CN111778324A

CN111778324A - Construction method and kit of universal gene detection library of Alport syndrome

Info

Publication number: CN111778324A
Application number: CN202010657187.8A
Authority: CN
Inventors: 李亚峰; 李荣山; 辛晓红; 杨颖�; 曹彦东; 扶媛媛
Original assignee: Beijing Anzhiyin Biotechnology Co ltd
Current assignee: Beijing Anzhiyin Biotechnology Co ltd
Priority date: 2020-07-09
Filing date: 2020-07-09
Publication date: 2020-10-16
Anticipated expiration: 2040-07-09
Also published as: CN111778324B

Abstract

The invention relates to a construction method and a kit of a universal gene detection library aiming at Alport syndrome. The construction method and the kit relate to gene mutation of COL4A3, COL4A4, COL4A5, COL4A6 and MYH9, can be compatible with various sequencing platforms including Ion Torrent and Illumina platforms and the like, and have the advantages of simple and rapid library construction steps, cost saving, wide application range and the like.

Description

Construction method and kit of universal gene detection library of Alport syndrome

Technical Field

The invention relates to the field of gene detection, in particular to a construction method and a kit of a universal gene detection library of Alport syndrome.

Background

Alport syndrome (Alport syndrome), also known as hereditary progressive nephritis, is one of the most common hereditary kidney diseases, and has an incidence rate of about 1/5000. The main clinical manifestations of Alport syndrome are hematuria, proteinuria and progressive renal hypofunction, the hematuria is the most common clinical manifestation of Alport syndrome patients, the hematuria is glomerular source hematuria, and almost 100% of patients with X-linked inheritance and autosomal recessive inheritance have microscopic hematuria. Proteinuria does not appear or is minimal in infants or early stages of disease, but appears with age, even progressing to profuse proteinuria. The prognosis of kidney in male patients with X-linked hereditary Alport syndrome is very poor, almost all patients develop end-stage renal disease (ESRD), usually 5-10 years from the onset of renal dysfunction to renal failure, and the clinical phenotype of female patients with X-linked hereditary Alport syndrome is lighter and more different than that of male patients. Other clinical symptoms also include the appearance of the kidney, such as sensorineural deafness (requiring pure-tone audiometry), anterior conical lens (requiring ophthalmic slit-lamp examination), macular and macular retinopathy around the macula (requiring retinal photography). Pathological changes of Alport syndrome can be seen only under an electron microscope, typical diseases are that glomerular basement membrane is widely thickened and thinned, and dense layer division occurs, but pathological changes of the kidney of a patient can not be observed in early stage of diseases, and certain difficulty is brought to diagnosis.

Alport syndrome is a monogenic hereditary disease, and due to the mutation of genes encoding different alpha chains of type iv collagen, the main component of type iv collagen alpha chain constituting the tissue basement membrane is abnormal or defective, so that the structure and function of the tissue basement membrane are abnormal, and various clinical symptoms and signs are generated. The Alport syndrome virulence genes include COL4A3, COL4a4, COL4a5, COL4a6 and MYH 9. About 85% of Alport syndrome patients are X-linked dominant genotypes caused by mutations in COL4A5 or COL4A5 and COL4A6 genes, with a more severe disease in male patients, 90% of renal failure before the age of 40, and a relatively less severe disease in female patients. About 15% of Alport syndrome patients are autosomal genotypes caused by mutations in COL4A3 and COL4A4 genes, wherein the autosomal recessive genotype is the predominant genotype, and renal failure occurs almost in all patients before the age of 30 years.

The Alport syndrome pathogenic genes are COL4A3, COL4A4, COL4A5, COL4A6 and MYH9, and are definite, but pathogenic sites are distributed in all exon regions of the genes and have no hot point mutation, so that a relatively high-throughput inspection method is required for detection. Currently, NGS sequencing methods are widely used for genetic disease detection with clear pathogenic genes but without hotspot mutations. The NGS sequencing usually adopts Massively Parallel Sequencing (MPS), can realize simultaneous sequencing of multiple samples and multiple sites, and greatly improves sequencing flux. High throughput sequencing technology has been demonstrated to have high accuracy and sensitivity in clinical gene testing. Currently, the NGS sequencing platforms widely applied in clinic are mainly IonTorrent and Illumina, but due to different sequencing technical principles, different platforms adopt different technical processes during library construction, so that the libraries are not universal, namely, the libraries suitable for the Ion Torrent platform can not generate sequencing data on the Illumina platform, and vice versa. This has generated a great limitation to clinical application, so it is necessary to find a universal gene testing library for Alport syndrome, which is suitable for different sequencing platforms and meets different clinical requirements.

The invention is provided in view of the above.

Disclosure of Invention

In order to solve the technical problems, the invention mainly aims to provide a universal gene detection library preparation kit for Alport syndrome, which has simple and rapid library construction steps, effectively reduces the cost and is suitable for different sequencing platforms.

Another purpose of the invention is to provide a universal gene detection library construction method of the Alport syndrome.

Another purpose of the invention is to provide a universal gene detection library of Alport syndrome obtained by the method.

In order to achieve the purpose, the invention provides the following technical scheme:

the invention firstly provides a universal high-throughput sequencing linker of Alport syndrome, wherein the linker sequence is as follows;

sequence a:

5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCCGT-3’；

sequence b:

5’-GAACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3’；

sequence c:

5’-GAACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTCTCTATGGGCAGTCGGTGATXXXXXX-3’

sequence d:

5’-XXXXXXATCACCGACTGCCCATAGAGAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCCGT-3’

where XXXXXXX represents the sample tag sequence.

In some embodiments, the tag sequence is selected from the group consisting of part or all of SEQ ID NO. 1-10.

In some embodiments, the linker sequence is annealed according to the following procedure and reaction system, annealing sequences a and b, respectively, to form a double-stranded linker, and annealing sequences c and d, respectively, to form another double-stranded linker.

The invention provides a kit for constructing a universal gene detection library of Alport syndrome, which comprises any one of the universal high-throughput sequencing adapters.

In some embodiments, the kit further comprises a PCR amplification primer set directed to the total coding region and/or variable splicing region of some or all of COL4A3, COL4a4, COL4a5, COL4a6, and MYH 9.

In some preferred embodiments, the primer sequence is selected from the group consisting of part or all of the primer sequences in FIGS. 5-10.

In other preferred embodiments, the primer sets are further divided into two groups: the primer sequences for group 1 are shown in FIGS. 5-7, and the primer sequences for group 2 are shown in FIGS. 8-10.

The invention also provides an application of the universal high-throughput sequencing joint and the kit for Alport syndrome in library construction or gene sequencing; preferably, the universal high-throughput sequencing linker used in Alport syndrome is applied to library construction or gene sequencing.

The invention also provides a construction method of the universal gene detection library of the Alport syndrome, which comprises the following steps:

1) multiplex PCR amplification: designing a synthesized ALPORT primer pool, and performing multiplex PCR amplification on a target region;

2) and (3) digesting a primer sequence: carrying out digestion reaction on the primer amplification product obtained in the step 1);

3) universal linker preparation, preparing a universal high throughput sequencing linker according to any one of claims 1-2;

4) connecting a sequencing joint: connecting the products of the step 2) and the step 3) under the action of DNA ligase;

5) library purification and amplification: and (3) adding purified magnetic beads into the connection product obtained in the step (4) for purification, and carrying out PCR amplification on the purified product to obtain a universal gene detection library of Alport syndrome.

In some embodiments, said step 1) designs a pool of synthetic primers against the full coding region and/or the variable splicing region of some or all of the genes COL4A3, COL4a4, COL4a5, COL4a6, and MYH 9.

In some embodiments, the step 2) mixes the amplification products of the two independent primer pools obtained in the step 1), and adds the digestion reaction premix to the mixed PCR product in a volume ratio of 1: 10; because the two ends of the amplification product are primer sequences, the digestion reaction in the step 2) can avoid introducing degenerate basic groups at the 5' end of the primers in the amplification process, and reduce the sequencing length (the length of the primer sequences at the two ends is nearly 40 bp).

The invention also provides a universal gene detection library of Alport syndrome, which is prepared by the needle construction method.

Compared with the prior art, the invention has the following beneficial technical effects:

1. the universal sequencing adaptors of the invention are compatible with a variety of sequencing platforms, including paired double-stranded complementary regions and unpaired single-stranded free arms. The distal end of the paired double-stranded portion contains a tag sequence, and the non-free ends of the two free arms contain tag sequences. The base composition of the label sequences carried by the same sample is consistent, and whether cross contamination exists in the library building process can be judged according to the consistency of the label sequences. After sequencing by using an Illumina sequencing platform, analysis of sequencing data can judge whether index hopping occurs or not according to whether base compositions of tag sequences of the same reads are consistent or not. The distal end of the paired double-stranded part contains a tag sequence, and the bases of the tag sequences carried by the sense strand and the antisense strand of the same read are identical. A particular mutation is determined to be true by the presence of both the sense and antisense strands of the same read. If a certain read only has mutation in the sense strand or the antisense strand, the read can be judged as an error in the library construction or sequencing process, and the mutation cannot be included for subsequent analysis procedures, so that false positive is avoided. In addition, the universal sequencing joint designed by the invention can effectively overcome the inherent label jumping problem of a sequencing part platform, and can realize authenticity interpretation of low-frequency mutation and the like.

2. The universal gene detection library of Alport syndrome prepared by the method or the kit can be carried out on all types of sequencing platforms of a mainstream sequencing platform Ion Torrent and Illumina to generate sequencing data. So that the library construction kit and the method are not limited by the existing sequencing platform. Meeting increasingly diverse clinical requirements. Meanwhile, the development cost and the development period of an application enterprise are saved.

3. The library provided by the invention adopts a high-throughput gene sequencing technology to detect the gene mutations of COL4A3, COL4A4, COL4A5, COL4A6 and MYH9, the detection range is the full coding region and the variable shearing region of the genes, the main disease genes of Alport syndrome are covered, and the mutation detection is comprehensive.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1, schematic structural diagram of a universal high throughput sequencing adapter described in example 1;

FIG. 2, bioanalyzer measurements (a-f) of 10 blood DNA libraries 2100 constructed according to the method of the present invention;

FIG. 3, bioanalyzer test results (g-j) of 10 blood DNA libraries 2100 constructed according to the method of the present invention;

FIG. 4, a library construction and assay flow diagram according to the present invention;

FIGS. 5-7, primer sequences of PCR multiplex amplification primer pool 1;

FIGS. 8-10 primer sequences for PCR multiplex amplification primer pool 2.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The following terms or definitions are provided only to aid in understanding the present invention. These definitions should not be construed to have a scope less than understood by those skilled in the art.

Unless defined otherwise below, all technical and scientific terms used in the detailed description of the present invention are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present invention.

As used herein, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of …" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.

Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun.

The terms "about" and "substantially" in the present invention denote an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.

Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

The term "nucleic acid" or "nucleic acid sequence" in the present invention refers to any molecule, preferably polymeric molecule, comprising units of ribonucleic acid, deoxyribonucleic acid, or analogues thereof. The nucleic acid may be single-stranded or double-stranded. The single-stranded nucleic acid may be a nucleic acid that denatures one strand of a double-stranded DNA. Alternatively, the single-stranded nucleic acid may be a single-stranded nucleic acid not derived from any double-stranded DNA.

The term "complementary" as used herein relates to hydrogen bonding base pairing between nucleotide bases G, A, T, C and U, such that when two given polynucleotides or polynucleotide sequences anneal to each other, a pairs with T, G pairs with C in DNA, G pairs with C, and a pairs with U in RNA.

Example 1 design and preparation of Universal high throughput sequencing adapters

Based on the prior patent application CN202010407833.5 of the applicant, a universal sequencing linker sequence which can be used for COL4A3, COL4A4, COL4A5, COL4A6, MYH9 and other genes and is simultaneously suitable for Ion Torrent and Illumina multi-sequencing platforms is designed and prepared. The specific method comprises the following steps:

based on the construction of the linker modules shown in FIG. 1, 10 sets of universal high throughput sequencing linkers AN1/PN1-AN10/PN10 were designed for the full coding region and the variable splicing region of the COL4A3, COL4A4, COL4A5, COL4A6 and MYH9 genes, with:

first synthesizing the following single chains

Sequence a:

sequence b:

sequence c:

sequence d:

wherein XXXXXXX represents sample tag sequences, and specific groups 1-10 tag sequences are respectively:

label number	Sequence of
		Group 1	CTAAGGTAAC(SEQ ID NO.1)
Group 2	TAAGGAGAAC(SEQ ID NO.2)
		Group 3	AAGAGGATTC(SEQ ID NO.3)
Group 4	TACCAAGATC(SEQ ID NO.4)
		Group 5	CAGAAGGAAC(SEQ ID NO.5)
Group 6	CTGCAAGTTC(SEQ ID NO.6)
		Group 7	TTCGTGATTC(SEQ ID NO.7)
Group 8	TTCCGATAAC(SEQ ID NO.8)
		Group 9	TGAGCGGAAC(SEQ ID NO.9)
Group 10	CTGACCGAAC(SEQ ID NO.10)

Annealing is carried out according to the following procedures and reaction systems, wherein the sequences a and b are respectively annealed to form AN 1-AN10 linkers, and the sequences c and d are respectively annealed to form PN 1-PN 10 linkers.

Name of reagent	Volume of μ L
		NEBuffer 10x	1.25
Single chain (50uM)	5
		Single chain (50uM)	5
Nuclease-free water	1.25
		Total	12.5

And (3) annealing procedure: and (3) heating the sample to 105 ℃, annealing the sample by using a PCR instrument, denaturing the sample at 95 ℃ for 5min, then cooling the sample at 95 ℃ to 25 ℃, and adjusting the cooling speed to be tem/min which is 0.6%, thereby obtaining the universal high-throughput sequencing joint. In addition, if the stability of the linker is further enhanced, it is possible to select a stability modification, such as a thio modification, at the 3 'end of the free arm of the linker, preferably a phosphorothioate instead of the phosphodiester bond between the last 3 bases of the 3' end, and the like. Such as:

sequence a:

5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCC*G*T-3’；

sequence d:

5’-XXXXXXATCACCGACTGCCCATAGAGAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCC*G*T-3’

example 2 Universal Gene testing library construction for Alport syndrome

Collecting 10 samples from Beijing coordination hospital Alport syndrome patients for library construction, performing multiplex PCR by using a primer pool containing the full coding regions and variable shearing regions (exons extend to introns by 20bp) of COL4A3, COL4A4, COL4A5, COL4A6 and MYH9 genes as target regions, and connecting sequencing joints to construct a library, wherein the specific operation flow is as follows:

(1) nucleic acid extraction and quality inspection: after nucleic acid extraction and quality inspection, blood cells are required to meet certain quality control standards: the DNA concentration is 10 ng/. mu.L; DNA purity: OD 260/2801.8-2.0, OD260/230> 2; total initial amount of DNA was 20 ng.

(2) Multiplex PCR primer design and amplification:

designing primer pools based on the full coding region and the variable splicing region (exon-intron extension 20bp) of COL4A3, COL4A4, COL4A5, COL4A6 and MYH9 genes, in order to ensure that the target region (the full coding region and the variable splicing region of the gene to be detected) is completely covered and avoid the formation of primer dimers or short fragments between the primers of adjacent amplicons, the primers are separated into two independent primer pools, and the specific sequence of the primer pools is shown in FIGS. 5-10 by taking the COL4A3 gene as an example.

The PCR amplification primers were separated into two separate primer pools for multiplex PCR amplification with 10. mu.L of each reaction and a total volume of 20. mu.L. Performing multiple PCR amplification on the DNA meeting the DNA quality standard in the step (1), wherein the reaction system is as follows: mu.L of the amplification reaction premix, 5. mu.L of the primer pool, 3. mu.L of the DNA, and 10. mu.L in total. The multiplex PCR reaction conditions were: the reaction was terminated by holding at 99 ℃ for 2min and then performing 16 cycles of 99 ℃ for 15s, 60 ℃ for 4min and then 10 ℃.

(3) And (3) digesting a primer sequence: mixing the amplification products of the two independent primer pools obtained in the step (2), and adding the amplification products into a digestion reaction system as follows: mu.L of amplification product + 2. mu.L of digestion reaction premix, total volume 22. mu.L. Digestion reaction conditions are as follows: maintaining at 50 deg.C for 20min,55 deg.C for 20min, 60 deg.C for 20min, and then at 10 deg.C for no more than 1 h.

(4) Connecting a universal joint: reagents were added to the digest in the following order: 4. mu.L of ligation buffer, 2. mu.L of ligase, 1. mu.L of AN linker and 1. mu.L of PN linker prepared in example 1, and 8. mu.L in total; reaction conditions are as follows: maintaining at 22 deg.C for 30 min; keeping at 68 deg.C for 5 min; keeping at 72 deg.C for 5 min; finally keeping the temperature at 10 ℃ for not more than 1 h.

(5) Purifying the ligation product obtained in the step (4) by using a purified magnetic bead, and then carrying out PCR amplification according to the following procedures and systems:

components	Reaction volume
		PCR MIX	25uL
Upstream primer (5uM)	5uL
		Downstream primer (5uM)	5uL
Purified ligation product	20uL
		Total volume	50uL

And purifying the amplified library to obtain the universal gene detection library of the Alport syndrome.

Example 3 Multi-platform sequencing verification and detection

Respectively combined with high-throughput sequencing platform Ion GeneStaudio^TMDNA sequencing by the S5 Plus platform and the Miseq DX platform followed by detection of the checkpointsChange (SNP), small fragment insertion deletion (InDel), the specific steps are as follows:

(1) purification the library was then quality checked and quantified using Agilent 2100 and QUBIT 4.0. The 2100 quality inspection map of the library is shown in a figure 2-3, and shows that the main peak of the library length fragment is near 400bp and the main peak of the library is a single sharp single peak, and the result shows that the two ends of the target gene fragment are connected with the universal high-throughput sequencing adaptor. And calculating to obtain the concentration of the library according to the dilution multiple, wherein the concentration of the library is higher than 1ng/uL, so that subsequent experimental steps can be carried out, and the library construction fails below 1 ng/uL.

(2) Sequencing and verifying the universal gene detection library of the Alport syndrome by respectively adopting an Ion Torrent platform and an Illumina platform from the library obtained in the step (1), wherein the sequencing and verifying method specifically comprises the following steps:

A. ion Torrent platform Ion GeneStaudio^TMSequencing on an S5 Plus sequencer, and specifically implementing the following steps:

the purified and quality-checked eluate is diluted by Ion 520^TM&Ion 530^TMKit-OT, according to the Kit operating protocol, after template preparation on an IonTouch 2 instrument, Ion GeneStaudio^TMSequencing and data analysis were performed on an S5 Plus gene sequencer.

B. The method comprises the following specific steps of carrying out on-machine sequencing on an Illumina platform Miseq DX sequencer:

the above purification and quality control was diluted with a library, performed according to the Kit protocol using Miseq DX Reagent Kit v3, and subjected to sequencing and data analysis on a Miseq DX gene sequencer.

Analysis of sequencing data results was performed as follows:

for Ion GeneStaudio^TMS5 Plus platform:

1) analysis of Ion GeneStaudio^TMThe off-line result of the S5 Plus platform mainly comprises the base number more than or equal to Q20, the average read length of the read, On Target, Uniformity and Mean depth. In particular, see the following table:

sample name	Number of bases of ≥ Q20	Average length of reads	On Target	Uniformity	Mean depth
							1	348,552,479	203	81.23％	97.18％	1195
2	328,086,895	200	83.63％	97.5％	1178
						3	360,410,162	204	77.33％	97.81％	1172
4	371,896,860	203	81.28％	97.68％	1273
						5	410,940,870	203	81.85％	97.87％	1416
6	495,057,745	203	79.44％	97.07％	1655
						7	352,710,538	202	79.09％	97.08％	1178
8	340,196,931	203	81.75％	97.52％	1170
						9	364,030,781	203	82.55％	96.61％	1265
10	376,650,125	203	81.38％	96.98％	1295

2) The average length of the read segments of the samples is more than or equal to 200bp, which indicates that all the samples are read through, namely, the bases between the head and the tail of the Target fragment to be detected can be identified, Mean depth is more than or equal to 1000 ×, which indicates that the Target fragment to be detected is sequenced more than 1000 times, On Target rate is more than or equal to 79%, which indicates that 79% of the base sequences can be compared in the range of the Target region to be detected, Uniformity is more than or equal to 96%, which indicates that the amplification efficiency of each read segment in the Target region to be detected and the efficiency of connecting a universal high-flux connector are similar, the parameters indicate that the two ends of the Target gene segment to be detected of the samples are successfully connected with the universal high-flux sequencing connectors and the sequencing is successful, which indicates that the universal gene detection library of Alport syndrome can be used in IonGeneStudio^TMSequencing was performed by the S5 Plus gene sequencer.

For the Miseq DX platform:

1) the Miseq DX platform offline results were analyzed and mainly included data yield, Reads counts, and Q30 percentages. As shown in the table below.

2) The data yield of the two samples is more than or equal to 1.5G, the data of the Reads is more than or equal to 5M, the Q30 proportion is more than or equal to 90%, and the sequencing depth is more than 400 x, which indicates that the samples are sequenced successfully; the results show that the two ends of the target gene segment to be detected of the sample are successfully connected with the universal high-throughput sequencing joint, and the universal gene detection library of the Alport syndrome can be sequenced in an Miseq DX gene sequencer.

In conclusion, the universal gene detection library of the Alport syndrome prepared by the invention can simultaneously meet the requirement of Ion GeneStaudio^TMSequencing requirements of an S5 Plus platform and an Miseq DX platform are met, namely the requirements of two mainstream sequencing platforms, namely an Ion Torrent platform and an Illumina platform, are met, so that the universal gene detection library for Alport syndrome has universality.

In addition, the principle and the process of sequencing of all models in the Ion Torrent sequencing platform are consistent, so that the method is suitable for the IonGeneStudio^TMThe library of S5 Plus sequencers can be adapted to Ion Torrent platform other model sequencers, such as PGM, Proton, etc. Similarly, all model sequencing principles and processes in the Illumina sequencing platform are consistent, and the library suitable for the Miseq DX gene sequencer can be suitable for other model sequencers of the Illumina platform, such as MiniSeq and NextSeq. Therefore, it can be clearly understood that the universal gene detection library for Alport syndrome of the present invention can be applied to all models of sequencers of Ion Torrent platform and Illumina platform.

(3) Two-platform sequencing data analysis showed that the above samples were at Ion Genestudio^TMThe following consistent mutations were obtained for both the S5 Plus platform and the Miseq DX platform, indicating the accuracy and reliability of the methods of the invention. Specific data are shown in the following table, and the sequencing results of 10 samples.

The foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description. It is not intended to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain certain principles of the invention and its practical application to enable one skilled in the art to make and use various exemplary embodiments of the invention and various alternatives and modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims and their equivalents.

SEQUENCE LISTING

<110> Beijing Anzhiyin Biotechnology Ltd

<120> construction method of universal gene detection library of Alport syndrome and kit thereof

<130>2020

<160>10

<170>PatentIn version 3.5

<210>1

<211>10

<212>DNA

<213> Artificial sequence

<400>1

ctaaggtaac 10

<210>2

<211>10

<212>DNA

<213> Artificial sequence

<400>2

taaggagaac 10

<210>3

<211>10

<212>DNA

<213> Artificial sequence

<400>3

aagaggattc 10

<210>4

<211>10

<212>DNA

<213> Artificial sequence

<400>4

taccaagatc 10

<210>5

<211>10

<212>DNA

<213> Artificial sequence

<400>5

cagaaggaac 10

<210>6

<211>10

<212>DNA

<213> Artificial sequence

<400>6

ctgcaagttc 10

<210>7

<211>10

<212>DNA

<213> Artificial sequence

<400>7

ttcgtgattc 10

<210>8

<211>10

<212>DNA

<213> Artificial sequence

<400>8

ttccgataac 10

<210>9

<211>10

<212>DNA

<213> Artificial sequence

<400>9

tgagcggaac 10

<210>10

<211>10

<212>DNA

<213> Artificial sequence

<400>10

ctgaccgaac 10

Claims

1. A universal high-throughput sequencing linker for Alport syndrome, wherein the linker sequence is as follows;

sequence a:

sequence b:

sequence c:

sequence d:

where XXXXXXX represents the sample tag sequence.

2. The universal high-throughput sequencing linker for Alport syndrome according to claim 1, wherein the tag sequence is selected from the group consisting of SEQ ID nos. 1-10, partially or wholly.

3. A kit for universal gene testing library construction of Alport syndrome, wherein the kit comprises the universal high-throughput sequencing linker of any one of claims 1-2.

4. The kit for universal gene testing library construction of Alport syndrome according to claim 3, characterized in that it further comprises a PCR amplification primer set for the full coding region and/or variable splicing region of some or all of the genes COL4A3, COL4A4, COL4A5, COL4A6 and MYH 9.

5. The kit for constructing the universal gene testing library for Alport syndrome according to claim 4, wherein the primer sequence is selected from the group consisting of part or all of the primer sequences shown in fig. 5 to 10; preferably, the primer components are divided into two groups: the primer sequences for group 1 are shown in FIGS. 5-7, and the primer sequences for group 2 are shown in FIGS. 8-10.

6. Use of a universal high-throughput sequencing linker of Alport syndrome according to any one of claims 1-2 for library construction or gene sequencing; preferably, the universal high-throughput sequencing linker used in Alport syndrome is applied to library construction or gene sequencing.

7. A method for constructing a universal gene detection library of Alport syndrome is characterized by comprising the following steps:

1) multiplex PCR amplification: designing and synthesizing an ALPORT primer pool, and performing multiplex PCR amplification on a target region;

2) and (3) digesting a primer sequence: carrying out digestion reaction on the amplification product obtained in the step 1);

5) library purification and amplification: adding magnetic beads into the connection product obtained in the step 4) for purification, and carrying out PCR amplification on the purified product to obtain a universal gene detection library of Alport syndrome.

8. The method for constructing a universal gene testing library for Alport syndrome according to claim 7, wherein the step 1) designs a synthetic primer pool against all coding regions and/or variable splicing regions of partial or genes in COL4A3, COL4a4, COL4a5, COL4a6 and MYH 9; preferably, the primer sequences in the primer pool are selected from part or all of the primer sequences in fig. 5-10; more preferably, the primer components are divided into two groups: the primer sequences for group 1 are shown in FIGS. 5-7, and the primer sequences for group 2 are shown in FIGS. 8-10.

9. The method for constructing a universal gene testing library for Alport syndrome according to any one of claims 7 or 8, wherein the step 2) comprises mixing the amplification products of the two independent primer pools obtained in the step 1), and adding the digestion reaction premix to the mixed PCR product at a volume ratio of 1: 10.

10. A universal gene testing library for Alport syndrome, prepared by the method of constructing the needle of any one of claims 7 to 9.