CN113005143A

CN113005143A - Expression system capable of degrading silk fibroin and releasing functional factors as required and application thereof

Info

Publication number: CN113005143A
Application number: CN202110212554.8A
Authority: CN
Inventors: 赵爱春; 郝占章; 龙定沛
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2021-02-25
Filing date: 2021-02-25
Publication date: 2021-06-22

Abstract

The invention discloses an expression system capable of degrading silk fibroin and releasing functional factors as required and application thereof, wherein the expression system is represented by the following general formula: linker-X-linker; wherein X represents a functional factor coding region; linker denotes the MMP linker coding sequence; the system releases functional factors by responding to MMP-2 enzyme and simultaneously degrades silk fibroin; the method is used for preparing a novel silk fibroin material, the prepared silk fibroin material can be degraded under the action of matrix metalloproteinase secreted by macrophages, functional factors can be continuously released, and a novel strategy is provided for controlling the degradation of the silk scaffold in the regeneration engineering.

Description

Expression system capable of degrading silk fibroin and releasing functional factors as required and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to an expression system capable of degrading silk fibroin and releasing functional factors as required, and also relates to application of the expression system.

Background

Silk (SF), a natural polymer material derived from Bombyx mori, is known for its excellent properties and has received attention as a biomaterial applicable to tissue engineering. However, natural silk materials have not been able to meet some specific requirements of tissue engineering biomaterials, for example, natural silk materials lack relevant growth factors, and ordinary silk scaffolds are very difficult to degrade in bioactive bodies. To date, different coupling schemes have been used to impart new functions and the ability to release growth factors to silk fibroin-creating materials such as porous 3D sponges, membranes, microparticles, and electrospun mats, but coupling of silk fibroin materials has often employed a strategy of non-covalent coupling, which is susceptible to "burst" phenomena in the first few days of biomaterial use. Therefore, how to control the release of functional proteins or factors under the condition of endowing silk biological materials with new functions becomes a hot spot and a difficult point of research on application of such silk materials.

Although it is possible to achieve the new desired functions imparted to silk materials by modification methods such as direct feeding, chemical modification, meso-scale assembly and macro-scale mixing, these strategies require complex modification experiments on the materials each time they are used and it is difficult to ensure the consistency of the modification obtained for each batch of material. Silkworm strain transformation (germline transformation) has received wide attention as a strategy for imparting a novel function to silk fibroin. The silkworm strain transformation method can obtain a transgenic silkworm individual which can spit out silk with new functions by inserting exogenous genes into a silkworm genome, and the characteristics obtained by inserting the exogenous genes can be stably maintained in the transgenic silkworm individual and are inherited to offspring. Therefore, the functional protein can be endowed with new functions by the specific expression of the transgenic silkworms in the silk glands and can be stably inherited to offspring, and the method is expected to effectively overcome the defects of other modification methods.

Recently, particular attention has been given to intelligent drug delivery systems which respond to tissue environmental signals and release growth factors on demand, so-called "release on demand". On-demand release can be designed by incorporating a stimulus-responsive component into the delivery system. The most commonly used trigger mechanism involves the use of enzymes to cleave the linker (linker) which immobilizes the growth factor, resulting in the release of the encapsulated growth factor. Matrix metalloproteinases 2 (MMP-2) is an important enzyme widely present in the regeneration process. If the MMP-2 enzymatic linkers are added at the two ends of the growth factor, under the action of MMP-2 enzyme widely existing in a regeneration microenvironment, the cytokine is expected to be controlled to release or released as required.

Disclosure of Invention

In view of the above, an object of the present invention is to provide an expression system capable of degrading silk fibroin and releasing functional factors as needed; the invention also aims to provide a preparation method of the silk material for regulating and releasing the bone growth factor by MMP-2 enzyme; the third purpose of the invention is to provide the silk material for regulating and releasing bone growth factor by MMP-2 enzyme prepared by the method; the fourth purpose of the invention is to provide the application of the transgenic silk in the preparation of the silk scaffold for MMP-2 enzyme induced release of functional factors.

In order to achieve the purpose, the invention provides the following technical scheme:

1. an expression system capable of degrading silk fibroin and releasing functional factors on demand, said expression system being represented by the general formula: linker-X-linker;

wherein X represents a functional factor coding region; linker represents the coding sequence of MMP-2 enzymatically-cleavable polypeptide.

Preferably, the coding sequence of the MMP linker enzymolytic polypeptide is any one of VLGL, PLNL, PANL, PLGL, VANL and PAGL.

Preferably, two ends of the expression system are respectively connected with the bombyx mori fibroin heavy chain promoter Fib-H P3 and the light chain binding site LBS to form an expression frame. The Fib-H P3 consists of the 5 'upstream sequence of the heavy chain, exon 1, intron and 5' end sequence of exon 2; the light chain binding site LBS consists of the 3 'end of the fibroin heavy chain gene containing Cys-C20 (the last 20 amino acids of the C-terminus) and the 3' end downstream sequence containing the polyadenylation signal sequence.

Preferably, the expression system is obtained by replacing an EGFP fragment in pBac [3xP3-DsRed ] -R3 by linker-X-linker.

Preferably, X is a human bone morphogenetic protein BMP-2 gene sequence or a codon-optimized human bone morphogenetic protein BMP-2 gene sequence.

2. Transgenic silk prepared by the expression system.

3. The preparation method of the transgenic silk comprises the following steps: and (3) introducing the transgenic vector containing the expression system into silkworm eggs by using an embryo microinjection mode, screening transgenic silkworms, and obtaining transgenic silkworms through cocooning the transgenic silkworms.

4. The transgenic silk is applied to the preparation of the silk scaffold for MMP-2 enzyme induced release of functional factors.

5. The transgenic silk is applied to the preparation of the silk scaffold degraded by silk fibroin induced by MMP-2 enzyme.

6. The preparation method of the silk material for regulating and releasing the bone growth factor by MMP-2 enzyme comprises the steps of connecting two ends of a codon optimized human bone morphogenetic protein BMP-2 gene sequence with a coding sequence for coding MMP-2 enzymolysis polypeptide, regulating and controlling the expression in a silkworm by a silkworm fibroin heavy chain promoter Fib-H P3, and secreting the exogenous components serving as silk fibers to the silkworm cocoon along with silk protein to obtain the silk material; the codon-optimized human bone morphogenetic protein BMP-2 gene sequence is shown in SEQ ID NO. 1; the coding sequence of the MMP linker enzymolysis polypeptide is any one of VLGL, PLGL and PAGL.

The invention has the beneficial effects that: the invention discloses an expression system capable of degrading silk fibroin and releasing functional factors as required, which can simultaneously degrade the silk fibroin by responding to MMP-2 enzyme to release the functional factors. The system is used for preparing a novel silk fibroin material, the prepared silk fibroin material can be degraded under the action of matrix metalloproteinase secreted by macrophages, and functional factors can be continuously released, such as: BMP-2 growth factor, and provides a new strategy for controlling the degradation of the silk scaffold in the regeneration engineering.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:

FIG. 1 is a schematic structural diagram of B1, B2 and B3.

FIG. 2 is a structural diagram of 3 fusion genes (A: structural diagram of silk fibroin heavy chain expression system R3; B: structural diagram of transgene vector).

FIG. 3 is a diagram of the structure of the transgene vector.

FIG. 4 is a diagram showing the preparation process of transgenic silkworms (A: embryo microinjection; B: screening of transgenic offspring individuals by fluorescence microscopy; C: analysis of transgenic silkworm genome integration by PCR).

FIG. 5 shows the analysis of total protein of wild-type and G1 transgenic silkworm cocoons (A: SDS-PAGE detection; B: hBMP-2 antibody immunoblotting detection).

FIG. 6 shows the influence of the processing of silk fibroin material on the content of exogenous BMP-2 protein (A: silk fibroin material; B: silk fibroin processing material; C: Western blot detection of exogenous BMP-2 protein; D: statistical result of exogenous BMP-2 protein).

FIG. 7 shows the results of implanting the silk fibroin slice into rabbit subcutaneously (A: silk fibroin slice; B: H & E staining results; C: presence of MMP-2 enzyme in inflammatory cells by gelatinase chromatography; D: MMP-2 enzyme content and activity results)

FIG. 8 shows the results of culturing sterilized silk fibroin slices in a culture medium without or with inflammatory macrophage M1 for 4 weeks to monitor the degradation of silk fibroin in the culture medium (A: the degradation rate of silk fibroin in the medium with inflammatory macrophage M1; B: the degradation rate of silk fibroin in the medium without inflammatory macrophage M1; C: the results of silk fibroin slices).

FIG. 9 is a schematic diagram of the cleavage of MMP-2 linker.

FIG. 10 shows that MMP-2 enzyme secreted from macrophages can recognize and cleave the linkers (A: silk fibroin solution preparation process; B: BMP-2 release result by MMP-2 cleavage).

FIG. 11 shows the BMP-2 release rate and catalytic activity of the inserted MMP-2linker peptide (A: BMP-2 release rate; B: Western blot assay).

FIG. 12 shows the result of DNA content in cocoon sheet co-cultured MSC (mesenchymal stem cell).

Detailed Description

The present invention is further described with reference to the following drawings and specific examples so that those skilled in the art can better understand the present invention and can practice the present invention, but the examples are not intended to limit the present invention.

Example 1 optimization of human bone morphogenetic protein BMP-2 Gene

The hBMP-2 is obtained by optimizing a human bone morphogenetic protein BMP-2 gene sequence according to the codon preference of a silkworm genome expression gene, XbaI enzyme cutting sites are related to the upstream, BamHI enzyme cutting sites are designed to the downstream, the total is 1132bp, and the designed specific sequence is shown as SEQ ID NO. 1:

ctctagactggtgccagaactgggtagaagaaagttcgctgctgcttcatcaggtagaccttcatcacaaccttcagacgaagtgctgagcgaattcgaactgagactgttgagcatgttcggactgaaacagagaccgacaccttcaagagacgctgttgttcctccttacatgctggacctgtacagaagacactcaggtcaaccaggttcaccagctccagatcatagactggaaagagcagctagcagagctaacacagtgagaagcttccaccacgaagagtcactggaagaactgccagaaaccagcggtaaaaccacaagacgcttcttcttcaacctgagcagcatccctaccgaagaattcatcacctcagccgaactgcaagtgttcagagaacagatgcaggacgctttgggtaacaacagctcattccaccaccgcatcaacatctacgagatcatcaagccggctacagctaactcaaagttcccagtgacaagactgctggacacaagactggtgaaccaaaacgctagccgttgggaatcattcgacgtgacaccagcagttatgcgttggacagctcaaggtcacgctaatcacggtttcgttgtggaagtggctcacttagaagaaaagcagggagtgagcaagagacacgtgagaatcagcagaagcttgcaccaagacgaacactcttggagccaaatcagacctctgctggttacattcggtcacgacggtaaaggtcaccctctgcacaaaagagaaaagcgccaagctaagcacaagcagagaaaacgcctgaagagctcttgcaaaagacaccctctgtacgtggatttctcagacgtgggttggaacgattggattgttgctcctccaggttaccacgctttctattgtcacggcgagtgtcctttcccattggctgatcacttgaacagcacaaaccacgctatcgtgcaaacactggtgaacagcgtgaacagcaagatccctaaagcttgttgcgtgcctaccgaactgtcagctatcagcatgctgtacctggacgaaaacgaaaaggtggtgctgaagaactaccaggacatggtcgttgaaggttgcggttgtagaggatcc

synthesizing hBMP-2 sequence for use.

Example 2 selection of matrix Metalloproteinase-2 digestion of linkers and vector construction

Three different binders with high MMP-2 enzymolysis activity (-PAGL-, 100%), medium (-PLGL-, 54.9%) and low (-VLGL-, 13%) are successfully connected with nucleotide sequences for coding MMP-2 binders at two ends of an hBMP-2 gene to obtain target gene sequences for generating 3 different binders-hBMP-2-binders, which are respectively named as B1, B2 and B3 (the nucleotide sequences are respectively shown as 10 th to 1176 th sites of SEQ ID No.2, 10 th to 1176 th sites of SEQ ID No.3 and 10 th to 1176 th sites of SEQ ID No. 4), and the structure is shown as figure 1. In the embodiment of the invention, other linkers can be selected according to the required release amount of the target protein, such as-PLNL-, 15.7%; -PANL-, 43.1% and-VANL-, 64.6%.

In order to ensure high expression of the fusion protein, the complete N end and C end of Fib-H are selected as two ends of 3 different linker-hBMP-2-linker structures. Specifically, 3 fusion genes, heavy-chain B1, heavy-chain B2 and heavy-chain B3 (FIG. 2), were successfully constructed by using the fibroin heavy chain expression system R3(ZHao A, ZHao T, ZHang Y, Xia Q, Lu C, ZHou Z, Xian Z, Nakagaki M.New and highlylly effective expression systems for expressing selective expression in the bone protein in the bone peptides of genetic skeletal. genetic Research,2010,19(1): 29-44), respectively replacing the EGFP fragment in the R3 system with the genes B1, B2 and B3, these 3 fusion genes contained 2304-bp of Fib-H P3 sequence (containing the heavy chain 5 ' upstream sequence, exon 1, intron and 5 ' end sequence of exon 2), 1206-bp of B1, B2 or B3 sequence and 333-bp of LBS sequence (containing the heavy chain exon 23 ' end sequence and poly-A sequence). The fusion genes were then cloned into piggyBac transposable vectors to obtain pBac [3xP3-DsRed ] -B1, pBac [3xP3-DsRed ] -B2 and pBac [3xP3-DsRed ] -B3 transgenic vectors (FIG. 3). The DNA sequencing result shows that 3 transgenic vectors are constructed correctly.

Example 3 preparation of transgenic silkworms

By using a silkworm strain transformation technology platform of embryo microinjection, 3 recombinant piggyBac transgenic vectors are introduced into silkworm eggs (figure 4, A), and transgenic offspring individuals expressing DsRed fluorescence in eyes are screened by using a fluorescence stereomicroscope with a DsRed filter (Table 1). Screening results show that the positive rates of moth regions containing DsRed fluorescence expression in G1 generation moth regions injected with pBac [3xP3-DsRed ] -B1, pBac [3xP3-DsRed ] -B2 and pBac [3xP3-DsRed ] -B3 are 13.4%, 19% and 6.3%, respectively (FIG. 4, B). Genomic DNA of DsRed positive silkworm moths was extracted, and integration of the transgene in the silkworm genome was confirmed by PCR analysis (FIG. 4, C). And then extracting total proteins of wild-type and G1 transgenic silkworm cocoons respectively, and detecting the total proteins by SDS-PAGE and hBMP-2 antibody immunoblotting, wherein single hybridization signals are detected in the total proteins of 3 different transgenic silkworm cocoons respectively, and any hybridization signal band is detected in the total proteins of the wild-type silkworm cocoons, so that the BMP-2 is proved to be expressed in the 3 transgenic silkworm cocoons.

TABLE 1 screening results for transgenic injection

Carrier	Number of embryos injected	Number of hatchings	Hatching rate (%)	Number of moth	G1 generation individual	G1 passage positive individuals
							pBac[3xP3-DsRed]-B1	320	28	8.75	17	17	14.3
pBac[3xP3-DsRed]-B2	57	57	35.32	45	45	19
							pBac[3xP3-DsRed]-B3	50	50	31.25	32	32	6.3

Total proteins of wild-type and G1 transgenic silkworm cocoons were extracted, and detected by SDS-PAGE and hBMP-2 antibody immunoblotting, and the results are shown in FIG. 5. The results showed that a single hybridization signal was detected in each of the 3 different transgenic silkworm cocoons total protein, whereas no hybridization signal band was detected in the wild-type silkworm cocoon total protein, thereby confirming that BMP-2 was expressed in all 3 transgenic silkworm cocoons.

The BMP-2 content of different transgenic silks was analyzed and the results are shown in Table 2. The results showed that the contents of 3 different types of BMP-2 proteins B1, B2, and B3 expressed in the transgenic silkworm cocoons were 7.2%, 10.05%, and 5.87%, respectively. The above research results indicate that the heavy-chain-B1, heavy-chain-B2 and heavy-chain-B3 fusion proteins are successfully secreted to the posterior silk gland lumen together with silk fibroin and secreted to silkworm cocoons together with silk protein as an exogenous component of silk fiber.

TABLE 2 BMP-2 content of different transgenic lines of silk

Sample (I)	Total protein (ng/. mu.l)	Protein load (ng)	hBMP-2(ng)	Content (%)
					SF-B1	1357.7	678.85	48.87	7.2
SF-B2	1901.4	950.7	95.47	10.05
					SF-B3	1330.6	665.3	39.05	5.87

Example 4 preparation and degradation of fibroin Material

Silk fibroin slices prepared by degumming silkworm cocoons and hydrogel, membrane and freeze-dried powder prepared by regenerating silk fibroin solution are redissolved by LISCN solution and analyzed by Western blotting, and the results are shown in FIG. 6. The result shows that in the regeneration process of preparing hydrogel, membrane and freeze-dried powder by using the fibroin solution, the content of hBMP-2 in the material is respectively reduced by 40%, 52% and 60% compared with the initial content; while the remaining content of BMP-2 in the silk fibroin sections (80%) was still sufficient for the subsequent experiments. Therefore, subsequent experiments were performed subsequently using silk sections.

The fibroin section is implanted into the subcutaneous part of a rabbit, H & E staining results show that the cell infiltration phenomenon appears within 4 weeks after the implantation, and the observed cells are judged to be possibly inflammatory cells. Thus, the presence and activity of MMP-2 enzyme in inflammatory cells (including monocytes, unpolarized and polarized macrophage M1) was examined using gelatinase spectroscopy, and the results are shown in FIG. 7. The results show that MMP-2 enzyme secreted by monocytes and macrophages is time-dependent. The determination yielded 2 bands with apparent molecular weights of 62-kDa and 72-kDa, respectively, with the 72-kDa band being the precursor form of the MMP-2 enzyme and the 62-kDa band being the active form of the MMP-2 enzyme. Monocyte THP1 and unpolarized macrophages secrete only the precursor MMP-2 enzyme. A small amount of active MMP-2 enzyme was detected on day 5 after macrophage polarization, while a large amount of active MMP-2 enzyme was detected in conditioned medium of macrophage M1 on day 7. Different types of cells that regulate different stages of bone healing include mainly macrophages, osteoblasts and osteoclasts. The results of the study indicate that macrophage M1 is the first responder after silk material implantation, and can be used as an inexpensive source of MMP-2 enzyme and an in vitro model for MMP-mediated degradation studies.

Sterile silk fibroin slices were co-cultured in medium without or with inflammatory macrophage M1 for 4 weeks, respectively. The degradation condition of the silk fibroin in the culture medium is monitored by measuring the quality change of the silk fibroin slice, and the form change of the silk fibroin slice is observed by using a scanning electron microscope, and the result is shown in figure 8. The results showed that there was no significant difference in the degradation rate of each group of silk fibroin sections when the silk fibroin sections were co-cultured with macrophage M1 until the first 3 days after M1 began to secrete MMP-2, presumably because the MMP-2 enzyme was still in the precursor state. Whereas after co-culturing the silk sections with M1 for 7 days, the amount and activity of MMP-2 enzyme in the medium has been able to lead to differences in the degradation rates of the different treatment groups of silk sections. After 28 days of co-culture, the silk fibroin slices with high catalytic activity had a greater mass loss (B1, 38.07%) compared to silk fibroin slices with medium catalytic activity (B2, 23.40%) and low catalytic activity (B3, 11.93%). In cell-free medium, the dry weight of silk fibroin slices decreased by a very small amount, even 0, confirming that the degradation of silk fibroin slices could be mediated by MMP-2 enzyme secreted from macrophages. The morphological analysis of a scanning electron microscope shows that the addition of the MMP-2linker promotes the degradation of the fibroin heavy chain to a certain extent. The wild-type silk fibroin slice still keeps the original structure, and particle fragments appear on the surfaces of the transgenic TSL-B1, TSL-B2 and TSL-B3 slices.

Example 5 BMP-2 release rate with a similar trend to the catalytic activity of the inserted MMP-2linker peptide

The design of the target proteins B1, B2 and B3 revealed that the embedded BMP-2 growth factor requires cleavage of MMP-2linker to be released (FIG. 9). An in vitro release system triggered by the MMP-2 enzyme from which macrophages are derived MMP-2 enzyme is established. This example preferably uses a soluble aqueous solution to verify the release of BMP-2 protein from linker containing PAGL, PLGL and VLGL, respectively, after MMP-2 enzyme cleavage. Macrophage conditioned medium MMP-2 enzyme source was mixed with silk fibroin solution to react. After the reaction, the components after the reaction were separated by 12% polyacrylamide gel and recovered. The molecular weight change of each component protein is verified by Western blotting with a BMP-2 antibody, and the result shows that after the enzyme reaction, the molecular weight of a corresponding band of the foreign protein is reduced compared with that before the reaction. The results of this experiment demonstrate that active MMP-2 enzyme is able to recognize and cleave the linker, and that BMP-2 protein is also separated from the remaining fibroin sequence after linker cleavage. While in cell-free medium, the molecular weight of the BMP-2 fusion protein did not decrease, indicating that the presence of an active MMP-2 enzyme is a prerequisite for triggering BMP-2 growth factor release (FIG. 10).

Macrophage mediated release was used to verify whether changes in catalytic activity of MMP sensitive sites would affect the kinetics of hBMP-2 release. SF-B1, SF-B2, and SF-B3 silk fibroin sections with the same BMP-2 content were subjected to release analysis in the presence of M1 macrophages. The content of BMP-2 in the release medium collected at each time point was measured by ELISA kit, and the content of BMP-2 in the remaining insoluble fiber was measured by Western blotting, the results are shown in FIG. 11. The results show that the kinetics of BMP-2 protein release were significantly different in 3 different treatment groups after co-culture in macrophage-containing medium for 4 weeks, with the fastest BMP-2 release rate in SF-B1 group (52.92%), followed by SF-B2 group (32.24%) and SF-B3 group (11.74%), indicating that the kinetics of drug (BMP-2 protein) release has a similar trend to that of catalytic activity (MMP enzyme). The decrease in catalytic activity is associated with a decrease in the amount of BMP-2 released, and with an increase in kinetic activity, the rate of BMP-2 release increases. In contrast, the samples in the medium without the addition of cells did not detect the release of BMP-2 protein even after the co-culture for a long period of time. The invention shows that the invention successfully obtains the novel silk material which can release bone growth factors at different speeds in the presence of MMP-2 enzyme.

The effect of released BMP-2 on Mesenchymal Stem Cell (MSC) proliferation was evaluated by DNA quantitative analysis. After 1 week, in vitro experiment results show that the DNA content of the MSC co-cultured with WT cocoon sheets is increased and is obviously lower than that of the MSC co-cultured with TSL-B1, TSL-B2 or TSL-B3, suggesting that BMP-2 protein released from the transgenic cocoon sheets shows the activity of promoting the proliferation of osteoprogenitor cells in the first step of the bone regeneration process (figure 12).

In conclusion, the invention creates the function of responding to MMP-2 enzyme cutting MMP linker to regulate silk fibroin degradation, and simultaneously releases functional factors, such as bone growth factor BMP-2, wherein the released BMP-2 protein has the activity of promoting osteoprogenitor cell proliferation in the first step of the bone regeneration process.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Sequence listing

<110> university of southwest

<120> expression system capable of degrading silk fibroin and releasing functional factors as required and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1132

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctctagactg gtgccagaac tgggtagaag aaagttcgct gctgcttcat caggtagacc 60

ttcatcacaa ccttcagacg aagtgctgag cgaattcgaa ctgagactgt tgagcatgtt 120

cggactgaaa cagagaccga caccttcaag agacgctgtt gttcctcctt acatgctgga 180

cctgtacaga agacactcag gtcaaccagg ttcaccagct ccagatcata gactggaaag 240

agcagctagc agagctaaca cagtgagaag cttccaccac gaagagtcac tggaagaact 300

gccagaaacc agcggtaaaa ccacaagacg cttcttcttc aacctgagca gcatccctac 360

cgaagaattc atcacctcag ccgaactgca agtgttcaga gaacagatgc aggacgcttt 420

gggtaacaac agctcattcc accaccgcat caacatctac gagatcatca agccggctac 480

agctaactca aagttcccag tgacaagact gctggacaca agactggtga accaaaacgc 540

tagccgttgg gaatcattcg acgtgacacc agcagttatg cgttggacag ctcaaggtca 600

cgctaatcac ggtttcgttg tggaagtggc tcacttagaa gaaaagcagg gagtgagcaa 660

gagacacgtg agaatcagca gaagcttgca ccaagacgaa cactcttgga gccaaatcag 720

acctctgctg gttacattcg gtcacgacgg taaaggtcac cctctgcaca aaagagaaaa 780

gcgccaagct aagcacaagc agagaaaacg cctgaagagc tcttgcaaaa gacaccctct 840

gtacgtggat ttctcagacg tgggttggaa cgattggatt gttgctcctc caggttacca 900

cgctttctat tgtcacggcg agtgtccttt cccattggct gatcacttga acagcacaaa 960

ccacgctatc gtgcaaacac tggtgaacag cgtgaacagc aagatcccta aagcttgttg 1020

cgtgcctacc gaactgtcag ctatcagcat gctgtacctg gacgaaaacg aaaaggtggt 1080

gctgaagaac taccaggaca tggtcgttga aggttgcggt tgtagaggat cc 1132

<210> 2

<211> 1233

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgctctagag gtggtggtgg ttcccctgct ggtctgtggg ctggtggtgg tggttccctg 60

gtgccagaac tgggtagaag aaagttcgct gctgcttcat caggtagacc ttcatcacaa 120

ccttcagacg aagtgctgag cgaattcgaa ctgagactgt tgagcatgtt cggactgaaa 180

cagagaccga caccttcaag agacgctgtt gttcctcctt acatgctgga cctgtacaga 240

agacactcag gtcaaccagg ttcaccagct ccagatcata gactggaaag agcagctagc 300

agagctaaca cagtgagaag cttccaccac gaagagtcac tggaagaact gccagaaacc 360

agcggtaaaa ccacaagacg cttcttcttc aacctgagca gcatccctac cgaagaattc 420

atcacctcag ccgaactgca agtgttcaga gaacagatgc aggacgcttt gggtaacaac 480

agctcattcc accaccgcat caacatctac gagatcatca agccggctac agctaactca 540

aagttcccag tgacaagact gctggacaca agactggtga accaaaacgc tagccgttgg 600

gaatcattcg acgtgacacc agcagttatg cgttggacag ctcaaggtca cgctaatcac 660

ggtttcgttg tggaagtggc tcacttagaa gaaaagcagg gagtgagcaa gagacacgtg 720

agaatcagca gaagcttgca ccaagacgaa cactcttgga gccaaatcag acctctgctg 780

gttacattcg gtcacgacgg taaaggtcac cctctgcaca aaagagaaaa gcgccaagct 840

aagcacaagc agagaaaacg cctgaagagc tcttgcaaaa gacaccctct gtacgtggat 900

ttctcagacg tgggttggaa cgattggatt gttgctcctc caggttacca cgctttctat 960

tgtcacggcg agtgtccttt cccattggct gatcacttga acagcacaaa ccacgctatc 1020

gtgcaaacac tggtgaacag cgtgaacagc aagatcccta aagcttgttg cgtgcctacc 1080

gaactgtcag ctatcagcat gctgtacctg gacgaaaacg aaaaggtggt gctgaagaac 1140

taccaggaca tggtcgttga aggttgcggt tgtagaggtg gtggtggttc ccctgctggt 1200

ctgtgggctg gtggtggtgg ttccggatcc gcg 1233

<210> 3

<211> 1233

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgctctagag gtggtggtgg ttcccctctg ggtctgtggg ctggtggtgg tggttccctg 60

gtgccagaac tgggtagaag aaagttcgct gctgcttcat caggtagacc ttcatcacaa 120

ccttcagacg aagtgctgag cgaattcgaa ctgagactgt tgagcatgtt cggactgaaa 180

cagagaccga caccttcaag agacgctgtt gttcctcctt acatgctgga cctgtacaga 240

agacactcag gtcaaccagg ttcaccagct ccagatcata gactggaaag agcagctagc 300

agagctaaca cagtgagaag cttccaccac gaagagtcac tggaagaact gccagaaacc 360

agcggtaaaa ccacaagacg cttcttcttc aacctgagca gcatccctac cgaagaattc 420

atcacctcag ccgaactgca agtgttcaga gaacagatgc aggacgcttt gggtaacaac 480

agctcattcc accaccgcat caacatctac gagatcatca agccggctac agctaactca 540

aagttcccag tgacaagact gctggacaca agactggtga accaaaacgc tagccgttgg 600

gaatcattcg acgtgacacc agcagttatg cgttggacag ctcaaggtca cgctaatcac 660

ggtttcgttg tggaagtggc tcacttagaa gaaaagcagg gagtgagcaa gagacacgtg 720

agaatcagca gaagcttgca ccaagacgaa cactcttgga gccaaatcag acctctgctg 780

gttacattcg gtcacgacgg taaaggtcac cctctgcaca aaagagaaaa gcgccaagct 840

aagcacaagc agagaaaacg cctgaagagc tcttgcaaaa gacaccctct gtacgtggat 900

ttctcagacg tgggttggaa cgattggatt gttgctcctc caggttacca cgctttctat 960

tgtcacggcg agtgtccttt cccattggct gatcacttga acagcacaaa ccacgctatc 1020

gtgcaaacac tggtgaacag cgtgaacagc aagatcccta aagcttgttg cgtgcctacc 1080

gaactgtcag ctatcagcat gctgtacctg gacgaaaacg aaaaggtggt gctgaagaac 1140

taccaggaca tggtcgttga aggttgcggt tgtagaggtg gtggtggttc ccctctgggt 1200

ctgtgggctg gtggtggtgg ttccggatcc gcg 1233

<210> 4

<211> 1233

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgctctagag gtggtggtgg ttccgttctg ggtctgtggg ctggtggtgg tggttccctg 60

gtgccagaac tgggtagaag aaagttcgct gctgcttcat caggtagacc ttcatcacaa 120

ccttcagacg aagtgctgag cgaattcgaa ctgagactgt tgagcatgtt cggactgaaa 180

cagagaccga caccttcaag agacgctgtt gttcctcctt acatgctgga cctgtacaga 240

agacactcag gtcaaccagg ttcaccagct ccagatcata gactggaaag agcagctagc 300

agagctaaca cagtgagaag cttccaccac gaagagtcac tggaagaact gccagaaacc 360

agcggtaaaa ccacaagacg cttcttcttc aacctgagca gcatccctac cgaagaattc 420

atcacctcag ccgaactgca agtgttcaga gaacagatgc aggacgcttt gggtaacaac 480

agctcattcc accaccgcat caacatctac gagatcatca agccggctac agctaactca 540

aagttcccag tgacaagact gctggacaca agactggtga accaaaacgc tagccgttgg 600

gaatcattcg acgtgacacc agcagttatg cgttggacag ctcaaggtca cgctaatcac 660

ggtttcgttg tggaagtggc tcacttagaa gaaaagcagg gagtgagcaa gagacacgtg 720

agaatcagca gaagcttgca ccaagacgaa cactcttgga gccaaatcag acctctgctg 780

gttacattcg gtcacgacgg taaaggtcac cctctgcaca aaagagaaaa gcgccaagct 840

aagcacaagc agagaaaacg cctgaagagc tcttgcaaaa gacaccctct gtacgtggat 900

ttctcagacg tgggttggaa cgattggatt gttgctcctc caggttacca cgctttctat 960

tgtcacggcg agtgtccttt cccattggct gatcacttga acagcacaaa ccacgctatc 1020

gtgcaaacac tggtgaacag cgtgaacagc aagatcccta aagcttgttg cgtgcctacc 1080

gaactgtcag ctatcagcat gctgtacctg gacgaaaacg aaaaggtggt gctgaagaac 1140

taccaggaca tggtcgttga aggttgcggt tgtagaggtg gtggtggttc cgttctgggt 1200

ctgtgggctg gtggtggtgg ttccggatcc gcg 1233

Claims

1. An expression system capable of degrading silk fibroin and releasing functional factors as required, which is characterized in that: the expression system is represented by the general formula: linker-X-linker;

2. The expression system of degradable silk fibroin and release-on-demand functional factors according to claim 1, characterized in that: the coding sequence of the MMP linker enzymolysis polypeptide is any one of VLGL, PLNL, PANL, PLGL, VANL and PAGL.

3. The expression system of degradable silk fibroin and release-on-demand functional factors according to claim 1, characterized in that: two ends of the expression system are respectively connected with a silkworm fibroin heavy chain promoter Fib-H P3 and a light chain binding site LBS to form an expression frame.

4. The expression system of degradable silk fibroin and release-on-demand functional factors according to claim 1, characterized in that: the expression system is obtained by replacing an EGFP fragment in pBac [3xP3-DsRed ] -R3 by linker-X-linker.

5. The expression system of degradable silk fibroin and release-on-demand functional factors according to claim 1, characterized in that: and the X is a human bone morphogenetic protein BMP-2 gene sequence or a codon-optimized human bone morphogenetic protein BMP-2 gene sequence.

6. Transgenic silk produced using the expression system of any one of claims 1 to 5.

7. A method for preparing transgenic silk according to claim 6, comprising the steps of: introducing a transgenic vector containing the expression system of any one of claims 1-5 into a silkworm egg by using an embryo microinjection method, screening transgenic silkworms, and obtaining transgenic silkworms through cocooning the transgenic silkworms.

8. Use of transgenic silk according to claim 6 for the preparation of silk scaffolds for MMP-2 enzyme-induced release of functional factors.

9. Use of transgenic silk according to claim 6 for the preparation of silk scaffolds with MMP-2 enzyme induced silk fibroin degradation.

A preparation method of silk material for regulating and releasing bone growth factor by MMP-2 enzyme is characterized in that: connecting two ends of a codon-optimized human bone morphogenetic protein BMP-2 gene sequence with a coding sequence for coding MMP-2 enzymolysis polypeptide, regulating and controlling the expression in a silkworm by a silkworm fibroin heavy chain promoter Fib-H P3, and secreting an exogenous component serving as silk fiber to a silkworm cocoon along with silk protein to obtain a silk material; the codon-optimized human bone morphogenetic protein BMP-2 gene sequence is shown in SEQ ID NO. 1; the coding sequence of the MMP linker enzymolysis polypeptide is any one of VLGL, PLGL and PAGL.