (A: silk gland frozen section image, a is wild-type silk gland white light image, B is transgenic silk gland white light image, c is wild-type silk gland green fluorescence image, d is transgenic silk gland green fluorescence image, B: cocoon silk frozen section image, a is wild-type silk gland white light image, B is transgenic silk gland white light image, c is wild-type silk gland green fluorescence image, d is transgenic silk gland green fluorescence image).
Detailed Description
The present invention is further described with reference to the following drawings and specific examples so that those skilled in the art can better understand the present invention and can practice the present invention, but the examples are not intended to limit the present invention.
The invention combines the silkworm embryo microinjection technology, the fluorescence detection and the molecular biological operation technology, constructs a silkworm fibroin heavy chain expression system (with complete N end and no C end) specifically expressed in the silkworm silk gland, the length of the N end sequence is 2304bp, and the nucleic acid sequence is as follows:
aagcttgttgtacaaaactgccacacgcatttttttctccactgtaggttgtagttacgcgaaaacaaaatcgttctgtg aaaattcaaacaaaaatattttttcgtaaaaacacttatcaatgagtaaagtaacaattcatgaataatttcatgtaaaa aaaaaatactagaaaaggaatttttcattacgagatgcttaaaaatctgtttcaaggtagagatttttcgatatttcgga aaattttgtaaaactgtaaatccgtaaaattttgctaaacatatattgtgttgttttggtaagtattgacccaagctatc acctcctgcagtatgtcgtgctaattactggacacattgtataacagttccactgtattgacaataataaaacctcttca ttgacttgagaatgtctggacagatttggctttgtatttttgatttacaaatgtttttttggtgatttacccatccaagg cattctccaggatggttgtggcatcacgccgattggcaaacaaaaactaaaatgaaactaaaaagaaacagtttccgctg tcccgttcctctagtgggagaaagcatgaagtaagttctttaaatattacaaaaaaattgaacgatattataaaattctt taaaatattaaaagtaagaacaataagatcaattaaatcataattaatcacattgttcatgatcacaatttaatttactt catacgttgtattgttatgttaaataaaaagattaatttctatgtaattgtatctgtacaatacaatgtgtagatgttta ttctatcgaaagtaaatacgtcaaaactcgaaaattttcagtataaaaaggttcaactttttcaaatcagcatcagttcg gttccaactctcaagatgagagtcaaaacctttgtgatcttgtgctgcgctctgcaggtgagttaattattttactatta tttcagaaggtggccagacgatatcacgggccacctgataataagtggtcgccaaaacgcacagatatcgtaaattgtgc catttgatttgtcacgcccgggggggctacggaataaactacatttatttatttaaaaaatgaaccttagattatgtaacttgtgatttatttgcgtcaaaagtaggcaagatgaatctatgtaaatacctgggcagacttgcaatatcctatttcaccg gtaaatcagcattgcaatatgcaatgcatattcaacaatatgtaaaacaattcgtaaagcatcattagaaaatagacgaa agaaattgcataaaattataaccgcattattaatttattatgatatctattaacaattgctattgcctttttttcgcaaa ttataatcattttcataacctcgaggtagcattctgttacattttaatacattggtatgtgattataacacgagctgccc actgagtttctcgccagatcttctcagtgggtcgcgttaccgatcacgtgatagattctatgaagcactgctcttgttag ggctagtgttagcaaattctttcaggttgagtctgagagctcacctacccatcggagcgtagctggaataggctaccagc taataggtagggaaaacaaagctcgaaacaagctcaagtaataacaacataatgtgaccataaaatctcgtggtgtatga gatacaattatgtactttcccacaaatgtttacataattagaatgttgttcaacttgcctaacgccccagctagaacatt caattattactattaccactactaaggcagtatgtcctaactcgttccagatcagcgctaacttcgattgaatgtgcgaa atttatagctcaatattttagcacttatcgtattgatttaagaaaaaattgttaacattttgtttcagtatgtcgcttat acaaatgcaaacatcaatgattttgatgaggactattttgggagtgatgtcactgtccaaagtagtaatacaacagatga aataattagagatgcatctggggcagttatcgaagaacaaattacaactaaaaaaatgcaacggaaaaataaaaaccatg gaatacttggaaaaaatgaaaaaatgatcaagacgttcgttataaccacggattccgacggtaacgagtccattgtagag gaagatgtgctcatgaagacactttccgatggtactgttgctcaaagttatgttgctgctgatgcgggagcatattctca gagcgggccatacgtatcaaacagtggatacagcactcatcaaggatatacgagcgatttcagc(SEQ ID NO.1)
the length of the poly (A) sequence is 159bp, and the nucleic acid sequence is:
tttttaatataaaataacccttgtttcttacttcgtcctggatacatctatgttttttttttcgttaataaatgagagca tttaagttattgtttttaattacttttttttagaaaacagatttcggattttttgtatgcattttatttgaatgtacta (SEQ ID NO.2)
the invention relates to a method for expressing exogenous protein by utilizing a bombyx mori fibroin heavy chain expression system (with complete N end and no C end), which comprises the following specific steps.
Example 1 construction of vectors
The piggyBac derived vector pBac [3 xP 3DsRedaf ] obtained in the previous period is used as an injection transposon vector, the recombinant pBac [3 xP 3DsRedaf ] injection transposon vector is constructed by utilizing a pSLfa1180fa cloning shuttle vector by a two-step cloning method, firstly, complex construction is completed in the pSLfa1180fa cloning shuttle vector containing all polyclonal sites of restriction enzymes capable of recognizing 6 bases, then the constructed recombinant pSLfa1180fa cloning shuttle vector is digested by restriction enzymes AscI and FseI capable of recognizing 10 bases, and the obtained recombinant target gene part is finally cloned into the piggyBac derived vector pBac [3 xP 3-DsRedaf ] (inserted by restriction enzyme sites AscI and FseI) to form a target recombinant injection vector.
The PCR amplification of the promoter element is to use Bacterial Artificial Chromosome (BAC) clone (hereinafter, H-chain BAC) containing silkworm variety p50 silk fibroin gene as a template (the sequence number of DDBJ/EMBL/GenBank is AF226688), the EGFP gene is obtained by amplifying pBS-A3EGFP plasmid, and the specific construction is as follows:
obtaining of different element fragments:
the fibroin heavy chain promoter 3 (abbreviated as Fib-H P3) comprising the complete N-terminal consists of the 5 '-upstream sequence of the fibroin heavy chain gene, exon 1, intron 1 and the 5' -non-repetitive sequence of exon 2, and is prepared by using Fib-H-P-f (61547-61564): 5' -aagcttgttgtacaaaactgcc-3' (SEQ ID NO.3) and Fib-H-P-r (63846-63823): 5' -gctatctagagctgaaatcgctcgtatatccttg-3' (SEQ ID NO.4) primer pair was obtained from H-chain BAC amplification; heavy chain gene polyadenylation signal sequence (poly (A)) using a poly (A) -f (79200-79219) containing a BamHI site: 5' -gtacggatccatttttaatataaaataaccc-3' (SEQ ID NO.5) and poly (A) -r (79359-79335) containing a SalI site: 5' -gcgcgtcgactagtacattcaaataaaatgcatac-3' (SEQ ID NO.6) was obtained from a H-chain BAC amplification; the EGFP gene was expressed using an EGFP-f containing an XbaI site: 5' -ctagtctagaatggtgagcaagggcgagg-3' (SEQ ID NO.7) and EGFP-r containing a BamHI site: 5' -cagtggatccttgtacagctcgtccatgccg-3' (SEQ ID NO.8) was obtained from pBS-A3EGFP plasmid amplification under PCR amplification conditions of pre-denaturation at 94 ℃ for 5 minutes, denaturation at 94 ℃ for 1 minute, annealing at 50 ℃ for 1 minute and extension at 72 ℃ for 1 minute and 30 seconds followed by 25 cycles of denaturation at 94 ℃ for 1 minute and annealing at 55 ℃ for 1 minute; and a cycle of extension at 72 ℃ for 1 min 30 sec, followed by extension at 72 ℃ for 7 min and storage at 4 ℃;
these amplification elements were then cloned into the pSLfa1180fa (hereinafter abbreviated as pSL) shuttle vector (FIG. 1, A) as follows: cloning a poly (A) fragment into a pSL shuttle vector through BamHI and SalI to obtain a pSL-poly (A) plasmid; cloning the EGFP fragment, and ligating the EGFP fragment into a pSL-poly (A) plasmid through XbaI and BamHI to obtain a pSL-poly (A) -EGFP plasmid; ③ cloning the Fib-H P3 fragment, connecting the fragment into pSL-poly (A) -EGFP plasmid by XbaI and Hind III to obtain pSL-poly (A) -EGFP-Fib-H P3 plasmid;
finally, cloning the recombinant target gene expression frame of the obtained pSL-poly (A) -EGFP-Fib-H P3 plasmid into a pBac [3 xP 3-DsRed ] vector (figure 1, B) to obtain a recombinant injection vector pBac [3 xP 3-DsRed-SV40-poly (A) -EGFP-Fib-H P3] (figure 1, C);
example 2 obtaining of transgenic silkworms (transgenic silkworms named TS-H-NG)
pHA3PIG (Tamura et al, 2000) is used as an auxiliary plasmid to produce transposase, plasmid DNA is purified and injected by QIAGEN plasmid midi kit (Qiagen), silkworm embryo microinjection is carried out according to the method described by Kanda & Tamura (1991), the injected silkworm eggs are sealed by nontoxic glue, incubation is carried out at 25 ℃ until hatching, hatched silkworms are bred, silkworms of the current generation (G0) are selfed or backcrossed to obtain silkworm eggs of the G1 generation, and transgenic individuals are obtained by scanning the silkworm eggs of the G1 generation; finally, the obtained transgenic individuals are raised and passaged, and detection and fluorescence observation of EGFP expression are carried out.
The detection of the specific expression of the promoter and the observation of the presence site of the foreign protein are as follows:
the obtained transgenic silkworms were subjected to genomic PCR, inverse PCR, Western blotting and fluorescence observation and analysis, and the results are shown in FIG. 2. The results showed that red fluorescence and green fluorescence could be detected in transgenic silkworms.
Genomic PCR analysis: the genome DNA of the transgenic silkworm and wild silkworm is extracted from G1 generation moth or G2 generation 7 days pupa by phenol-chloroform method. And carrying out PCR analysis on the EGFP-f and EGFP-r by using a primer pair, and then carrying out agarose gel electrophoresis analysis and detection. The results show that TS-H-NG silkworm moth shows red color in eyes under red fluorescence, and silkworm cocoon shows green color under green fluorescence condition. The result shows that the transgenic positive silkworm TS-H-NG is successfully obtained.
Reverse PCR analysis: the insertion site of the piggyBac vector on the chromosome is determined by using a reverse transcription polymerase chain reaction (reverse PCR) technology. 10 μ g of genomic DNA was digested with HaeIII overnight at 37 ℃ and circularized overnight at 16 ℃. The ligation products were amplified with transposon specific primers PLF/PLR (piggyBac left arm) and PRF/PRR (piggyBac right arm). The PCR fragments were cloned and sequenced. Application program using SilkMap ((R))www.silkdb.org/silksoft/silkmap.html) The positioning of the silkworm genome insertion site of the piggyBac vector is completed. The results show that TS-H-NG has a clear single band relative to the control wild type.
③ Western blotting analysis: cocoon fragments from which silk waste has been removed are dissolved in a 60% LiSCN solution (dissolved and treated at a ratio of about 0.025g cocoon pieces/1 ml of 60% LiSCN), and then centrifuged to collect the supernatant, which is then diluted 5-fold with Tris buffer (10 mM Tris-HCl pH 7.0, 2% SDS, 5% beta-mercaptoethanol) to be used as a sample for experimental analysis. These samples were mixed with 5 Xloading buffer and denatured at 100 ℃ for 5 minutes before loading on 12% SDS-polyacrylamide gel and Western blotting analysis. The antibody analyzed by Western blotting was GFP Rabbit monoclonal antibody (Beyotime, C.H.N.), and the standard sample of GFP was Recombinant A.Victoria GFP protein (abcam, U.K.). The results showed that GFP protein expression could be detected in transgenic silkworms (fig. 3).
Fourthly, the silk glands of the transgenic silkworms of G2 generation 5 instar larvae on day 2 are dissected and placed on a glass slide, and the expression and the existence position of EGFP are detected and observed by using an Olympus MacroViewMVX10-AUTO fluorescence stereomicroscope (Olympus, Tokyo, Japan), and the result is shown in FIG. 4. The results showed that green fluorescence could be observed in the transgenic silkworm silk glands.
Histological examination of the frozen sections: g2 generation five-day old silk glands are placed in 10 vol.% formalin for fixation, then embedded in Tissue-Tek o.c.t. compounds (Sakura Finetechnical co., Ltd.) together with cocoon silk and cut into 10 μm thick slices, and egfp detection and presence position observation are performed on frozen sections of silk and silk monofilaments by using a fluorescence stereo microscope and a confocal laser scanning microscope (CLSM or LSCM), and the results are shown in fig. 5. The results show that the presence of GFP was detected in both the silk gland and cocoon silk, indicating that the N-terminus is not an essential factor for silk formation in the absence of the C-terminus.
The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or the change made by the person skilled in the art on the basis of the present invention are within the protection scope of the present invention. The protection scope of the invention is subject to the claims.
Sequence listing
<110> Chongqing West silkworm Biotechnology research institute, Inc.; southwest university
<120> expression system for expressing heavy chain expression of silkworm fibroin and sericin with target protein distributed in fibroin and sericin, preparation method and application <160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>2304
<212>DNA
<213> silkworm (Bombyx mori Linnaeus)
<400>1
aagcttgttg tacaaaactg ccacacgcat ttttttctcc actgtaggtt gtagttacgc 60
gaaaacaaaa tcgttctgtg aaaattcaaa caaaaatatt ttttcgtaaa aacacttatc 120
aatgagtaaa gtaacaattc atgaataatt tcatgtaaaa aaaaaatact agaaaaggaa 180
tttttcatta cgagatgctt aaaaatctgt ttcaaggtag agatttttcg atatttcgga 240
aaattttgta aaactgtaaa tccgtaaaat tttgctaaac atatattgtg ttgttttggt 300
aagtattgac ccaagctatc acctcctgca gtatgtcgtg ctaattactg gacacattgt 360
ataacagttc cactgtattg acaataataa aacctcttca ttgacttgag aatgtctgga 420
cagatttggc tttgtatttt tgatttacaa atgttttttt ggtgatttac ccatccaagg 480
cattctccag gatggttgtg gcatcacgcc gattggcaaa caaaaactaa aatgaaacta 540
aaaagaaaca gtttccgctg tcccgttcct ctagtgggag aaagcatgaa gtaagttctt 600
taaatattac aaaaaaattg aacgatatta taaaattctt taaaatatta aaagtaagaa 660
caataagatc aattaaatca taattaatca cattgttcat gatcacaatt taatttactt 720
catacgttgt attgttatgt taaataaaaa gattaatttc tatgtaattg tatctgtaca 780
atacaatgtg tagatgttta ttctatcgaa agtaaatacg tcaaaactcg aaaattttca 840
gtataaaaag gttcaacttt ttcaaatcag catcagttcg gttccaactc tcaagatgag 900
agtcaaaacc tttgtgatct tgtgctgcgc tctgcaggtg agttaattat tttactatta 960
tttcagaagg tggccagacg atatcacggg ccacctgata ataagtggtc gccaaaacgc 1020
acagatatcg taaattgtgc catttgattt gtcacgcccg ggggggctac ggaataaact 1080
acatttattt atttaaaaaa tgaaccttag attatgtaac ttgtgattta tttgcgtcaa 1140
aagtaggcaa gatgaatcta tgtaaatacc tgggcagact tgcaatatcc tatttcaccg 1200
gtaaatcagc attgcaatat gcaatgcata ttcaacaata tgtaaaacaa ttcgtaaagc 1260
atcattagaa aatagacgaa agaaattgca taaaattata accgcattat taatttatta 1320
tgatatctat taacaattgc tattgccttt ttttcgcaaa ttataatcat tttcataacc 1380
tcgaggtagc attctgttac attttaatac attggtatgt gattataaca cgagctgccc 1440
actgagtttc tcgccagatc ttctcagtgg gtcgcgttac cgatcacgtg atagattcta 1500
tgaagcactg ctcttgttag ggctagtgtt agcaaattct ttcaggttga gtctgagagc 1560
tcacctaccc atcggagcgt agctggaata ggctaccagc taataggtag ggaaaacaaa 1620
gctcgaaaca agctcaagta ataacaacat aatgtgacca taaaatctcg tggtgtatga 1680
gatacaatta tgtactttcc cacaaatgtt tacataatta gaatgttgtt caacttgcct 1740
aacgccccag ctagaacatt caattattac tattaccact actaaggcag tatgtcctaa 1800
ctcgttccag atcagcgcta acttcgattg aatgtgcgaa atttatagct caatatttta 1860
gcacttatcg tattgattta agaaaaaatt gttaacattt tgtttcagta tgtcgcttat 1920
acaaatgcaa acatcaatga ttttgatgag gactattttg ggagtgatgt cactgtccaa 1980
agtagtaata caacagatga aataattaga gatgcatctg gggcagttat cgaagaacaa 2040
attacaacta aaaaaatgca acggaaaaat aaaaaccatg gaatacttgg aaaaaatgaa 2100
aaaatgatca agacgttcgt tataaccacg gattccgacg gtaacgagtc cattgtagag 2160
gaagatgtgc tcatgaagac actttccgat ggtactgttg ctcaaagtta tgttgctgct 2220
gatgcgggag catattctca gagcgggcca tacgtatcaa acagtggata cagcactcat 2280
caaggatata cgagcgattt cagc 2380
<210>2
<211>159
<212>DNA
<213> silkworm (Bombyx mori Linnaeus)
<400>2
tttttaatat aaaataaccc ttgtttctta cttcgtcctg gatacatcta tgtttttttt 60
ttcgttaata aatgagagca tttaagttat tgtttttaat tacttttttt tagaaaacag 120
atttcggatt ttttgtatgc attttatttg aatgtacta 163
<210>3
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
aagcttgttg tacaaaactg cc 22
<210>4
<211>34
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gctatctaga gctgaaatcg ctcgtatatc cttg 34
<210>5
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
gtacggatcc atttttaata taaaataacc c 31
<210>6
<211>35
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gcgcgtcgac tagtacattc aaataaaatg catac 35
<210>7
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ctagtctaga atggtgagca agggcgagg 29
<210>8
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
cagtggatcc ttgtacagct cgtccatgcc g 31
Claims (10)
1. The expression target protein is distributed in the fibroin and sericin fibroin heavy chain expression system, which is characterized in that: the domestic fibroin heavy chain expression system comprises a target gene expression frame, and the 5' end of the expression frame is a fibroin heavy chain promoter 3Fib-H P3; the 3' end is a heavy chain gene poly (A) sequence; the nucleotide of the fibroin heavy chain promoter 3Fib-H P3 is shown in SEQ ID NO. 1; the nucleotide sequence of the chain gene poly (A) sequence is shown as SEQ ID NO. 2.
2. A recombinant vector comprising the bombyx mori silkworm fibroin heavy chain expression system of claim 1.
3. The recombinant vector according to claim 2, wherein: the bombyx mori fibroin heavy chain expression system is obtained by connecting a target gene expression frame into a pSLfa1180fa vector through BamHI and HindIII enzyme cutting sites.
4. The recombinant vector according to claim 2, wherein: the silkworm fibroin heavy chain expression system is obtained by connecting a target gene expression cassette into enzyme cutting sites of a pBac [3 xP 3DsRedaf ] vector AscI and FseI.
5. A method for producing the recombinant vector according to claim 3, wherein: the recombinant vector is obtained by connecting a target gene expression frame into a pSLfa1180fa vector through BamHI and HindIII enzyme cutting sites.
6. The method for producing the recombinant vector according to claim 5, which comprises: firstly, a heavy chain gene poly (A) sequence is connected into a pSLfa1180fa vector through BamHI and SalI enzyme cutting sites to obtain a pSL-poly (A) plasmid, then a target gene is connected into the pSL-poly (A) plasmid through XbaI and BamHI to obtain a transition vector containing the target gene, and finally a fibroin heavy chain promoter 3Fib-H P3 is connected into the transition vector containing the target gene through BamHI and HindIII to obtain the domestic fibroin heavy chain expression system pSL-poly (A) -target gene-Fib-H P3.
7. The method for producing a recombinant vector according to claim 6, wherein: the fibroin heavy chain promoter 3 is obtained by taking SEQ ID NO.3 and SEQ ID NO.4 as primers and bacterial artificial chromosome clone containing a silk fibroin gene of a silkworm variety p50 as a template through PCR amplification.
8. The method for producing a recombinant vector according to claim 6, wherein: the heavy chain gene poly (A) sequence is obtained by taking sequences shown in SEQ ID NO.5 and SEQ ID NO.6 as primers and bacterial artificial chromosome clone containing silk fibroin gene of silkworm variety p50 as a template through PCR amplification.
9. The method for producing the recombinant vector according to claim 4, which comprises: the recombinant vector obtained in claim 3 was inserted into the piggyBac-derived vector pBac [3 XP 3DsRedaf ] vector using restriction enzymes AscI and FseI to form a final injection vector.
10. The use of the bombyx mori silkworm fibroin heavy chain expression system or the recombinant vector of claim 1 in expressing target proteins through silk fibroin and sericin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010691454.3A CN111793643A (en) | 2020-07-17 | 2020-07-17 | Silkworm fibroin heavy chain expression system for expressing target protein distributed in silk fibroin and sericin, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010691454.3A CN111793643A (en) | 2020-07-17 | 2020-07-17 | Silkworm fibroin heavy chain expression system for expressing target protein distributed in silk fibroin and sericin, preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111793643A true CN111793643A (en) | 2020-10-20 |
Family
ID=72807620
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010691454.3A Pending CN111793643A (en) | 2020-07-17 | 2020-07-17 | Silkworm fibroin heavy chain expression system for expressing target protein distributed in silk fibroin and sericin, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111793643A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111793644A (en) * | 2020-07-17 | 2020-10-20 | 西南大学 | Silkworm fibroin heavy chain expression system and preparation method and application thereof |
| CN112522266A (en) * | 2020-12-10 | 2021-03-19 | 西南大学 | Promoter of bombyx mori pebrine induced expression gene BmPGT 2 and application thereof |
| CN113005143A (en) * | 2021-02-25 | 2021-06-22 | 西南大学 | Expression system capable of degrading silk fibroin and releasing functional factors as required and application thereof |
| CN113621650A (en) * | 2021-03-24 | 2021-11-09 | 西南大学 | Establishment and application of efficient silk fibroin heavy chain promoter secretion expression system |
| CN114480500A (en) * | 2022-03-04 | 2022-05-13 | 西南大学 | Construction method of transgenic sericin cocoon bioreactor |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1912116A (en) * | 2006-07-14 | 2007-02-14 | 西南大学 | Method for mass expressing external protein using domestic silk core protein heavy chain promoter |
| CN101270367A (en) * | 2008-04-30 | 2008-09-24 | 苏州大学 | Construction method for domestic silkworm silk glandulae biological factory and pharmacy use |
| CN104450782A (en) * | 2015-01-07 | 2015-03-25 | 苏州大学 | Method of preparing silkworm model of hyperproteinemia |
-
2020
- 2020-07-17 CN CN202010691454.3A patent/CN111793643A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1912116A (en) * | 2006-07-14 | 2007-02-14 | 西南大学 | Method for mass expressing external protein using domestic silk core protein heavy chain promoter |
| CN101270367A (en) * | 2008-04-30 | 2008-09-24 | 苏州大学 | Construction method for domestic silkworm silk glandulae biological factory and pharmacy use |
| CN104450782A (en) * | 2015-01-07 | 2015-03-25 | 苏州大学 | Method of preparing silkworm model of hyperproteinemia |
Non-Patent Citations (3)
| Title |
|---|
| HAO Z等: "New insight into the mechanism of in vivo fibroin self-assembly and secretion in the silkworm, Bombyx mori" * |
| LONG D等: "New insight into the mechanism underlying fibroinsecretion in silkworm,Bombyx mori" * |
| 张袁松等: "转基因家蚕生产含蜘蛛丝蛋白的新型复合茧丝纤维" * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111793644A (en) * | 2020-07-17 | 2020-10-20 | 西南大学 | Silkworm fibroin heavy chain expression system and preparation method and application thereof |
| CN111793644B (en) * | 2020-07-17 | 2023-10-20 | 西南大学 | Home silk fibroin heavy chain expression system and preparation method and application thereof |
| CN112522266A (en) * | 2020-12-10 | 2021-03-19 | 西南大学 | Promoter of bombyx mori pebrine induced expression gene BmPGT 2 and application thereof |
| CN112522266B (en) * | 2020-12-10 | 2022-06-10 | 西南大学 | Promoter of bombyx mori pebrine induced expression gene BmPGT 2 and application thereof |
| CN113005143A (en) * | 2021-02-25 | 2021-06-22 | 西南大学 | Expression system capable of degrading silk fibroin and releasing functional factors as required and application thereof |
| CN113621650A (en) * | 2021-03-24 | 2021-11-09 | 西南大学 | Establishment and application of efficient silk fibroin heavy chain promoter secretion expression system |
| CN114480500A (en) * | 2022-03-04 | 2022-05-13 | 西南大学 | Construction method of transgenic sericin cocoon bioreactor |
| CN114480500B (en) * | 2022-03-04 | 2023-09-08 | 西南大学 | Construction method of transgenic sericin cocoon bioreactor |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111793643A (en) | Silkworm fibroin heavy chain expression system for expressing target protein distributed in silk fibroin and sericin, preparation method and application | |
| Royer et al. | Biosynthesis and cocoon-export of a recombinant globular protein in transgenic silkworms | |
| CN111850039B (en) | Silkworm fibroin heavy chain expression system with expressed proteins distributed on silkworm silk glue layer, and preparation method and application thereof | |
| CN111793644B (en) | Home silk fibroin heavy chain expression system and preparation method and application thereof | |
| US20080287651A1 (en) | Silk Thread Containing Spider Thread Protein and Silk Worm Producing the Silk Thread | |
| CN110719732B (en) | Transgenic silkworms expressing spider silk | |
| CN105400815B (en) | The method for synthesizing secretion latrodectus mactans traction silk-fibroin 1 using domestic natural silk gland bioreactor | |
| EP1811027B1 (en) | Polynucleotide for production of recombinant protein by silkworm | |
| CN100554418C (en) | Utilize the proteic method of domestic silk core albumen heavy chain promoter mass expressing external | |
| JP6253109B2 (en) | Rear silk gland gene expression unit and genetically modified silkworm having the same | |
| CN111518831B (en) | Application of spider botryoid gland silk protein gene sequence and method for improving performance of silkworm silk | |
| CN111500591B (en) | Application of spider poly-adenoid fibroin gene sequence and method for improving properties of silkworm silk | |
| CN117247971A (en) | Application of silkworm non-receptor tyrosine phosphatase 13 in breeding of high-silk-content varieties | |
| CN110551190B (en) | Method for producing spider silk by using silkworm | |
| JP4701336B2 (en) | Transformed silkworm producing human collagen | |
| CN111793645B (en) | Silkworm fibroin heavy chain expression system and preparation method and application thereof | |
| US9447167B2 (en) | Fibrinogen-producing transgenic silkworm | |
| CN105400817B (en) | Utilize the method for the silkworm simultaneously synthesizing traction of secretion latrodectus mactans silk-fibroin 1 and albumen 2 | |
| JP5997772B2 (en) | Mutated sequences of silkworm fibroin heavy chain gene, and methods and applications for inducing mutations | |
| CN105463022B (en) | The method for synthesizing secretion latrodectus mactans traction silk-fibroin 2 using domestic natural silk gland bioreactor | |
| JP2006521802A (en) | Nucleic acids that direct the expression of useful polypeptides in the posterior silk gland of Lepidoptera and their applications | |
| JP2011103816A (en) | Transgenic silkworm | |
| JP2005095063A (en) | Method for producing protein with signal region removed from protein having transfer activity from silkworm silk gland cell to silk gland inner lumina | |
| KR101634275B1 (en) | Transgenic silkworms producing blue fluorescent cocoons | |
| CN105907786B (en) | Double-promoter universal plasmid for expressing T4ligase of bombyx mori middle silk gland bioreactor and application and method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20201020 |
|
| RJ01 | Rejection of invention patent application after publication |