CN110564745B - Lung cancer rare ALK fusion mutant gene and detection primer, kit and detection method thereof - Google Patents
Lung cancer rare ALK fusion mutant gene and detection primer, kit and detection method thereof Download PDFInfo
- Publication number
- CN110564745B CN110564745B CN201910794133.3A CN201910794133A CN110564745B CN 110564745 B CN110564745 B CN 110564745B CN 201910794133 A CN201910794133 A CN 201910794133A CN 110564745 B CN110564745 B CN 110564745B
- Authority
- CN
- China
- Prior art keywords
- primer
- sequencing
- kit
- alk
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a lung cancer rare ALK fusion mutant gene, and a detection primer, a kit and a detection method thereof. The invention comprises a rare CNTNAP5-ALK fusion mutation sequence (SEQ ID NO.1) in non-small cell lung cancer and a pair of primers (SEQ ID NO.2 and SEQ ID NO.3 sequences) for detecting the fusion mutation sequence. The invention uses the primer pair CNTNAP5-ALK fusion mutation sequence (SEQ ID NO.1) to amplify, the terminal of the amplified product is modified, the modified product is connected with a sequencing joint, and finally the connected product is purified to obtain the library which can be directly sequenced. The primer, the method and the kit can amplify, sequence and detect the rare fusion sequence efficiently, quickly and simply.
Description
Technical Field
The invention relates to the technical field of in-vitro molecular diagnosis and high-throughput sequencing library construction, in particular to a rare ALK gene fusion mutation in lung cancer, a detection primer, a kit and a detection and library construction method thereof.
Background
Anaplastic Lymphoma Kinase (ALK) is a tyrosine receptor Kinase consisting of an extracellular domain, a transmembrane domain, and an intracellular Kinase domain. The fusion of the ALK gene with other genes was detected in approximately 1% -7% of patients with Non-Small Cell Lung Cancer (NSCLC), resulting in high expression activity of intracellular tyrosine kinases. Chaperone genes that have been found to be fused with the ALK gene are EML4, KIF5B, TGF, KLC1, PTPN3, STRN, and the like.
Quite a plurality of chaperone genes are discovered at present, and due to the pathogenic mechanism of ALK gene fusion, a great number of genes can be fused with the ALK gene to cause diseases, and the fused forms are often overlooked by the conventional method because the occurrence frequency is too low, and are generally called as rare fused forms.
Detection of ALK fusion mutations can be achieved though conventional pathological detection methods such as Immunohistochemistry (IHC) detection, Fluorescence In Situ Hybridization (FISH) detection, and reverse transcription-polymerase chain reaction (RT-PCR) detection. However, the IHC detection method has poor specificity; the FISH method is used for detecting ALK, and the sensitivity is low; RT-PCR can only be detected and identified for known common ALK fusions.
Aiming at the problems, the invention discovers a novel rare ALK fusion mutation type, and designs a detection primer or a probe in a targeted manner, so that the sensitivity and the specificity of the specific rare fusion mutation can be improved.
Disclosure of Invention
The invention relates to a DNA sequence of a rare ALK fusion mutation CNTNAP5-ALK newly found in a non-small cell lung cancer patient, and a primer and a kit aiming at the sequence to detect the DNA in a special fusion form, and a corresponding detection and library-building method.
The first purpose of the invention is to provide a novel rare fusion mutation form of non-small cell lung cancer ALK gene.
The second purpose of the invention is to utilize specially designed primer pairs to carry out PCR amplification on the tissue or plasma DNA of a patient, carry out high-throughput sequencing on the amplified product by adding a linker sequence for high-throughput sequencing, and realize the detection of the rare fusion mutation by bioinformatics analysis.
The present invention relates to a mutant ALK gene, which is a fusion mutation of CNTNAP5 and ALK.
In a specific embodiment, the mutated ALK gene preferably comprises the sequence shown in SEQ ID No. 1.
SEQ ID NO.1：
AACAGCCCTTCTCTCCCCACTCTCCCCTGCCCCATGTCCCCCTCACATCCTCTGATCAGGGGGTGGGGAGCTCCTTCAGTGTCCATCACGATGGTGAAAGC
In another aspect, the invention provides a primer set for detecting a fusion mutation of CNTNAP5 and ALK.
In a specific embodiment, the primer set is capable of amplifying a sequence comprising the fusion site of CNTNAP5 with ALK from nucleotides 52 to 53 of SEQ ID No. 1.
Further, the primer set preferably comprises an upstream primer CAF1 and a downstream primer CAR1, wherein the upstream primer CAF1 comprises a sequence shown in SEQ ID No.2, and the downstream primer CAR1 comprises a sequence shown in SEQ ID No. 3.
SEQ ID NO.2：AACAGCCCTTCTCTCC
SEQ ID NO.3：GCTTTCACCATCGTGATG
Further, the primer pair can independently amplify the DNA to be detected in a single amplification reaction.
Preferably, when the above primer pairs are mixed, the two primers are mixed in equimolar amounts.
In another aspect, the present invention provides a method for preparing a library or detecting the mutated anaplastic lymphoma kinase gene, comprising the following steps:
(a) amplifying the DNA of a sample to be detected by using the primer set;
(b) performing end modification on the amplification product;
(c) connecting the modified product with a sequencing joint;
(d) and purifying the connected product to obtain the library capable of being directly sequenced.
Further, the amplification process may use a primer having a 5 'phosphorylation modification and a DNA polymerase capable of producing a 3' overhang A product, so that the step b) is omitted, and preferably, the amplification may be performed using Taq DNA polymerase.
Further, the above-mentioned amplification process may use DNA polymerase that generates blunt ends in order to add specially modified primers.
Further, end modification of the amplification product requires phosphorylation modification of the 5' end of the amplification product with phosphorylase and addition of a dangling A-terminus to the end of the product with DNA polymerase lacking 3' -5' activity.
Further, the sequencing linker used to ligate with the modified product may be a commercially available sequencing linker for the illeminia sequencing platform, preferably a TruSeq HT linker.
Further, the sequencing adapters used to ligate with the modified product may be commercially available for use with Ion Torrent sequencing platforms.
In another aspect, the invention provides a kit and a detection kit for constructing a sequencing library by using the method. The kit comprises the following reagents: 1) primer solution for amplifying a sequence of interest.
In a specific embodiment, the sequence of interest is a sequence comprising the fusion site of CNTNAP5 with ALK, from nucleotide 52 to nucleotide 53 of SEQ ID No. 1.
Further, the primer is preferably a primer set in the present invention.
Further, the kit also comprises the following reagents: 2) DNA polymerase and corresponding buffer solution for amplifying target segment; 3) a modified enzyme mixture and a corresponding buffer solution for terminal modification; 4) sequencing the adaptor DNA solution; 5) ligase and corresponding buffer; 6) equipment and reagents for library purification, such as magnetic beads, washing solution and eluent.
Further, the primer solution for amplifying the target sequence contains a 5' phosphorylation modification.
Further, the above-mentioned amplification enzyme for amplification may be an amplification enzyme lacking 3'-5' exonuclease activity, preferably Taq DNA polymerase.
Further, the above-mentioned amplification enzyme for amplification may be a high fidelity amplification enzyme having 3'-5' exonuclease activity, preferably KAPA Hifi DNA polymerase.
Further, the enzyme mixture for terminal modification is preferably a mixture of T4 Polynucleotide Kinase and Klenow Fragment (3'-5' exo-).
Further, the above sequencing adapters are necessary for sequencing on the corresponding sequencing platform.
Further, the above sequencing linker may be a sequencing linker for an illumina sequencing platform, preferably TruSeq HT.
Further, the sequencing linker can be a sequencing linker for an Ion Torrent sequencing platform.
Further, the above ligation process is carried out using a DNA double-stranded ligase.
Further, the Ligase is preferably T4 DNA Ligase.
In another aspect, the invention provides the use of the primer set of the invention in the preparation of a reagent for detecting a fusion mutation of CNTNAP5 and ALK.
The invention has the beneficial effects that:
the primer of the invention is specially used for rare ALK fusion mutation CNTNAP5-ALK, and provides an accurate and reliable detection method for detecting the rare mutation. The related primer, the method and the kit can efficiently, quickly and simply amplify, library, sequence and detect the rare fusion sequence.
Drawings
FIG. 1 shows the sequencing results of CNTNAP5-ALK on CZ17011 specimen.
Detailed Description
The technical contents of the present invention will be described in detail with reference to the accompanying drawings and specific embodiments.
Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention.
Example 1
In this example, 1 non-small cell lung cancer operation sample DNA (sample number CZ17011) and 3 normal human leukocyte DNA (sample number ZZ17101-ZZ17103) containing CNTNAP5-ALK fusion mutation through Sanger sequencing verification are respectively used as a positive group and a control group, and the test is carried out according to the method and the reagent of the invention, and the details are as follows:
1. amplification of the target region:
a) the following components were added in sequence on ice:
b) setting a reaction program on a PCR instrument according to the following table, covering the temperature with a hot cover at 105 ℃, and placing the prepared reaction solution on the PCR instrument for reaction:
c) the amplified product was purified by 2x Ampure XP (Beckman # a63882) magnetic beads according to the protocol, and finally eluted with 30uL of Elution Buffer (EB,20mM Tris pH 8) to obtain the purified amplified product.
2. End modification:
a) the following components were added in sequence on ice:
b) setting a reaction program on a PCR instrument according to the following table, covering the reaction program with a hot cover at 80 ℃, and placing the prepared reaction solution on the PCR instrument for reaction:
| number of cycles | Reaction temperature | Reaction time |
| - | 37℃ | 20min |
| - | 72℃ | 20min |
| - | 4℃ | Holding |
3. Connecting a joint:
a) the following components were added in sequence on ice:
| components | Sample addition amount |
| DNA modified at the end of the previous step | 20μL |
| T4 DNA Ligase(NEB M0202S) | 2μL |
| Quick Ligation Reaction Buffer(NEB#B6058S) | 6μL |
| Illumina TruSeq HT linker (5. mu.M) | 5μL |
| Deionized water | 17μL |
| Final volume of reaction | 50μL |
b) Setting a reaction program on a PCR instrument according to the following table, heating to 70 ℃, and placing the prepared reaction solution on the PCR instrument for reaction:
| number of cycles | Reaction temperature | Reaction time |
| - | 20℃ | 15min |
| - | 65℃ | 10min |
| - | 4℃ | Holding |
4. Purifying a connection product:
and purifying DNA of the connected product by 0.6x Ampure XP (Beckman # A63882) magnetic beads according to a method shown in the specification, and finally eluting by 30uL EB to obtain a purified sequencing library on the computer.
5. And (3) machine sequencing:
the purified sequencing libraries were operated on the machine according to the instructions of the illumina NextSeq 500 sequencer, the sequencing read length was no less than 150bp (150PE) on both ends, and the data size of each library required PF Reads no less than 0.5M.
6. And (3) data analysis:
the quality control requirement of the off-line data is that Q30 is more than 80%, and the comparison rate is more than 90%. The data meeting the quality control requirements are analyzed according to conventional sequence analysis software.
7. And (3) analysis results:
in the above results, the results of the detection of the verified pathological tissue DNA containing the mutation of the specific fusion gene are all positive correspondingly, and the results of the detection of the leukocyte (negative sample) DNA of healthy people are all negative, which indicates that the above method has very good sensitivity and specificity.
Example 2
In this example, the PCR amplification and first-generation sequencing of a CZ17011(CNTNAP5-ALK fusion mutation positive) sample were carried out using the primer set described above, as detailed below:
1. amplification of the target region:
a) the following components were added in sequence on ice:
b) setting a reaction program on a PCR instrument according to the following table, covering the temperature with a hot cover at 105 ℃, and placing the prepared reaction solution on the PCR instrument for reaction:
c) the amplified product was purified by 2x Ampure XP (Beckman # a63882) magnetic beads according to the protocol, and finally eluted with 30uL of Elution Buffer (EB,20mM Tris pH 8) to obtain the purified amplified product.
2. Sequencing the amplified products by one generation:
the purified amplification product is provided for third party company to carry out Sanger sequencing, the sequencing result is shown in figure 1, and the sequencing result is matched with the prior information of a CZ17011 sample (CNTNAP5-ALK fusion mutation positive), so that the primers can be fully used for effectively and accurately amplifying the mutation sequence.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> first-person Hospital in Hangzhou City, Fujian and Rui Gene science and technology Co., Ltd
<120> lung cancer rare ALK fusion mutant gene and detection primer, kit and detection method thereof
<130> 2019
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 101
<212> DNA
<213> human (Homo sapiens)
<400> 1
aacagccctt ctctccccac tctcccctgc cccatgtccc cctcacatcc tctgatcagg 60
gggtggggag ctccttcagt gtccatcacg atggtgaaag c 101
<210> 2
<211> 16
<212> DNA
<213> Artificial sequence
<400> 2
aacagccctt ctctcc 16
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence
<400> 3
gctttcacca tcgtgatg 18
Claims (15)
1. A mutant Anaplastic Lymphoma Kinase (ALK) gene, wherein said mutant anaplastic lymphoma kinase gene is a rare fusion mutation of CNTNAP5 and ALK;
the mutated anaplastic lymphoma kinase gene is a sequence shown as SEQ ID NO. 1.
2. A primer set for detecting the Anaplastic Lymphoma Kinase (ALK) gene mutated according to claim 1,
characterized in that the primer pair is capable of amplifying a sequence comprising the fusion site of CNTNAP5 and ALK, from nucleotide 52 to nucleotide 53 of SEQ ID NO. 1; the primer pair is an upstream primer and a downstream primer, the upstream primer is a sequence shown by SEQ ID NO.2, and the downstream primer is a sequence shown by SEQ ID NO. 3.
3. A library construction method for the mutated anaplastic lymphoma kinase gene according to claim 1, comprising the steps of:
(a) amplifying the DNA of a sample to be tested by using the primer set according to claim 2;
(b) performing end modification on the amplification product;
(c) connecting the modified product with a sequencing joint;
(d) and purifying the connected product to obtain the library capable of being directly sequenced.
4. The method of claim 3, wherein step (b) is omitted if a primer with phosphorylation modification is used in step (a) and an amplification enzyme that produces a 3' overhang A base is used.
5. The method of claim 3, wherein the enzyme used for product modification in step (b) is a mixture of phosphorylase and amplification enzyme capable of generating a 3' overhang A base.
6. The method of claim 3, wherein the sequencing adaptors in step (c) comprise sequences necessary for the corresponding sequencing platform.
7. The method of claim 3, wherein the modified product and the sequencing adaptor are ligated using DNA ligase, and the ligated product is purified for direct sequencing without amplification.
8. The kit for constructing the library of the CNTNAP5-ALK rare fusion mutation sequence according to claim 1, comprising the following reagents: a) a primer solution for amplifying a sequence of interest;
the target sequence is a sequence containing a fusion site of CNTNAP5 and ALK, wherein the fusion site is nucleotides 52 to 53 in SEQ ID NO. 1;
the primer is the primer pair according to claim 2.
9. The kit of claim 8, further comprising the following reagents: b) DNA polymerase and corresponding buffer solution for amplifying target segment; c) a modified enzyme mixture and a corresponding buffer solution for terminal modification;
d) sequencing the adaptor DNA solution; e) ligase and corresponding buffer; and/or f) equipment and reagents for purifying the library, such as magnetic beads, washing solutions and eluents.
10. The kit of claim 9, wherein the 5' end of the primer comprises a phosphorylation modification.
11. The kit of claim 9, wherein the amplification enzyme comprises 3'-5' exonuclease activity.
12. The kit of claim 9, wherein the modifying enzyme is a mixture of a phosphorylase and a DNA polymerase lacking 3'-5' exonuclease activity.
13. The kit of claim 9, wherein the sequencing adapters are necessary for sequencing on the corresponding sequencing platform.
14. The kit of claim 9, wherein the ligase is a DNA double strand ligase.
15. Use of the primer pair according to claim 2 for the preparation of a reagent for detecting the mutated Anaplastic Lymphoma Kinase (ALK) gene according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910794133.3A CN110564745B (en) | 2019-08-27 | 2019-08-27 | Lung cancer rare ALK fusion mutant gene and detection primer, kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910794133.3A CN110564745B (en) | 2019-08-27 | 2019-08-27 | Lung cancer rare ALK fusion mutant gene and detection primer, kit and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110564745A CN110564745A (en) | 2019-12-13 |
| CN110564745B true CN110564745B (en) | 2021-07-20 |
Family
ID=68776196
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910794133.3A Active CN110564745B (en) | 2019-08-27 | 2019-08-27 | Lung cancer rare ALK fusion mutant gene and detection primer, kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110564745B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021217499A1 (en) * | 2020-04-29 | 2021-11-04 | 华大数极生物科技(深圳)有限公司 | Method for constructing sequencing library, and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148323A (en) * | 2015-04-22 | 2016-11-23 | 北京贝瑞和康生物技术股份有限公司 | A kind of method and test kit merging abrupt climatic change library for building ALK gene |
| CN107699957A (en) * | 2017-05-27 | 2018-02-16 | 领星生物科技（上海）有限公司 | Fusion based on DNA, which is quantitatively sequenced, builds storehouse, detection method and its application |
| CN108998523A (en) * | 2018-07-24 | 2018-12-14 | 为康（苏州）基因科技有限公司 | A kind of detection method and detection kit of EML4-ALK fusion |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20180115922A (en) * | 2017-04-14 | 2018-10-24 | 대한민국 (식품의약품안전처장) | TPM4-ALK fusion protein and composition for diagnosing cancer |
-
2019
- 2019-08-27 CN CN201910794133.3A patent/CN110564745B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148323A (en) * | 2015-04-22 | 2016-11-23 | 北京贝瑞和康生物技术股份有限公司 | A kind of method and test kit merging abrupt climatic change library for building ALK gene |
| CN107699957A (en) * | 2017-05-27 | 2018-02-16 | 领星生物科技（上海）有限公司 | Fusion based on DNA, which is quantitatively sequenced, builds storehouse, detection method and its application |
| CN108998523A (en) * | 2018-07-24 | 2018-12-14 | 为康（苏州）基因科技有限公司 | A kind of detection method and detection kit of EML4-ALK fusion |
Non-Patent Citations (2)
| Title |
|---|
| Somatic Mutations from Whole Exome Sequencing Analysis of the Patients with Biliary Tract Cancer;Kyong-Ah Yoon 等;《Genomics and Informatics》;20181028;第16卷(第4期);第6138-6148页 * |
| The CASPR2 cell adhesion molecule functions as a tumor suppressor gene in glioma;LBC Bralten 等;《oncogene》;20101218;第29卷(第46期);摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110564745A (en) | 2019-12-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7379418B2 (en) | Deep sequencing profiling of tumors | |
| CN113661249A (en) | Compositions and methods for isolating cell-free DNA | |
| Okonechnikov et al. | InFusion: advancing discovery of fusion genes and chimeric transcripts from deep RNA-sequencing data | |
| EP3807884A1 (en) | Methods and systems for calling mutations | |
| JP7189401B2 (en) | Methods for preparing cell-free nucleic acid molecules by in situ amplification | |
| KR20190003987A (en) | Methods for capturing cell-free methylated DNA and its use | |
| CN107075730A (en) | The identification of circle nucleic acid and purposes | |
| WO2017054302A1 (en) | Sequencing library, and preparation and use thereof | |
| Petrova et al. | IDH1 and IDH2 mutations in patients with acute myeloid leukemia: Suitable targets for minimal residual disease monitoring? | |
| CN109486811A (en) | Both-end molecular label connector and application thereof and the sequencing library with the connector | |
| CN106939344B (en) | Linker for next generation sequencing | |
| US20180135044A1 (en) | Non-unique barcodes in a genotyping assay | |
| CN107164513A (en) | Mankind's polygenic mutation detection kit based on high-flux sequence method | |
| JP2022551401A (en) | Method for preparing a dual-indexed methyl-SEQ library | |
| Beg et al. | Integration of whole-exome and anchored PCR-based next generation sequencing significantly increases detection of actionable alterations in precision oncology | |
| CN110564745B (en) | Lung cancer rare ALK fusion mutant gene and detection primer, kit and detection method thereof | |
| Kunimasa et al. | Quantitative detection of ALK fusion breakpoints in plasma cell-free DNA from patients with non-small cell lung cancer using PCR-based target sequencing with a tiling primer set and two-step mapping/alignment | |
| CN107083442B (en) | BRCA1/2 gene variation combined detection kit and application thereof | |
| Peng et al. | Development and validation of an RNA sequencing assay for gene fusion detection in formalin-fixed, paraffin-embedded tumors | |
| CN112639127A (en) | Method for detecting and quantifying genetic alterations | |
| US20230112730A1 (en) | Compositions and methods for oncology precision assays | |
| TWI771847B (en) | Method of amplifying and determining target nucleotide sequence | |
| JP2022500062A (en) | Systems and methods for modular and combinatorial nucleic acid sample preparation for sequencing | |
| EP3012328B1 (en) | Methods for detecting oncogenic mutations | |
| Schupp | Clarifying the Transcriptional Profiles of Malignant Clones and Nonmalignant Cells of the Microenvironment Through Multiscale and Multiomic Analysis of Individual Tumors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |