CN111778222B - NRPS-PKS hybrid protein capable of producing flavonoid compounds in fungi and encoding gene and application thereof - Google Patents

Abstract

The invention relates to a preparation method of NRPS-PKS hybrid protein, a carrier, recombinant bacteria, protein and flavonoid compounds thereof. The amino acid sequence of the NRPS-PKS hybrid protein is shown as SEQ ID NO. 1. The NRPS-PKS hybrid protein can produce flavonoid compounds naringin chalcone and naringenin when in heterologous expression.

Description

NRPS-PKS hybrid protein capable of producing flavonoid compounds in fungi and encoding gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering in general, in particular to a preparation method of NRPS-PKS hybrid proteins, vectors, recombinant bacteria, proteins and flavonoid compounds thereof.

Background

Fungi are the second most organisms in nature, and their secondary metabolites are an important source of natural drugs. Among the fungal secondary metabolites that have been used in clinical therapy are penicillin, griseofulvin, cyclosporin a, lovastatin, alkaloids and the like. The synthetases are mainly divided into four classes: polyketide synthases (Polyketide synthases, PKSs), non-ribosomal polypeptide synthases (Non-ribsomal peptide synthases, NRPSs), terpene synthases/cyclases (Terpene synthases/bicycles, TCs), and dimethylpropenyl tryptophan synthases (Dimethylallyl tryptophan synthases, DMATSs). In addition, there is a class of PKS and NRPS hybrids in fungi that also catalyze the production of secondary metabolites. The hybrid enzymes are classified into PKS-NRPS and NRPS-PKS, and the complex and variable structures of the hybrid enzymes lead to various biological activities of products.

However, a large number of fungal transcriptome sequencing shows that more than 90% of secondary metabolite synthesis gene clusters in fungi are in a silent state under the conventional culture conditions of a laboratory, and the corresponding products cannot be obtained through expression, so that the discovery of new metabolites and the research on synthesis mechanisms thereof are greatly limited. Meanwhile, the research difficulty is increased due to the long culture period of part of the primary strains, the difficult genetic operation and the like.

The flavonoid compounds are compounds which have a parent nucleus with a 2-phenyl chromone structure, contain two phenolic hydroxyl benzene rings and are mutually connected through three carbon atoms in the center. Flavonoid compounds are commonly found in plant bodies, and researches show that the flavonoid compounds have various biological activities and pharmacological activities, such as antibacterial activity, antitumor activity, antioxidant activity, anticoagulation effect, immunoregulation and the like, and also have certain treatment effects on diseases such as diabetes, senile dementia and the like. Therefore, the method for rapidly and efficiently obtaining a large amount of flavonoid compounds has important significance for production and life.

The flavonoid compounds are generally prepared by chemical or biological synthesis methods. The biological synthesis method has more advantages than the chemical synthesis method, such as strong selectivity, high efficiency, multiple reaction types, mild reaction conditions, small environmental pollution and the like; compared with the method for obtaining the flavonoid compound from the plant body, the fungus system has the characteristics of short growth period, low nutrition requirement, strong environment adaptation capability and reproductive capacity, simple product separation and the like.

However, there is only one example of studies on isolation of flavonoids from fungi (Biosynthesis of Chlorflavonin in Aspergillus candidus: A Novel Fungal Route to Flavonoids.J.C.S.CHEM.COMM., 1979), and no report has been made to demonstrate the finding of synthetic genes for flavonoids in fungi.

Disclosure of Invention

Based on the background technology, the invention relates to NRPS-PKS hybrid protein capable of producing flavonoid compounds in fungi, and a coding gene and application thereof. The protein is derived from endophytic fungi of plants, mucor ficus (Pestalotiopsis fici CGMCC 3.15140), and has a size of about 293.1kDa. The gene number is PFICI_04360, the full length of the coding sequence is 8154 nucleotides, and a protein containing 2717 amino acids can be encoded. The PFICI_04360 gene and the coded protein thereof can generate flavonoid compounds naringin and naringenin when expressed in a heterologous manner.

The invention provides an NRPS-PKS hybrid protein, the amino acid sequence of which is shown as SEQ ID NO. 1.

Alternatively, according to the aforementioned hybrid protein, the nucleotide sequence encoding the hybrid protein is shown as SEQ ID NO.2 or SEQ ID NO. 3.

The invention also provides a vector, the nucleotide sequence of which comprises the nucleotide sequence for encoding the hybrid protein.

The invention also provides a recombinant bacterium which is obtained by introducing the vector into an original strain.

Alternatively, according to the aforementioned recombinant bacterium, the starting strain is a strain of Aspergillus or Saccharomyces. Preferably, the starting bacterium is aspergillus nidulans or saccharomyces cerevisiae.

The invention also provides a preparation method of the hybrid protein, which comprises the following steps: fermenting the recombinant strain. Preferably, the starting bacterium is Saccharomyces cerevisiae. Preferably, the preparation method further comprises the following steps after fermenting the recombinant bacterium: and (5) purifying the protein.

The invention also provides a preparation method of the flavonoid compound, which comprises the following steps: fermenting the recombinant strain.

Optionally, according to the aforementioned preparation method, the flavonoid is naringenin and/or naringenin chalcone.

Alternatively, according to the aforementioned preparation method, the starting strain of the recombinant bacterium is a strain of Aspergillus. Preferably, the flavonoid is naringin chalcone. Preferably, the preparation method further comprises the following steps after fermenting the recombinant bacterium: extracting and separating flavonoid compounds. The flavonoid compound is extracted and fermented to obtain crude extract. The extraction condition is that ethyl acetate is adopted for ultrasonic extraction. The flavonoid compound is obtained by adopting forward silica gel column chromatography to carry out dichloromethane/methanol gradient elution on the crude extract.

Alternatively, according to the aforementioned preparation method, the starting strain of the recombinant bacterium is a strain in Saccharomyces, and the fermentation substrate is one or more selected from parahydroxybenzoic acid, coumaric acid, parahydroxybenzaldehyde and benzoic acid. Preferably, the fermentation substrate concentration is 0.1-10mg/ml. Preferably, the flavonoid is naringin. Preferably, the preparation method further comprises the following steps after fermenting the recombinant bacterium: extracting and separating flavonoid compounds. The flavonoid compound is extracted and fermented to obtain crude extract. The extraction condition is that ethyl acetate is adopted for ultrasonic extraction. The flavonoid compound is obtained by adopting forward silica gel column chromatography to carry out dichloromethane/methanol gradient elution on the crude extract.

The hirsutella fici (Pestalotiopsis fici CGMCC 3.15140) is a plant endophyte separated from tea tree branches, and full genome sequencing and bioinformatics analysis show that the hirsutella fici contains 76 secondary metabolite synthetic gene clusters, while transcriptome sequencing shows that only 10 secondary metabolite gene clusters can be expressed under laboratory conditions, so that the diversity of secondary metabolites is greatly limited. Therefore, the expression of the silencing gene cluster is activated by changing culture conditions, utilizing strategies such as apparent regulation and global regulation factors, heterologous expression and the like, and the method has important significance for obtaining novel compounds with good biological activity. And the heterologous expression is carried out by utilizing a model strain with clear genetic background, easy molecular biological operation and mature genetic system, so that the expression product of the corresponding gene can be efficiently and rapidly obtained, and the synthesis mechanism research can be carried out in the strain with simple and clear background.

The invention obtains flavonoid compounds naringin and naringenin by carrying out bioinformatics analysis on genome and utilizing heterologous expression strategy to express silent NRPS-PKS hybrid enzyme in the trichoderma ficuum in model fungi saccharomyces cerevisiae and aspergillus nidulans, enriches the sources of the flavonoid compounds and simultaneously makes important contribution to efficiently obtaining a large amount of flavonoid compounds.

Drawings

FIG. 1 is a diagram showing the cleavage assay of pYWL82 of example 1;

FIG. 2 is a schematic diagram of the site-directed insertion of pYWL82 into Aspergillus nidulans of example 1;

FIG. 3 is a diagram of HPLC analysis of crude extract of Aspergillus nidulans mutant of example 2;

FIG. 4 is a diagram of HPLC analysis of crude extract of Aspergillus nidulans mutant of example 2;

FIG. 5 is a separation scheme and HPLC analysis of naringin of example 3, wherein A is the separation scheme of naringin and B is the HPLC analysis of naringin;

FIG. 6 shows the construction of pYZX10 and the cleavage thereof in example 4, wherein A is the design of pYZX10 and B is the cleavage of pYZX10 plasmid;

FIG. 7 is a PCR verification of the transformant of example 4;

FIG. 8 shows SDS-PAGE analysis of the PFICI_04360 protein purification of example 5;

FIG. 9 is an HPLC analysis chart of naringenin of example 6;

FIG. 10 is a nuclear magnetic pattern of naringenin chalcone of example 3;

FIG. 11 is a nuclear magnetic resonance spectrum of naringenin of example 6;

FIG. 12 is a chemical structural formula of naringenin and naringenin chalcone.

Detailed Description

The following detailed description of specific embodiments of the invention is provided in connection with the accompanying drawings and examples in order to provide a better understanding of the aspects of the invention and advantages thereof. However, the following description of specific embodiments and examples is for illustrative purposes only and is not intended to be limiting of the invention.

The experimental methods in the following examples are conventional methods unless otherwise specified.

The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all set up in triplicate and the results averaged. In the following examples, unless otherwise indicated, the technical means used in the examples are conventional means well known to those skilled in the art and commercially available general instruments and reagents, and reference may be made to the "molecular cloning Experimental guidelines (3 rd edition) (scientific Press)," microbiological experiments (4 th edition) (higher education Press), "manufacturer's instructions for the corresponding instruments and reagents, and the like.

The strains of aspergillus nidulans (Aspergillus nidulans) LO8030, saccharomyces cerevisiae (Saccharomyces cerevisiae) BJ5464 and the like can be purchased through commercial paths (such as China general microbiological culture collection center (CGMCC) and the like).

Reference herein to "starting strain" refers to the initial strain used in the genetic engineering strategy of the present invention. The strain can be a naturally occurring strain or a strain bred by means of mutagenesis, genetic engineering or the like.

The promoter used herein is not particularly limited as long as it can function as recognition, binding and transcription initiation of RNA polymerase, such as gpdA, AMAI, etc

Example 1 construction of a heterologous expression Strain of the PFICI_04360 Gene in Aspergillus nidulans

Aspergillus nidulans LO8030 was used as the starting strain for the genetic engineering of this example.

The gene PFICI_04360 (shown as SEQ ID NO. 2) used in this example is derived from Maota ficus (Pestalotiopsis fici CGMCC 3.15140), and is subjected to PCR amplification by using the Maota ficus genome as a template and using high-fidelity enzymes and the following primers, and is divided into 3 segments for cloning, wherein about 150bp of overlap sequence is contained between each segment.

Name	Oligonucleotide sequence(5’-3’)
		PF4360-1for	ttcagtatattcatcttcccatccaagaacctttaatcgggcagttcacctccttgacc
4360-R1	ggaggatccaagaccaagatg
		4360-F2	gactggttgcttcattggcacg
4360R2	ggagaatggcagtcgaatctgg
		4360F3	gtcagcacgacaacgagctc
PF4360-3rev	cacaacatatttcgtcagacacagaataactctcgctagcgtgctaattccgacaagcc

Then using yeast assembly techniques (see literature for specific principles and operations:Muller,Narayana Annaluru,Joy Wu Schwerzmann,Sarah M.Richardson,Jessica S.Dymond,Erthe PFICI_04360 (i.e., 3-piece overlap sequence of the foregoing clone) was assembled into the pYH-wA-gpdA-pyrG plasmid (construction of the pYH-wA-gpdA-pyrG plasmid) by ic M.Cooper, joel S.Bader, jef D.Boeke, srinivasan Chandrasegar. Assemblem Large DNA Segments in Yeast, protocol Gene Synthesis of the series Methods in Molecular biology.2012 (852): 133-150): taking pYH-wA-pyrG as a starting plasmid, and connecting the gpdA fragment to the starting plasmid in a homologous recombination mode; the pYH-wA-pyrG plasmid is described in: yin, w. -b., chooi, y.h., smith, a.m., cacho, r.a., hu, y., white, t.c., and Tang, y. Discovery of cryptic polyketide metabolites from dermatophytes using heterologous expression in Aspergillus nidurans acs synth.biol.2013,2 (11): 629-634), the pfici_04360 heterologous expression plasmid pYWL82 was obtained. Cleavage verification of the pYWL82 recombinant plasmid is shown in FIG. 1, which shows that PFICI_04360 has been successfully ligated to the pYH-wA-gpdA-pyrG plasmid.

Genetic transformation of Aspergillus nidulans is carried out by using a PEG-mediated protoplast genetic transformation method (the transformation method is the same as that of the construction and application of a heterologous expression system of Aspergillus nidulans, the publication number of which is 201710283508.0, CN108795970A, in particular paragraphs 0039-0047 in the specification), then transformants are picked up and genomic DNA is extracted, and the transformants are identified by using a PCR method, thus obtaining the heterologous expression strain of PFICI_ 04360. A schematic representation of the site-directed insertion of pYWL82 into Aspergillus nidulans is shown in FIG. 2.

Example 2 HPLC verification of heterologous expression product of the PFICI_04360 Gene in A.nidulans

To verify the products of heterologous expression of the genes, the pfici_04360 heterologous expression strain obtained in example 1 and aspergillus nidulans LO8030 were cultured in rice medium (80 g rice, 1.2g YE, 115mL water were added to each 500mL Erlenmeyer flask, the auxotroph was added according to the genotype of the mutant strain, and steam sterilization was performed at 121 ℃ high pressure for 30 mm) at 25 ℃ for 12 days, then compound extraction was performed, and the compound obtained by extraction was used to detect the heterologous expression products of pfici_04360 in aspergillus nidulans by high performance liquid chromatography HPLC analysis method. The results are shown in FIGS. 3 and 4.

The extraction was performed under the following conditions: the mycelia obtained after culturing for 12 days and the culture medium were subjected to compound extraction. Dividing the culture into small pieces, placing in a triangular flask, adding 2 times volume of MEA (ethyl acetate: methanol: glacial acetic acid=89:10:1), and performing ultrasonic extraction (ultrasonic frequency 100Hz, time 1 hr), and shaking the triangular flask during the period to make the extraction more sufficient; collecting the extractive solution, transferring to a 100mL rotary evaporator, and evaporating to dryness (temperature 30deg.C, rotation speed 100rpm/min, vacuum degree <3mm Hg) by rotary evaporator; after evaporation to dryness, the mixture was dissolved in 800. Mu.L of analytically pure methanol, and the mixture was diluted to a suitable concentration by filtration through an organic phase microporous membrane to remove the methanol-insoluble substance, followed by HPLC analysis using a 100% methanol column. HPLC analysis was performed under the following conditions: the device comprises: waters e2695 system detector: waters 2998 (200-600 nm); chromatographic column: 38020-41 COSMIL 5C18-MS-II packet Column,4.6mm I.D.x 250mm; elution rate: 1mL/min, eluent: water and methanol the methanol content was increased from 20% methanol to 100% methanol in 20 min.

In fig. 3, the HPLC analysis object was divided into a blank (CK) as the original strain LO8030, and a Crude extract (Crude extract) as the compound obtained by the above extraction and naringenin chalcone standard (Naringenin chalcone ST).

As can be seen from FIG. 3, the crude extract had a peak with the same peak time and UV absorbance as naringin chalcone standard, and the blank was judged to be the same compound, but no peak.

In FIG. 4, the HPLC analysis object was Crude extract (Crude extract-10 d) which was the compound obtained by the above extraction, naringin chalcone standard (Naringenin chalcone ST) and naringin standard (Naringin ST). As can be seen from FIG. 4, the crude extract contains both naringenin and naringenin chalcone.

Example 3 isolation, purification and characterization of the heterologous expression product of the PFICI_04360 Gene in Aspergillus nidulans, naringin chalcone

To further determine the products of heterologous expression in A.nidulans, the PFICI_04360 heterologous expression strain obtained in example 1 was cultivated by fermentation in rice medium. Firstly, streaking and inoculating the strain into GMM (supplementing corresponding nutritional defect), standing and culturing for 3 days under dark condition at 37 ℃ and after spore production, using 0.1% Tween 80 to help wettingMoistening spore, filtering mycelium with filter cloth, and making spore suspension. 80g of rice, 1.2g of YE and 115mL of water are added into each 500mL triangular flask, the auxotroph is added according to the genotype of the mutant strain, and the mutant strain is sterilized by high-pressure steam at 121 ℃ for 30 mm. Inoculating 2.5X10 of rice culture medium per bottle ⁷ The spores were allowed to stand still for 12 days at 25℃in the dark.

The extraction was performed under the following conditions: the fermentation product was collected together with the medium in a 5L jar, 1 volume of ethyl acetate was added and extracted with ultrasound for 1h. The crude extract was concentrated by rotary evaporator (temperature 30 ℃, rotation speed 100rpm/min, vacuum <3 mmHg). The extraction was repeated 3 times in total.

The specific separation flow is shown in fig. 5A, and the separation of the target product is performed under the following conditions: the target peak was determined according to HPLC verification of the heterologous expression product of example 2. Subjecting the crude extract to forward silica gel column chromatography, and gradient eluting with dichloromethane/methanol (CH ₂ Cl ₂ Meoh=100:0, 250:1,100:1,50:1,30:1,20:1,10:1, 0:100), and after HPLC detection analysis, the fraction of the compound of interest (i.e. F7-F13) was determined. And (3) merging fractions of the target compound, separating by a propyl Sephadex gel column (Sephadex LH-20), eluting by methanol, detecting and merging by HPLC, and determining fractions of the target compound (F93-F101) again to finally obtain the target compound (compound 1). The analytical results of HPLC in the separation procedure are shown in FIG. 5B. Wherein, HPLC analysis objects include: the blank (CK (LO 8030)) was the original strain LO8030, the crude extract obtained by extraction in example 2, the crude extract obtained by extraction in this example, the forward silica gel column chromatography was the fractions F7-F13 obtained by forward silica gel column chromatography eluting with a dichloromethane/methanol gradient, the propyl Sephadex column was separated by a propyl Sephadex column (Sephadex LH-20), the methanol eluted pool, and naringenin chalcone was the final target compound (component 1).

NMR analysis was performed under the following conditions: bruker Avance III 500 Nuclear magnetic resonance spectrometer; the isolated target compound (compound 1) was dissolved in acetate-d 6 to collect nuclear magnetic resonance hydrogen spectrum data, which was compared with published data after attribution by 1H and 13C NMR analysis, and the spectrum data was consistent with naringin as reported in literature (Slimead R, fossent, verheul MJ. The flavonoidsof tomatoes [ J ]. Journal of Agricultural and Food Chemistry,2008,56 (7): 2436-41.), and the NMR spectrum was shown in FIG. 10.

Naringenin chalcone has the following structural formula:

。

example 4 construction of a heterologous expression Strain of the PFICI_04360 Gene in Saccharomyces cerevisiae

The cDNA sequence of the hirsutella fici (shown as SEQ ID NO. 3) is used as a template, an exon gene which can be directly expressed in yeast is obtained by PCR, a yeast heterologous expression plasmid is constructed by utilizing a yeast assembly strategy, and the yeast heterologous expression plasmid is transformed into Saccharomyces cerevisiae BJ 5464.

Total RNA from disc-like hirsutella fici was obtained under the following conditions: using ambionA kit. The Pediopsidium Ficus cultured in PDA medium for 5 days was selected as material, and the cells were ground with a SPEX samplePrep 6870 Freeze/Mill frozen liquid nitrogen grinder. Transferring the ground powdery (small amount) sample into a centrifuge tube (RNase-free), adding 1mL TRIZOL Reagent/100mg tissue, shaking vigorously, and standing at room temperature for 5min; adding 0.2mL chloroform/mL TRIZOL Reagent, shaking vigorously for 10s, and standing at room temperature for 5min; centrifuging at 12000rpm at 4deg.C for 15min (pre-cooling at 4deg.C in advance), separating the sample into three layers, colorless water phase (upper layer), middle layer, and pink organic phase (lower layer); transferring the colorless water phase into a new centrifuge tube, adding equal amount of isopropanol TRIZOL Reagent, slightly reversing and uniformly mixing, and standing at room temperature for 10min; centrifuging at 12000rpm for 10min at 4deg.C, removing supernatant, and forming gelatinous precipitate at the side and bottom of the tube; adding 1mL 75% ethanol (RNase-free), shaking, removing supernatant, sucking the rest liquid, and dissolving the precipitate in 50-200 μL RNA solution; total RNA was detected by 2.0% agarose gel electrophoresis.

The fig disc-like hirsutella sinensis cDNA is synthesized under the following conditions: a FastQuant cDNA first Strand Synthesis kit was used. Thawing the template RNA on ice; thawing 5 XgDNA Buffer, FQ-RT Primer Mix, 10 Xfast RT Buffer, RNase-Free ddH2O at room temperature (15-25 ℃), rapidly placing on ice, mixing each solution by vortex oscillation, centrifuging briefly, and collecting liquid remained on pipe wall; a mixed solution of the genomic DNA removal system (5 XgDNA Buffer 5. Mu.L, total RNA, RNase-Free ddH2O up to 10. Mu.L) was prepared and thoroughly mixed. Centrifuging briefly, placing at 42 ℃, incubating for 3min, and then placing on ice; preparing a mixed solution (10Fast RT Buffer 2 L,RT Enzyme Mix 1 L,FQ-RT Primer Mix 2L, RNase-Free ddH2O is complemented to 10L) according to the reverse transcription reaction system; mix in the reverse transcription reaction is added into the reaction solution of the gDNA removal step, and fully and uniformly mixed; incubating at 42 ℃ for 15min; after incubation at 95℃for 3min, the resulting cDNA was placed on ice and used for subsequent experiments or stored at-20 ℃.

The yeast heterologous expression plasmid was constructed under the following conditions:

yeast transformation kit S.c.easy Comp Transformation Kit: invitrogen by life technology.

And using the obtained cDNA as a template, and carrying out PCR amplification by using high-fidelity enzyme according to the following primers, wherein the amplification sequence is shown as SEQ ID NO. 3. Specifically, it was divided into 6 fragments of about 1.5kb in length according to the principle of SOE-PCR, each comprising a repeat region of the contiguous fragment, and the vector-contiguous fragments contained vector homologous sequences on both sides.

Name	Oligonucleotide sequence(5’-3’)
		YE4360-P1-F	atggctagcgattataaggatgatgatgataagactagtatgtctcaaccaacttcggt
YE4360-P1-R	ctcgccaagcaatccgtgtagaatg
		YE4360-P2-F	gaattctcaccacttcggatgtcgg
YE4360-P2-R	gagaacatcaatgtcggtaggcgac
		YE4360-P3-F	gccgaacgtactcgagcgac
YE4360-P4-F	cacggcaatcattgcagttgtcaac
		YE4360-P4-R	cttcaactcggtccacttgagtcgg
YE4360-P5-F	catacaagtctttgaggctgccacc
		YE4360-P5-R	gagtatcggagcgactctctggag
YE4360-P6-F	catctgtttgaccgcgcactac
		YE4360-P6-R	ttgtcatttaaattagtgatggtgatggtgatgcacgtgaacccccaactgctcctttg

To be linearized with autonomously replicating sequencesVector pXW55 (pXW 55 vector reference W.Xu, X.Cai, M.E.Jung and Y.Tang, J.Am.Chem.Soc.,2010,132,13604-13607) was mixed with 6 fragments of about 1.5kb in length from the above PCR, rapidly centrifuged and added to 50. Mu.L yeast competent cells thawed on ice; adding 500 mu L of Solution III at room temperature, and uniformly mixing by vortex; incubation at 30deg.C for 1 hr, during which vortex for 1-2s every 15min; coating the bacterial liquid on an SDCt (A, U) plate, and culturing for 2 days at 30 ℃; streaking the single colonies on SDCt (A, U) plates, and culturing at 30 ℃ overnight; colony PCR verifies transformants. Using zymopprep ^TM Yeast Plasmid Miniprep I the kit extracts yeast plasmids and converts the yeast plasmids into competent E.coli; and selecting the transformant for colony PCR verification, extracting plasmids after shaking culture of the correct transformant, and performing enzyme digestion verification by using NEB restriction endonuclease to obtain a recombinant vector named pYZX 10. The recombinant plasmid design scheme and the cleavage verification result are shown in FIG. 6, the cleavage result band is consistent with the expectation, and the cDNA encoding the hybrid protein of the invention is successfully connected to a vector pXW55.

The yeast heterologous expression strain was constructed under the following conditions: the recombinant vector pYZX10 is transformed into yeast competence by using the yeast transformation method to obtain a skeleton gene yeast heterologous expression strain. The results of PCR verification of the transformants are shown in FIG. 7, in which positive control (+CK) is a PCR template for recombinant vector pYZX10 and negative control (-CK) is no template.

Example 5 purification of PFICI_04360 protein in Saccharomyces cerevisiae

The yeast heterologous expression strain constructed in the above example 4 was inoculated into 5mL of SDCt medium, and after two days of culture at 30℃and 280rpm, microscopic examination was carried out without contamination and in a normal growth state. YPD medium (1%Yeast extract,2% Peptone) was inoculated at a ratio of 1:1000, sterilized, and then added to a glucose stock solution to give a final concentration of 1%), and after culturing at 28℃and 280rpm for 96 hours, the cells were collected by high-speed centrifugation and dissolved in an appropriate amount of Lysis buffer. After the bacterial liquid is rapidly frozen in liquid nitrogen, an ultrasonic breaker or a frozen liquid nitrogen grinder is used for microscopic examination to determine the breaking rate of cells, and lysate is obtained. Ultrasonic breaker: 600W, 20S of crushing, 20S of intermittent operation, 100 times; frozen liquid nitrogen mill: crushing for 20S, and intermittently performing 20S and 15 times. Centrifuge at 17.000rpm,4℃for 2h. Taking the supernatant. 1mL of 50% Ni-NTA suspension was added to the supernatant, gently mixed, stirred in an ice bath for 60min, and then Lysate-Ni-NTA was applied to the column. The liquid flows through and the fraction FT is collected. On ice, 5mL Wash buffer was added to the Ni column to elute the impurities and fractions were collected. Eluting twice. Eluting target protein by adding 2.5. 2.5mL Elution buffer to a Ni column on ice, and collecting E1 fraction. Eluting target protein by adding 2.5. 2.5mL Elution buffer to a Ni column on ice, and collecting E2 fraction. 100L of Bradford is added into a 96-well plate, 10L of fractions are added into each well, and the protein concentration is detected to determine the SDS-PAGE loading; after the loading was determined, 6X protein loading buffer was added and the total volume was made up to 20L with lysis buffer. Heating for 10min at 100deg.C, cooling, and centrifuging. Samples were analysed by SDS-PAGE and Marker used in this example was #26625 of Thermo SCIENTIFIC. SDS-PAGE gels after electrophoresis were stained with Coomassie blue staining solution for 2h. Decolorizing with decolorizing solution for 40min, decolorizing again with distilled water after 40 min. The rotation speed of the shaking table is about 80rpm during decolorization and dyeing. SDS-PAGE analysis is shown in FIG. 8, wherein 1 is the sample to be examined. The protein is approximately 293.1kDa in size.

SDS-PAGE electrophoresis was used to analyze the fraction of the buffer in which the target protein was present and desalted using a PD-10 gel column. On ice, after the PD-10 gel column is washed by using a storage buffer, an addition buffer fraction is added, and the mixture is drained. Then 0.5. 0.5mL storage buffer was added sequentially and the S1-S7 fractions were collected. Fractions for the presence of the target protein were determined using Bradford and split into 100 μl per tube and stored at-80 ℃.

Example 6 PFICI_04360 Gene isolation, purification and characterization of coumaric acid and its product, naringenin, fed in Saccharomyces cerevisiae

The yeast heterologous expression strain constructed in example 4 above was inoculated into YPD medium (1%Yeast extract,2%Peptone, sterilized and then added to a glucose stock solution to give a final concentration of 1%) and cultured at 28℃for two days at 280rpm, followed by separation into test and control groups. The test group was incubated with 1mg/mL coumaric acid as the feed substrate at 28℃and 280rpm for three additional days, and MEA extracted. The control group (CK) was not added with coumaric acid, and the other experimental procedures were the same as those of the experimental group. FermentationThe samples were processed in the same manner as in example 3. After the crude extract is obtained, the liquid phase is used for compound separation, and the target difference peak is obtained. Separating to obtain its pure product, dissolving in CD ₃ OD was subjected to 1H-NMR analysis, spectroscopic data from the literature (Qian Y X, kang J C, luo Y K, et al second Metabolites of an Endophytic Fungus Phomopsis castaneae-mollissimae [ J)]Chemistry of Natural Compounds, 2018:1-2.) reported naringenin agreement. HPLC analysis results and nuclear magnetic patterns are shown in FIGS. 9 and 11. As can be seen, only the test group with coumaric acid as substrate will obtain naringenin as the product.

Naringenin has the following structural formula:

。

in addition, the same NMR spectrum as that of FIG. 10 was obtained by performing NMR analysis of the fermented sample in the same manner as in example 3, and thus, the product of feeding coumaric acid with PFICI_04360 gene in Saccharomyces cerevisiae also includes naringenin chalcone.

Example 7 PFICI_04360 Gene feeding of different concentrations of coumaric acid in Saccharomyces cerevisiae

The experimental procedure of this example was the same as that of example 6 except for the concentration of coumaric acid, and the concentrations of coumaric acid were 0.1, 0.3, 0.5 and 10mg/ml, respectively, for test groups 1 to 4.

HPLC was used to verify that the PFICI_04360 gene was fed heterologous expression products of different concentrations of coumaric acid in Saccharomyces cerevisiae. For specific implementation see example 2.

As can be seen by HPLC analysis, the strains of test groups 1-4 all produced naringenin and naringenin chalcone.

Example 8 PFICI_04360 Gene feeding different fermentation substrates in Saccharomyces cerevisiae

The experimental procedure of this example was identical to that of example 6, except for the additional addition of fermentation substrate, and the concentrations of parahydroxybenzoic acid, parahydroxybenzaldehyde, benzoic acid were 0.1, 0.3, 0.5, 1,10 mg/ml, respectively, for test groups 1-15.

HPLC was used to verify that the PFICI_04360 gene was fed heterologous expression products of different fermentation substrates in Saccharomyces cerevisiae. For specific implementation see example 2.

As can be seen by HPLC analysis, the strains of test groups 1-15 all produced naringenin and naringenin chalcone.

Finally, it should be noted that: it is apparent that the above examples are only illustrative of the present invention and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. And obvious variations or modifications thereof are contemplated as falling within the scope of the present invention.

Sequence listing

<110> institute of microorganisms at national academy of sciences

<120> an NRPS-PKS hybrid protein capable of producing flavonoid compounds in fungi, and encoding gene and application thereof

<130> 190158CI

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2717

<212> PRT

<213> Ficus carica (Pestalopsis ficus)

<400> 1

Met Ser Gln Pro Thr Ser Val Pro Lys Leu Leu Leu His His Ala Val

1 5 10 15

Glu Ser Arg Asp Lys Val Ala Phe Leu Gly Pro Gly Trp Ser Ile Thr

20 25 30

Tyr Ser Asp Leu Glu Lys Arg Thr Arg Leu Val Ala Ala His Leu Ala

35 40 45

Arg Ala Gly Ile Gly Arg Gly Asp Phe Val Ala Ile Val Leu Gly Arg

50 55 60

Cys Leu Glu Ala Val Glu Ser Val Leu Ala Ile Met Arg Ala Gly Ala

65 70 75 80

Val Ser Val Pro Leu Asp Pro Arg Ser Pro Pro Ala Asp Leu Ala Arg

85 90 95

Val Leu Glu His Ser Gly Ala Arg Ala Ile Ile Thr Asp Asp Arg His

100 105 110

Leu Ala Thr Val Ser Ala Ala Ala Val Lys Gly Ser Leu Ile Ile Ile

115 120 125

Ser Thr Thr Asn Ala Gln Val Asp Val Ile Glu Ser Leu Lys Thr Glu

130 135 140

Arg Tyr Gln Asp Trp Val Glu Asp Asp Gly Tyr Ser Thr Ser Asp Val

145 150 155 160

His Leu Asp Ser Leu Gly Asp Glu Glu Glu Ala Phe Leu His Tyr Thr

165 170 175

Ser Gly Thr Thr Ser Leu Pro Lys Gly Val Leu Ser Ser Gln Lys Ser

180 185 190

Ala Leu Trp Asn Val Glu Lys Val Thr Ser Val Phe Glu Phe Ser Ser

195 200 205

Glu Asp Arg Phe Phe Trp Pro Leu Pro Leu Phe His Ile Leu Gly His

210 215 220

Ser Leu Cys Ile Leu Ala Thr Val Ala Lys Gly Ala Ser Ala Tyr Leu

225 230 235 240

Ser Asp Pro Asp Gln Leu Leu Leu Asp Asn Leu Leu Val Lys Asp Val

245 250 255

Glu Asp Thr Thr Phe Ile Ala Gly Ala Pro Ala Thr Phe His Glu Leu

260 265 270

Val Glu Ala Lys Ala Ala Ser Ser Ser Thr Leu Ser Leu Pro Lys Leu

275 280 285

Arg Ala Cys Met Ser Ala Gly Ala Ala Ala Ser Val Ser Leu Cys Asp

290 295 300

Gln Val His Glu Leu Phe Gly Val Ser Leu Leu Asn Asn Tyr Gly Cys

305 310 315 320

Thr Glu Thr Cys Gly Ala Ile Ala Ile Ser Arg Pro Gly His Val Tyr

325 330 335

Arg Gln His Gly Ser Val Thr Pro Leu Pro Asp Trp Glu Ile Gln Leu

340 345 350

Met Asp Gln Asp Gly Lys Gln Val Arg Glu Gly Glu Gln Gly Glu Leu

355 360 365

Trp Val Arg Gly Pro Gly Leu Met Leu Gly Tyr Tyr Lys Glu Thr Gln

370 375 380

Ser Pro Phe Thr Glu Asp Ala Trp Phe Pro Thr Gly Asp Thr Gly Ile

385 390 395 400

Leu Thr Thr Ser Asp Val Gly Lys Glu Leu Ser Leu Val Gly Arg Lys

405 410 415

Lys Glu Leu Ile Ile Arg Gly Gly Glu Asn Ile Gln Pro Ala Glu Leu

420 425 430

Glu Gln Val Leu Leu Gln His Pro Gly Val Ala Asp Val Ala Val Ser

435 440 445

Gly Ile Leu His Gly Leu Leu Gly Glu Thr Pro Ala Ala Phe Ile Val

450 455 460

Lys Glu Thr Pro Asp Leu Asp Leu Asp Leu Ser Ser Leu Ile Ala Thr

465 470 475 480

Cys Arg Glu Ala Leu Pro Asp Tyr Lys Val Pro Thr Ala Phe Tyr Glu

485 490 495

Ile Asp Ala Val Pro Arg Thr Leu Leu Gly Lys Pro Lys Arg Leu Ala

500 505 510

Val Ala Ser Tyr Thr Ser Lys Pro Leu Thr Val Arg Ser Arg Leu Gln

515 520 525

Thr Arg Ala Ala Val Glu Ala Leu Val Leu Ala Glu Thr Ala Gly Ala

530 535 540

Cys Gly Val Gln Ala Glu Pro Gly Glu Lys Glu Ser Asp Pro Asp Trp

545 550 555 560

Leu Arg Lys Tyr Ala Asp Glu Ser Phe Ser His Leu Gly Leu Thr Ser

565 570 575

Met Ala Gly Val Val Leu Arg Asp Arg Leu Ala Asn Leu Thr Gly Leu

580 585 590

Val Asp Leu Pro Asn Thr Leu Val Phe Asp Tyr Ser Thr Pro Ala Ala

595 600 605

Val Arg Asp Tyr Leu Phe Asn Arg Leu Arg Glu Gln Glu Ser Pro Leu

610 615 620

Pro Ser Lys Ser Ala Pro Ala Leu Ser Leu Pro Ser Lys Ala Glu Pro

625 630 635 640

Ile Ala Ile Ile Ser Met Ala Cys Arg Tyr Pro Gly Gly Ile Ser Ser

645 650 655

Pro Glu Asp Leu Trp Gln Leu Val Ser Asp Glu Ile Asp Ala Thr Thr

660 665 670

Asp Phe Pro Ser Asp Arg Gly Trp Asp Ile Asp Ser Leu Tyr Ser Thr

675 680 685

Asp Pro Thr Glu Pro Phe Thr Ser Thr Thr Lys Arg Gly Gly Phe Leu

690 695 700

Pro Asp Phe Ala Asp Phe Asp Ala Gly Leu Phe Gly Met Ala Pro Arg

705 710 715 720

Glu Ala Leu Ala Thr Asp Pro Gln Gln Arg Leu Leu Leu Glu Thr Thr

725 730 735

Trp Glu Leu Ala Glu Arg Gly Gly Ile Ala Pro Leu Ser Leu Lys Gly

740 745 750

Thr Gln Thr Gly Cys Phe Ile Gly Thr Leu Tyr Asp Asp Tyr Glu Ala

755 760 765

Asn Gly Phe Gly Asn Ala Glu Leu Glu Ala His Leu Gly Leu Gly Ser

770 775 780

Ser Gly Ser Val Met Ser Gly Arg Ile Ser Tyr Tyr Phe Gly Leu His

785 790 795 800

Gly Pro Ser Ile Val Ile Ser Thr Gly Cys Ser Ser Ser Leu Cys Ala

805 810 815

Val His Ser Ala Ala Gln Ala Leu Arg Asn Glu Glu Cys Thr Leu Ala

820 825 830

Ile Ala Gly Gly Ile Thr Cys Met Ala Ser Pro Arg Pro Phe Thr Met

835 840 845

Phe Ser Lys Arg Arg Gly Leu Ser Ala Asp Gly Arg Cys Arg Thr Tyr

850 855 860

Ser Ser Asp Ala Ala Gly Thr Gly Trp Ser Glu Gly Val Gly Leu Ile

865 870 875 880

Met Leu Glu Lys Leu Ser Asp Ala Gln Arg Asn Gly His Arg Val Leu

885 890 895

Gly Val Ile Arg Gly Ser Ala Val Asn Ser Asp Gly Thr Ser Asn Gly

900 905 910

Leu Thr Ala Pro Ser Gly Pro Ala Gln Gln Met Cys Ile Gln Ser Ala

915 920 925

Leu Ser Gln Ala Ala Leu Ser Pro Thr Asp Ile Asp Val Leu Glu Gly

930 935 940

His Gly Thr Ala Thr Pro Leu Gly Asp Pro Ile Glu Val Gln Ala Val

945 950 955 960

Ile Asn Thr Tyr Gly Asn Gly Ser Gly Asn Asp Pro Arg Ala Asn Pro

965 970 975

Leu Leu Ile Gly Ser Ile Lys Ser Asn Ile Gly His Thr Gln Ala Ala

980 985 990

Ala Ala Val Ala Gly Ile Ile Lys Met Val Lys Ser Ile His His Gly

995 1000 1005

Val Ala Pro Ala Ser Leu His Ile Arg Glu Pro Ser Arg His Ile Asp

1010 1015 1020

Trp Asp Gly Cys Gly Val Glu Pro Leu Ser Lys Ala Lys Gln Trp Pro

1025 1030 1035 1040

Ser Val Asp Arg Ala Arg Arg Ala Ala Val Ser Ser Phe Gly Ile Gly

1045 1050 1055

Gly Thr Asn Ala His Ile Ile Leu Glu Gln Pro Asp Ser Ile Glu Gln

1060 1065 1070

Asn Gly Val Ser Thr Pro Lys Asn His Thr Ile Ala Phe Pro Trp Ile

1075 1080 1085

Ile Ser Gly Ala Asp Glu Asn Ala Leu Arg Ala Gln Ala Gln Ser Leu

1090 1095 1100

Leu Ala Ala Trp Arg Lys Ser Leu Ser His Glu Ser Pro Ser Asp Ile

1105 1110 1115 1120

Ala Phe Ser Leu Ala Thr Ala Arg Ser Ser Leu Lys Tyr Arg Ala Val

1125 1130 1135

Val Thr Tyr Thr Ala Gly Gly Asp Leu Asn Asp Gln Ile Glu Thr Ala

1140 1145 1150

Leu Thr Ala Leu Ala Glu Asp Glu Ser His Pro Asp Val Val Thr Gly

1155 1160 1165

His Thr Asn Thr Thr Gly Asn Lys Pro Arg Leu Ala Cys Leu Phe Ser

1170 1175 1180

Gly Gln Gly Ser Arg Met Pro Asp Pro Ser Ala Ile Glu Glu Leu Ser

1185 1190 1195 1200

Thr Val Phe Pro Ile Phe Ser Arg Ala Phe Lys Glu Ala Cys Glu Glu

1205 1210 1215

Val Asn Gln Tyr Leu Glu Cys Pro Leu Glu Arg Ala Leu Ser Asp Ser

1220 1225 1230

Ser Leu Leu Asp Arg Thr Asp Phe Ala Gln Pro Ala Leu Phe Val Phe

1235 1240 1245

Glu Val Ala Met Tyr Arg Leu Leu Glu Ser Phe Asp Val Ile Pro Asp

1250 1255 1260

Val Val Ser Gly His Ser Leu Gly Glu Ile Ala Ala Ala His Ile Ser

1265 1270 1275 1280

Gly Ala Leu Thr Leu Arg Asp Ala Ala Ile Ile Val Thr Thr Arg Ser

1285 1290 1295

Arg Leu Met Ala Ala Leu Asp Ala Asn Gly Gly Met Val Ser Ile Ala

1300 1305 1310

Ala Pro Glu Gln Glu Val Ala Glu Glu Leu Ser Arg Leu Gly Ser Thr

1315 1320 1325

Ala Ile Ile Ala Val Val Asn Ser Glu Lys Ser Val Val Val Ser Gly

1330 1335 1340

Thr Arg Glu Ala Ile Thr Ala Val Ala Asp Arg Phe Thr Glu Leu Gly

1345 1350 1355 1360

Arg Arg Thr Thr Ile Leu Arg Asn Val Asn His Gly Phe His Ser Pro

1365 1370 1375

Met Met Asn Gly Ile Leu Gly Asp Leu Glu Glu Ala Leu Ala Ser Ser

1380 1385 1390

Ile Gly Ser Gly Thr Ser Ser Lys Ile Pro Leu Val Ser Thr Val Thr

1395 1400 1405

Gly Lys Leu Ala Glu Ala Ala Gln Leu Thr Ser Pro Gln Tyr Trp Thr

1410 1415 1420

Arg His Val Ser Glu Pro Val Arg Phe Ala Asp Ser Val Asn Glu Leu

1425 1430 1435 1440

Arg Ser Asn Glu Arg Val Ser Val Phe Ile Glu Val Gly Pro Ser Ala

1445 1450 1455

Val Leu Ser Pro His Val Pro Gly Thr Val Ala Thr Tyr Gly Thr Val

1460 1465 1470

Gly Lys Leu Leu Asn Thr Leu Gly Gln Ile Trp Ala Arg Gly Val Pro

1475 1480 1485

Val Asn Trp Gln Ala Val Phe Gly Gly Val Gly Ala His Leu Val Asp

1490 1495 1500

Leu Pro Val Tyr Ala Phe Gln Arg Arg Lys Tyr Trp Leu Pro Tyr Arg

1505 1510 1515 1520

Thr Leu Leu Pro Ala Glu Ser Val Gly Ala Ser Gly Ala Ser Ser Pro

1525 1530 1535

Gly Arg Thr Ser Asp Ile Gly Thr Ser Thr Leu Asn His Gly Val Leu

1540 1545 1550

Tyr Arg Thr Thr Ser Ile Ala Gly Thr Asn Asp Ile Ile Cys Ala Gly

1555 1560 1565

Phe Val Ser Ala Ser Lys Gln Pro Trp Leu Arg Asp His Ile Ile Ser

1570 1575 1580

Gly Gln Ser Leu Val Pro Ala Thr Ala Phe Ala Glu Leu Ala Leu Arg

1585 1590 1595 1600

Ala Gly Arg Glu Cys Ala Asp Pro Ser Gly Ser Glu Gln Val Ile Leu

1605 1610 1615

Asp Glu Leu Ile Ile Leu Ala Pro Leu Ala Leu Ser Leu Glu Glu Asp

1620 1625 1630

Asp Glu Glu Gln Glu Phe Glu Val Gln Val Val Ile Lys Glu Leu Glu

1635 1640 1645

Asp Glu Glu Ser Thr Ile Arg Arg Ser Ile Asp Val Tyr Ser Arg Leu

1650 1655 1660

His Ala Val Ser Thr Gln Pro Asp Trp Val Gln His Ala Thr Gly Thr

1665 1670 1675 1680

Leu Lys Leu Ile Ser Leu Pro Pro Pro Glu Lys Asp Val Phe Thr Asn

1685 1690 1695

Gly Thr His Asp Val Glu Asn Ser Glu Val Asp Val Ser Lys Ala Tyr

1700 1705 1710

Ala Met Leu Glu Asp Phe Gly Ile Ser Tyr Gly Pro Ala Phe Gln Gly

1715 1720 1725

Val Arg Gly Gly Trp Arg Gln His Asp Asn Glu Leu Leu Val Gln Ile

1730 1735 1740

Asn Pro Pro Gln Asp Gln Asp Ser Lys Ala Gly Phe Val Leu His Pro

1745 1750 1755 1760

Ala Leu Leu Asp Ala Ala Leu His Ala Pro Ile Leu Ala Ala Pro Glu

1765 1770 1775

Lys Val Ser Ser Gly Gln Ile Arg Leu Pro Phe Ser Phe Lys Gly Ile

1780 1785 1790

Gln Val Phe Glu Ala Ala Thr Ser Thr Ser Gly Pro Val Leu Ala Arg

1795 1800 1805

Ile Arg Asp Leu Asp Asp Glu Arg Phe Ser Val Thr Ile Thr Asn Lys

1810 1815 1820

Ala Thr Gly Ala Ala Val Ala Glu Ile Ser Glu Val Met Leu Arg Ala

1825 1830 1835 1840

Val Gln Pro Pro Val Val Glu Gly Asp Leu Tyr Arg Leu Lys Trp Thr

1845 1850 1855

Glu Leu Lys Ala Ala Gln Thr Thr Lys Pro Asn Leu Val Asp Asp Ile

1860 1865 1870

Phe Thr Val Gln Ala Pro Arg Asn Val Asp Ala Ala Asp Ile Pro Lys

1875 1880 1885

Ala Val His Asn Ala Val Ser Glu Ala Leu Arg Ala Ile Gln Gln Trp

1890 1895 1900

Arg Thr Lys Lys Ala Asn Ser Ser Asp Lys Ile Arg Leu Ile Phe Val

1905 1910 1915 1920

Thr Glu Gln Ala Ser Leu His Pro Asp Val Asn Val Ile Asp Ala Ala

1925 1930 1935

Val Trp Gly Phe Val Arg Ser Ala Gln Thr Glu Phe Gly Gly Glu Asn

1940 1945 1950

Ile Ile Leu Ile Asp Leu Asp Gly Ser Ala Glu Ser Gln Glu Ala Leu

1955 1960 1965

Pro Ser Ala Phe Asp Cys Gly Gln Glu Val Val Ala Leu Gln Asp Gly

1970 1975 1980

Lys Ile Met Val Pro Thr Leu Ser Lys Glu Pro Pro Val Pro Ser Thr

1985 1990 1995 2000

Ser Thr Thr Leu Asp Val Ser Gly Thr Val Leu Ile Thr Gly Gly Thr

2005 2010 2015

Gly Gly Leu Gly Ala Ile Leu Ser Arg His Leu Val Gln Thr Cys Gly

2020 2025 2030

Ala Arg Asn Leu Leu Leu Thr Ser Arg Ser Gly Ile Lys Ala Ala Gly

2035 2040 2045

Ala Thr Glu Leu Leu Asp Glu Leu Ser Ala Gln Asp Ala Thr Val Val

2050 2055 2060

Arg Ile Glu Ser Cys Asp Ile Ser Asp Arg Ala Gln Leu Ala Thr Leu

2065 2070 2075 2080

Leu Glu Gly Asn His Gly His Pro Pro Ile Thr Ala Ile Ile His Cys

2085 2090 2095

Ala Gly Val Val Asp Asp Gly Val Leu Thr Ser Leu Thr Pro Glu Arg

2100 2105 2110

Ile Ser Arg Val Leu Gln Ala Lys Val Asp Ala Ala Trp Asn Leu His

2115 2120 2125

Gln Leu Ala Pro Glu Thr Thr Arg Thr Phe Val Leu Tyr Ser Ser Phe

2130 2135 2140

Val Gly Ile Val Gly Asn Glu Gly Gln Ala Ala Tyr Thr Ala Gly Asn

2145 2150 2155 2160

Ala Phe Leu Asn Ala Leu Ala Arg Met Arg Val Ala Gln Gly Leu Pro

2165 2170 2175

Ala Val Ser Leu Ala Trp Gly Pro Trp Ala Asn Asp Val Gly Met Ala

2180 2185 2190

Ala Gly Asp Lys Leu Val Ile Pro Asn Leu Arg Ile Ala Ser Ala Gln

2195 2200 2205

Pro Val Val Asp Gln Gln Gly Leu His Leu Phe Asp Arg Ala Leu Gln

2210 2215 2220

Thr Ser Glu Pro Val Leu Val Pro Leu Leu Leu Arg Gly Pro Phe Pro

2225 2230 2235 2240

Met Val Pro Ser Ala Ala Ala Val Thr Lys Ser Lys Lys Ala Thr Ala

2245 2250 2255

Lys Gly Lys Ala Lys Thr Gly Ala Ala Trp Arg Lys Lys Leu Ala Ala

2260 2265 2270

Val Ser Pro Glu Ser Arg Ser Asp Thr Leu Leu Gly Leu Val Arg Asp

2275 2280 2285

Glu Ile Ala Ala Val Leu Gly Tyr Gln Gly Gln Glu Leu Pro Asp Gly

2290 2295 2300

Pro Leu Ser Asp Leu Gly Phe Asp Ser Phe Thr Ser Val Thr Val Ser

2305 2310 2315 2320

Asn Arg Met Arg Val Leu Thr Gly Phe Arg Asp Leu Pro Val Thr Leu

2325 2330 2335

Ala Leu Asp Tyr Asp Thr Pro Gln Ala Leu Val Gln Tyr Leu Leu Asp

2340 2345 2350

Arg Ile Asn Ala Glu Pro Glu Thr Glu Ile Glu Leu Asp Gln Asp Val

2355 2360 2365

Ala Glu Glu Glu Thr Val Ser Gly Thr Asn Gly His Gln Asn Gly His

2370 2375 2380

Gln Asn Gly Thr Gln Asn Gly His Ser Asn Gly His Ala Asn Gly Ala

2385 2390 2395 2400

Ser Thr Asn Gly Asp Ala Thr Asp Gly Ile Asp Pro Glu Glu Phe Arg

2405 2410 2415

Gly Leu Ser Thr Leu His Arg Arg Leu Cys Arg Leu Glu Gln Tyr Thr

2420 2425 2430

Ala Ala Ala Asp Leu Leu Ala Ser Ala Ala Leu Ala Met Pro Thr Phe

2435 2440 2445

Pro Ser Asn Gly Arg Lys Leu Leu Asp Tyr Val Ala Asp Pro His Arg

2450 2455 2460

Leu Ala Thr Gly Pro Glu Val Ser Pro Gly Asn Asp Ala Pro Leu Pro

2465 2470 2475 2480

Val Val Phe Ile Ala Pro Phe Phe Pro Arg Ile Lys Ile Gly Gly Ile

2485 2490 2495

Ser Leu Ser Val Tyr Ser Ala Val Ala Ala Ser Leu Asn Gly Lys Arg

2500 2505 2510

Asp Val Phe Glu Leu Pro His Pro Glu Gly Gln Tyr Val Pro Glu Asp

2515 2520 2525

Leu Asp Thr Leu Ala Glu Leu His Val Ser Thr Ile Glu Gln Gln Phe

2530 2535 2540

Gly Asp Arg Pro Gly Ile Ile Leu Ala Gly Tyr Ser Ala Gly Gly Thr

2545 2550 2555 2560

Val Ala Tyr Ala Val Ala Ser Lys Leu Ala Gln Ala Gly Lys His Pro

2565 2570 2575

Arg Leu Ala Gly Phe Val Leu Val Asp Thr Tyr Leu Thr Met Thr Gly

2580 2585 2590

Arg Gly Asp Pro Asp Trp Leu Asn Ala Leu Pro Ala Glu Ala Leu Val

2595 2600 2605

Ser Arg Leu Gly Gly Pro Asp Ser Thr Gly Glu Ser Leu Val Gly Asp

2610 2615 2620

Leu Asp Leu Ala Leu Ala Lys Val Gly Gly Tyr Phe Arg Thr Leu Arg

2625 2630 2635 2640

Asp Trp Asp Gln Glu Leu Tyr Pro Leu Pro Asp Ala Leu Ser Thr Leu

2645 2650 2655

Phe Val Arg Ala Leu Asp Pro Ser Glu Lys Met Pro Lys Asn Ala Asp

2660 2665 2670

Ile Trp Arg Pro Arg Trp Gln Arg Ala Asn His Thr Val Glu Val Pro

2675 2680 2685

Gly Ser His Leu Ala Leu Leu Asp Lys Arg Tyr Ala Pro Ala Ile Ala

2690 2695 2700

Val Glu Ile Glu His Trp Ala Lys Glu Gln Leu Gly Val

2705 2710 2715

<210> 2

<211> 8604

<212> DNA

<213> Ficus carica (Pestalopsis ficus)

<400> 2

atgtctcaac caacttcggt tcccaagctg ctcctccacc atgcggtgga aagccgggac 60

aaggtggcct tcttgggccc aggctggtcc attgtatgtc tttccgaagc gtgtcccttt 120

tgctgagatg tttctcgtag tcgtttgaca tgactgactc catattctcc ttgtagacct 180

acagtgacct tgaaaagcga acgcggcttg tggcagctca tctggcgcgg gccggtatag 240

gacgaggaga tttcgtagcc attgtgctag ggagatgctt ggaggcggtg gagtctgtgt 300

tggcaatcat gagagccggc gccgtgagcg ttcccctaga tccgcgttca ccaccagcag 360

acctggccag ggttttggag cacagcggag cccgcgcaat cataactgat gatcggcact 420

tggctacggt gtccgccgca gccgtcaaag gatccttgat tatcataagc actacgaatg 480

ctcaggtgga tgtcatagaa agcctcaaga cggagcggta ccaagactgg gttgaagatg 540

atggatactc gacgtcggat gtccacctgg acagcctagg cgatgaggag gaggcctttc 600

tgcactacac ttctggaaca accagcctac ccaagggagt cttgtcgagt caaaagagcg 660

cactgtggaa cgttgaaaag gtcacttcag tgtttgagtt ttcctctgag gaccgcttct 720

tctggccact ccccttgttt cacattctcg gccactcctt atgtatactg gccaccgtgg 780

ccaagggtgc cagcgcctat ctttcggacc ctgaccagtt gctgttggat aacctcttgg 840

tcaaggatgt tgaagacacg accttcattg caggtgcccc ggccacgttt cacgagcttg 900

tcgaagccaa ggcggcatcg tcgtcgactc tgagtttgcc caaattgagg gcatgtatga 960

gcgcaggtgc tgcggcatct gtttctctgt gtgatcaggt ccatgagctg ttcggagtgt 1020

cgcttctcaa caactacgga tgcacagaga cttgcggcgc cattgccatt agccggcctg 1080

gccatgtcta tcggcaacat gggagtgtta ccccactccc cgactgggag attcagctga 1140

tggatcaaga tgggaagcaa gtccgcgaag gcgagcaagg cgagctctgg gtgcgcggtc 1200

ccggcctgat gctgggttac tacaaagaaa ctcagtcgcc attcactgaa gatgcttggt 1260

ttcccactgg tgatacagga attctcacca cttcggatgt cggaaaagag ctcagcctcg 1320

tgggtcggaa aaaggagttg atcatccggg gaggagaaaa catacagcca gctgagttgg 1380

aacaagtctt gctccagcac cctggcgtgg cagacgttgc tgtttctggc attctacacg 1440

gattgcttgg cgagacgcct gccgcgttca ttgtcaagga gactccagac cttgaccttg 1500

acctttcctc cctgatcgcc acgtgcagag aagctttgcc agactacaag gtgcctacag 1560

gtaagtgacg ggcgccgttt ctttcactga tctagattta ttgctgactc aatcctcgac 1620

agcattttac gaaatcgacg ctgtgcctcg gaccctttta ggcaagccca agcggttggc 1680

cgtagcgtct tacacgagca aaccactcac ggttcgctcc aggttacaaa caagagccgc 1740

cgtcgaggca ttggttcttg cagaaacggc cggggcctgc ggtgtgcaag ccgagcccgg 1800

ggagaaggaa tcggacccgg attggcttcg caaatacgcc gacgagtcct tttcccatct 1860

cggcctgacc tccatggccg gtgtcgtcct gcgagaccga ctggccaacc tcaccggctt 1920

ggttgatctg cccaacaccc tcgtctttga ctactctact ccagcggctg tgcgcgacta 1980

cctattcaac aggctcaggg agcaggaatc gccgctccca tccaagtcag cacctgcact 2040

gagcttgccc agcaaggctg agcccattgc cattatctca atggcctgta gatatcctgg 2100

aggaatctct tcgccagagg acttgtggca actcgtttcc gacgagatag acgcaactac 2160

tgactttccg agtgatcgtg gctgggatat cgatagtctg tatagtaccg acccgacgga 2220

acctttcacc tcgaccacga agcgcggcgg tttcctgccc gactttgccg actttgatgc 2280

cggtctattt ggcatggcac ctcgagaagc cctggctacg gatccccagc aacgtttact 2340

actggaaacg acgtgggaac tagccgaacg aggaggcatt gccccgttgt cgctcaaagg 2400

cacccagact ggttgcttca ttggcacgct gtatgatgat tacgaagcaa acggctttgg 2460

caacgctggt aacgtaccct ccttcgtaca aaggtatgaa gaatgaatat ctactgacga 2520

aaaacttctc cttttgacag aattggaagc tcatcttggt cttggatcct ccggcagtgt 2580

catgtccggt cgcatttcct actactttgt gagtgctttc caatcgcata tttcattgca 2640

ggaaaatctc ctagacgctt tgcggcacga ttgaattcaa tagactgatt aatccctttt 2700

ggcagggtct ccacggtccg tcaatagtca tatcaaccgg ttgttcgtcc tcgctctgcg 2760

ccgtccattc agcagcccaa gctctcagga acgaagagtg cacactcgcc attgcaggtg 2820

gaatcacgtg catggcttcg cccaggccat tcaccatgtt tagcaagcga cgaggtctct 2880

cggccgatgg gcgatgccga acgtactcga gcgacgccgc cggcaccggt tggtccgagg 2940

gcgtaggtct catcatgctc gaaaagctct cagacgccca gcgcaacgga catcgcgtac 3000

tgggcgtgat tcggggctcc gccgtcaact cggacggcac gtccaacggt ctgacggccc 3060

cgagcggacc tgcgcagcaa atgtgtatcc agagcgcgct gtcccaagcg gcgctgtcgc 3120

ctaccgacat tgatgttctc gaaggtcacg ggactgccac gcccttgggt gatcccatcg 3180

aggtacaggc cgtgatcaac acctacggca atgggtctgg caatgatccc cgcgcgaatc 3240

cattgctgat tggttcaatc aagtccaata ttggccacac ccaggccgca gccgccgtgg 3300

ctggaatcat caagatggtc aagtccattc atcatggtgt tgccccagca tccttgcaca 3360

tccgcgaacc ttcacgacac attgattggg atgggtgtgg tgttgagcca cttagcaagg 3420

ccaagcagtg gccatctgtg gacagggcga gacgtgcagc cgtgtcatca ttgtaagttc 3480

tcaagataat gattcgatta ctggtgaaat agagctgacg gttttgaatt agtggtattg 3540

gaggcacaaa cgcagtatgt gccttctcac aacctccctt aattcaaacc tttaaagatt 3600

gaaaaagtta ctgactcgtg ggaataacag cacatcattt tggaacagcc tgattctatt 3660

gaacagaatg gcgtctcgac gccaaagaat cacacaattg cttttccatg gatcatttct 3720

ggcgccgacg aaaatgctct gcgcgcgcaa gcccagtcac ttctggcggc ctggcgcaag 3780

tccctcagtc atgagagccc gtccgacatt gcattctccc ttgcaaccgc gagatcttct 3840

ctcaaatata gggccgtggt gacgtacacc gccggaggcg acttgaacga tcagattgaa 3900

acggcactta cggctctcgc tgaagatgaa tcccatcccg acgtcgtgac aggacacacc 3960

aacaccactg gcaacaagcc gcgtctggct tgtctattct cgggacaggg tagtcggatg 4020

cccgatccca gcgccatcga ggagctttct accgttttcc ccatcttctc ccgcgcattc 4080

aaggaggcct gcgaggaagt caatcagtac ctcgaatgtc cgcttgaacg tgctttgagt 4140

gacagtagcc tcctggaccg aactgacttt gcgcagcccg ccttgtttgt ctttgaggtg 4200

gcaatgtacc gcctgctcga gtccttcgat gtgattcccg acgtggtgtc tggacattct 4260

ctaggagaaa tcgcagcagc tcacatttct ggagctctga ctctccgcga cgctgccatc 4320

atcgttacca cccgttccag attaatggct gctctagatg ccaatggcgg catggtgagc 4380

attgcggctc ctgagcaaga agtcgccgaa gagctgtcac gcctgggcag cacggcaatc 4440

attgcagttg tcaactctga aaaatcggtt gtggtatccg gtactcgaga ggccataacc 4500

gctgttgcag acagatttac agagctagga cgaagaacga ctattctgcg caatgtcaac 4560

cacggcttcc actcgccaat gatgaacggt attctgggag accttgaaga agctctggcg 4620

tcgtccattg gaagtggaac atcctccaag attccgctcg tgtccaccgt cacgggcaag 4680

ctcgccgaag cggcccagct gacctctccc caatactgga cacgccacgt cagcgagcca 4740

gttcgcttcg cagactccgt caacgagctt cgctcaaacg aacgtgtctc ggtgtttatt 4800

gaagtcggtc cctctgcagt cctctctccc catgtcccgg gtactgtcgc cacatatggc 4860

acagtcggca agctactgaa cacgctgggt caaatctggg cgcgcggcgt gcccgtcaac 4920

tggcaggccg tattcggtgg cgtaggtgcg catctcgtcg acttgcccgt ctatgccttc 4980

cagaggcgca agtattggct accatataga accctgttgc cagcagaatc tgtgggggcg 5040

tctggcgcct cctcaccggg tcgcacttca gacattggta cttctacatt gaaccatgga 5100

gtgctctacc ggactacatc cattgcgggg acaaacgaca tcatctgtgc cggtttcgtc 5160

tccgcaagca agcagccctg gctgcgcgac catattatta gtggtcagag ccttgttcct 5220

gccacagcct ttgccgagct ggctttgcgg gctggtcgcg aatgtgccga tccctctgga 5280

tctgagcagg tgattctcga tgagctcatc attctcgcac ccctagcctt gtctctagag 5340

gaagatgacg aggaacaaga atttgaggta caagtcgtga tcaaggagtt ggaagacgaa 5400

gagagcacta tccgacgaag cattgacgtt tattcacgtc ttcatgctgt ctcaacccaa 5460

cccgactggg tacagcatgc cacgggtacc ctgaagttga tttcgttgcc accacccgaa 5520

aaggatgtat ttaccaatgg cacacacgac gtagagaact ccgaggtgga tgtttccaaa 5580

gcatatgcca tgctagaaga ctttggcatc agctatggac cagccttcca aggcgtccgc 5640

ggtggttggc gtcagcacga caacgagctc ttggtacaga tcaacccgcc tcaggaccag 5700

gactccaagg cgggcttcgt cctccaccca gcccttctcg atgctgcttt gcacgctccc 5760

atcctcgcag cacctgaaaa ggtttctagt ggccagattc gactgccatt ctccttcaag 5820

ggcatacaag tctttgaggc tgccaccagc acctctgggc cagttttggc ccgcattcgc 5880

gatttggatg atgagcgctt ttccgtgacc atcacgaaca aggcaacagg cgcagcagtg 5940

gcagagattt ctgaagtcat gctgcgcgca gtccagcctc ccgttgtcga aggagattta 6000

taccgactca agtggaccga gttgaaggca gctcagacaa caaagccaaa ccttgtcgat 6060

gacatcttca ccgttcaagc tccccgcaac gtagatgccg ccgatattcc caaggctgtt 6120

cataatgccg tctcggaagc actccgtgct atacaacagt ggaggaccaa aaaggcgaat 6180

tcttccgaca aaattcgtct catctttgtc actgaacagg cgtcgctgca ccctgacgtc 6240

aatgttatcg atgccgccgt ctggggcttt gtgcggtctg cgcagacaga gtttggtggg 6300

gagaatatca ttctgataga tctcgacggg tcggcagagt cacaggaggc tcttccatcc 6360

gcctttgatt gtggacaaga agttgttgct ctgcaagatg gcaagatcat ggttcccacg 6420

ctcagcaaag aacccccggt tccaagcacc tcgacaactc tcgatgtcag tggtacagtt 6480

ctaatcaccg gaggtacagg aggtctgggt gccatactca gtagacacct tgtgcaaacc 6540

tgcggggcaa gaaatctgct tttgacaagt aggtcgggca tcaaggctgc cggagcgact 6600

gagttgcttg acgagctaag cgctcaagac gcaacggttg tgcgtatcga gtcgtgcgat 6660

attagtgatc gcgctcagtt ggccacgcta cttgaaggca atcacggaca tccacccata 6720

actgccatca tccactgcgc cggcgtggtg gatgatggag tcttgacctc gctaactcca 6780

gaacggattt cccgtgtctt gcaagcaaag gttgatgctg cttggaatct gcaccagctg 6840

gcgccagaga caacacgtac ttttgtcctc tactcatcct ttgtcggcat tgttggaaac 6900

gaaggccaag ccgcatacac ggcgggcaat gccttcctca atgctttggc ccgcatgcgc 6960

gttgctcagg gactccccgc agtgtcgctg gcttggggcc cttgggccaa tgatgtcggc 7020

atggctgccg gggataaatt ggtgattccc aatcttcgca tcgccagcgc tcaaccggtc 7080

gtggatcagc aaggactgca tctgtttgac cgcgcactac agacttcaga gcctgttctt 7140

gtgccactat tgctacgcgg acccttcccc atggtgccat ccgccgctgc ggtgaccaag 7200

tccaagaagg ctaccgccaa gggcaaggca aagacgggcg ctgcatggcg caagaagctt 7260

gcagcagtct ctccagagag tcgctccgat actcttctgg gtctggtgcg agacgaaatt 7320

gccgcggtgc ttggatatca gggccaggag ctgccagacg ggccactgtc cgaccttggt 7380

ttcgactcgt ttacctcggt cacggtcagc aacaggatga gagtgctgac gggtttccgt 7440

gaccttccag tgaccctggc actcgactac gatacacctc aggcactggt gcagtacctg 7500

ctggatcgaa tcaatgctga accagaaacc gaaatcgagt tggaccaaga cgttgccgag 7560

gaagagacag tttctggaac aaacggtcac cagaatggcc atcaaaatgg cacccagaat 7620

ggccattcca acggacatgc caacggcgcg tccaccaatg gcgatgctac tgatggcatt 7680

gaccccgaag agttccgagg gctttccaca cttcaccggc gcctctgccg actcgagcag 7740

tacactgccg cggcagacct gctggcctct gccgcactgg caatgccaac attccccagc 7800

aatggccgca aactgttgga ttatgtggcg gatcctcatc gcctggcgac tggtcccgaa 7860

gtctcgcctg gcaacgacgc gcccctgccc gtagtcttta ttgccccctt cttcccacgc 7920

atcaagattg gaggaatctc gctcagtgtg tacagtgctg tagcagcttc tctgaatgga 7980

aagagggacg tgtttgagct cccacacccc gagggacaat atgttcccga ggaccttgac 8040

acactggccg agctacatgt cagtaccatc gagcaacagt ttggcgatag gccaggcatc 8100

attttggcag gttactctgc cggcggcacg gtcgcgtacg ccgtggcctc caagctggcc 8160

caggccggca aacacccccg tctggcgggc tttgtcttgg tagacacata cctgaccatg 8220

acgggacggg gcgatccaga ctggctcaac gccttgccgg ccgaggcgct cgtgtcgcgt 8280

ctcggaggac cggacagcac aggggagagt ctggtgggag atttggatct ggcattggcc 8340

aaggtgggcg ggtactttag aactctgcga gactgggacc aagagcttta tcccctaccc 8400

gatgcactgt cgactctctt tgtgcgagct ctagatccgt cggagaagat gcccaagaac 8460

gcggatatat ggcgtccaag atggcaacgg gcgaatcaca cggttgaggt gcctggaagt 8520

catttggccc ttcttgacaa gcgctatgct ccggcaattg ctgttgaaat tgaacattgg 8580

gcaaaggagc agttgggggt ttga 8604

<210> 3

<211> 8154

<212> DNA

<213> Ficus carica (Pestalopsis ficus)

<400> 3

atgtctcaac caacttcggt tcccaagctg ctcctccacc atgcggtgga aagccgggac 60

aaggtggcct tcttgggccc aggctggtcc attacctaca gtgaccttga aaagcgaacg 120

cggcttgtgg cagctcatct ggcgcgggcc ggtataggac gaggagattt cgtagccatt 180

gtgctaggga gatgcttgga ggcggtggag tctgtgttgg caatcatgag agccggcgcc 240

gtgagcgttc ccctagatcc gcgttcacca ccagcagacc tggccagggt tttggagcac 300

agcggagccc gcgcaatcat aactgatgat cggcacttgg ctacggtgtc cgccgcagcc 360

gtcaaaggat ccttgattat cataagcact acgaatgctc aggtggatgt catagaaagc 420

ctcaagacgg agcggtacca agactgggtt gaagatgatg gatactcgac gtcggatgtc 480

cacctggaca gcctaggcga tgaggaggag gcctttctgc actacacttc tggaacaacc 540

agcctaccca agggagtctt gtcgagtcaa aagagcgcac tgtggaacgt tgaaaaggtc 600

acttcagtgt ttgagttttc ctctgaggac cgcttcttct ggccactccc cttgtttcac 660

attctcggcc actccttatg tatactggcc accgtggcca agggtgccag cgcctatctt 720

tcggaccctg accagttgct gttggataac ctcttggtca aggatgttga agacacgacc 780

ttcattgcag gtgccccggc cacgtttcac gagcttgtcg aagccaaggc ggcatcgtcg 840

tcgactctga gtttgcccaa attgagggca tgtatgagcg caggtgctgc ggcatctgtt 900

tctctgtgtg atcaggtcca tgagctgttc ggagtgtcgc ttctcaacaa ctacggatgc 960

acagagactt gcggcgccat tgccattagc cggcctggcc atgtctatcg gcaacatggg 1020

agtgttaccc cactccccga ctgggagatt cagctgatgg atcaagatgg gaagcaagtc 1080

cgcgaaggcg agcaaggcga gctctgggtg cgcggtcccg gcctgatgct gggttactac 1140

aaagaaactc agtcgccatt cactgaagat gcttggtttc ccactggtga tacaggaatt 1200

ctcaccactt cggatgtcgg aaaagagctc agcctcgtgg gtcggaaaaa ggagttgatc 1260

atccggggag gagaaaacat acagccagct gagttggaac aagtcttgct ccagcaccct 1320

ggcgtggcag acgttgctgt ttctggcatt ctacacggat tgcttggcga gacgcctgcc 1380

gcgttcattg tcaaggagac tccagacctt gaccttgacc tttcctccct gatcgccacg 1440

tgcagagaag ctttgccaga ctacaaggtg cctacagcat tttacgaaat cgacgctgtg 1500

cctcggaccc ttttaggcaa gcccaagcgg ttggccgtag cgtcttacac gagcaaacca 1560

ctcacggttc gctccaggtt acaaacaaga gccgccgtcg aggcattggt tcttgcagaa 1620

acggccgggg cctgcggtgt gcaagccgag cccggggaga aggaatcgga cccggattgg 1680

cttcgcaaat acgccgacga gtccttttcc catctcggcc tgacctccat ggccggtgtc 1740

gtcctgcgag accgactggc caacctcacc ggcttggttg atctgcccaa caccctcgtc 1800

tttgactact ctactccagc ggctgtgcgc gactacctat tcaacaggct cagggagcag 1860

gaatcgccgc tcccatccaa gtcagcacct gcactgagct tgcccagcaa ggctgagccc 1920

attgccatta tctcaatggc ctgtagatat cctggaggaa tctcttcgcc agaggacttg 1980

tggcaactcg tttccgacga gatagacgca actactgact ttccgagtga tcgtggctgg 2040

gatatcgata gtctgtatag taccgacccg acggaacctt tcacctcgac cacgaagcgc 2100

ggcggtttcc tgcccgactt tgccgacttt gatgccggtc tatttggcat ggcacctcga 2160

gaagccctgg ctacggatcc ccagcaacgt ttactactgg aaacgacgtg ggaactagcc 2220

gaacgaggag gcattgcccc gttgtcgctc aaaggcaccc agactggttg cttcattggc 2280

acgctgtatg atgattacga agcaaacggc tttggcaacg ctgaattgga agctcatctt 2340

ggtcttggat cctccggcag tgtcatgtcc ggtcgcattt cctactactt tggtctccac 2400

ggtccgtcaa tagtcatatc aaccggttgt tcgtcctcgc tctgcgccgt ccattcagca 2460

gcccaagctc tcaggaacga agagtgcaca ctcgccattg caggtggaat cacgtgcatg 2520

gcttcgccca ggccattcac catgtttagc aagcgacgag gtctctcggc cgatgggcga 2580

tgccgaacgt actcgagcga cgccgccggc accggttggt ccgagggcgt aggtctcatc 2640

atgctcgaaa agctctcaga cgcccagcgc aacggacatc gcgtactggg cgtgattcgg 2700

ggctccgccg tcaactcgga cggcacgtcc aacggtctga cggccccgag cggacctgcg 2760

cagcaaatgt gtatccagag cgcgctgtcc caagcggcgc tgtcgcctac cgacattgat 2820

gttctcgaag gtcacgggac tgccacgccc ttgggtgatc ccatcgaggt acaggccgtg 2880

atcaacacct acggcaatgg gtctggcaat gatccccgcg cgaatccatt gctgattggt 2940

tcaatcaagt ccaatattgg ccacacccag gccgcagccg ccgtggctgg aatcatcaag 3000

atggtcaagt ccattcatca tggtgttgcc ccagcatcct tgcacatccg cgaaccttca 3060

cgacacattg attgggatgg gtgtggtgtt gagccactta gcaaggccaa gcagtggcca 3120

tctgtggaca gggcgagacg tgcagccgtg tcatcatttg gtattggagg cacaaacgca 3180

cacatcattt tggaacagcc tgattctatt gaacagaatg gcgtctcgac gccaaagaat 3240

cacacaattg cttttccatg gatcatttct ggcgccgacg aaaatgctct gcgcgcgcaa 3300

gcccagtcac ttctggcggc ctggcgcaag tccctcagtc atgagagccc gtccgacatt 3360

gcattctccc ttgcaaccgc gagatcttct ctcaaatata gggccgtggt gacgtacacc 3420

gccggaggcg acttgaacga tcagattgaa acggcactta cggctctcgc tgaagatgaa 3480

tcccatcccg acgtcgtgac aggacacacc aacaccactg gcaacaagcc gcgtctggct 3540

tgtctattct cgggacaggg tagtcggatg cccgatccca gcgccatcga ggagctttct 3600

accgttttcc ccatcttctc ccgcgcattc aaggaggcct gcgaggaagt caatcagtac 3660

ctcgaatgtc cgcttgaacg tgctttgagt gacagtagcc tcctggaccg aactgacttt 3720

gcgcagcccg ccttgtttgt ctttgaggtg gcaatgtacc gcctgctcga gtccttcgat 3780

gtgattcccg acgtggtgtc tggacattct ctaggagaaa tcgcagcagc tcacatttct 3840

ggagctctga ctctccgcga cgctgccatc atcgttacca cccgttccag attaatggct 3900

gctctagatg ccaatggcgg catggtgagc attgcggctc ctgagcaaga agtcgccgaa 3960

gagctgtcac gcctgggcag cacggcaatc attgcagttg tcaactctga aaaatcggtt 4020

gtggtatccg gtactcgaga ggccataacc gctgttgcag acagatttac agagctagga 4080

cgaagaacga ctattctgcg caatgtcaac cacggcttcc actcgccaat gatgaacggt 4140

attctgggag accttgaaga agctctggcg tcgtccattg gaagtggaac atcctccaag 4200

attccgctcg tgtccaccgt cacgggcaag ctcgccgaag cggcccagct gacctctccc 4260

caatactgga cacgccacgt cagcgagcca gttcgcttcg cagactccgt caacgagctt 4320

cgctcaaacg aacgtgtctc ggtgtttatt gaagtcggtc cctctgcagt cctctctccc 4380

catgtcccgg gtactgtcgc cacatatggc acagtcggca agctactgaa cacgctgggt 4440

caaatctggg cgcgcggcgt gcccgtcaac tggcaggccg tattcggtgg cgtaggtgcg 4500

catctcgtcg acttgcccgt ctatgccttc cagaggcgca agtattggct accatataga 4560

accctgttgc cagcagaatc tgtgggggcg tctggcgcct cctcaccggg tcgcacttca 4620

gacattggta cttctacatt gaaccatgga gtgctctacc ggactacatc cattgcgggg 4680

acaaacgaca tcatctgtgc cggtttcgtc tccgcaagca agcagccctg gctgcgcgac 4740

catattatta gtggtcagag ccttgttcct gccacagcct ttgccgagct ggctttgcgg 4800

gctggtcgcg aatgtgccga tccctctgga tctgagcagg tgattctcga tgagctcatc 4860

attctcgcac ccctagcctt gtctctagag gaagatgacg aggaacaaga atttgaggta 4920

caagtcgtga tcaaggagtt ggaagacgaa gagagcacta tccgacgaag cattgacgtt 4980

tattcacgtc ttcatgctgt ctcaacccaa cccgactggg tacagcatgc cacgggtacc 5040

ctgaagttga tttcgttgcc accacccgaa aaggatgtat ttaccaatgg cacacacgac 5100

gtagagaact ccgaggtgga tgtttccaaa gcatatgcca tgctagaaga ctttggcatc 5160

agctatggac cagccttcca aggcgtccgc ggtggttggc gtcagcacga caacgagctc 5220

ttggtacaga tcaacccgcc tcaggaccag gactccaagg cgggcttcgt cctccaccca 5280

gcccttctcg atgctgcttt gcacgctccc atcctcgcag cacctgaaaa ggtttctagt 5340

ggccagattc gactgccatt ctccttcaag ggcatacaag tctttgaggc tgccaccagc 5400

acctctgggc cagttttggc ccgcattcgc gatttggatg atgagcgctt ttccgtgacc 5460

atcacgaaca aggcaacagg cgcagcagtg gcagagattt ctgaagtcat gctgcgcgca 5520

gtccagcctc ccgttgtcga aggagattta taccgactca agtggaccga gttgaaggca 5580

gctcagacaa caaagccaaa ccttgtcgat gacatcttca ccgttcaagc tccccgcaac 5640

gtagatgccg ccgatattcc caaggctgtt cataatgccg tctcggaagc actccgtgct 5700

atacaacagt ggaggaccaa aaaggcgaat tcttccgaca aaattcgtct catctttgtc 5760

actgaacagg cgtcgctgca ccctgacgtc aatgttatcg atgccgccgt ctggggcttt 5820

gtgcggtctg cgcagacaga gtttggtggg gagaatatca ttctgataga tctcgacggg 5880

tcggcagagt cacaggaggc tcttccatcc gcctttgatt gtggacaaga agttgttgct 5940

ctgcaagatg gcaagatcat ggttcccacg ctcagcaaag aacccccggt tccaagcacc 6000

tcgacaactc tcgatgtcag tggtacagtt ctaatcaccg gaggtacagg aggtctgggt 6060

gccatactca gtagacacct tgtgcaaacc tgcggggcaa gaaatctgct tttgacaagt 6120

aggtcgggca tcaaggctgc cggagcgact gagttgcttg acgagctaag cgctcaagac 6180

gcaacggttg tgcgtatcga gtcgtgcgat attagtgatc gcgctcagtt ggccacgcta 6240

cttgaaggca atcacggaca tccacccata actgccatca tccactgcgc cggcgtggtg 6300

gatgatggag tcttgacctc gctaactcca gaacggattt cccgtgtctt gcaagcaaag 6360

gttgatgctg cttggaatct gcaccagctg gcgccagaga caacacgtac ttttgtcctc 6420

tactcatcct ttgtcggcat tgttggaaac gaaggccaag ccgcatacac ggcgggcaat 6480

gccttcctca atgctttggc ccgcatgcgc gttgctcagg gactccccgc agtgtcgctg 6540

gcttggggcc cttgggccaa tgatgtcggc atggctgccg gggataaatt ggtgattccc 6600

aatcttcgca tcgccagcgc tcaaccggtc gtggatcagc aaggactgca tctgtttgac 6660

cgcgcactac agacttcaga gcctgttctt gtgccactat tgctacgcgg acccttcccc 6720

atggtgccat ccgccgctgc ggtgaccaag tccaagaagg ctaccgccaa gggcaaggca 6780

aagacgggcg ctgcatggcg caagaagctt gcagcagtct ctccagagag tcgctccgat 6840

actcttctgg gtctggtgcg agacgaaatt gccgcggtgc ttggatatca gggccaggag 6900

ctgccagacg ggccactgtc cgaccttggt ttcgactcgt ttacctcggt cacggtcagc 6960

aacaggatga gagtgctgac gggtttccgt gaccttccag tgaccctggc actcgactac 7020

gatacacctc aggcactggt gcagtacctg ctggatcgaa tcaatgctga accagaaacc 7080

gaaatcgagt tggaccaaga cgttgccgag gaagagacag tttctggaac aaacggtcac 7140

cagaatggcc atcaaaatgg cacccagaat ggccattcca acggacatgc caacggcgcg 7200

tccaccaatg gcgatgctac tgatggcatt gaccccgaag agttccgagg gctttccaca 7260

cttcaccggc gcctctgccg actcgagcag tacactgccg cggcagacct gctggcctct 7320

gccgcactgg caatgccaac attccccagc aatggccgca aactgttgga ttatgtggcg 7380

gatcctcatc gcctggcgac tggtcccgaa gtctcgcctg gcaacgacgc gcccctgccc 7440

gtagtcttta ttgccccctt cttcccacgc atcaagattg gaggaatctc gctcagtgtg 7500

tacagtgctg tagcagcttc tctgaatgga aagagggacg tgtttgagct cccacacccc 7560

gagggacaat atgttcccga ggaccttgac acactggccg agctacatgt cagtaccatc 7620

gagcaacagt ttggcgatag gccaggcatc attttggcag gttactctgc cggcggcacg 7680

gtcgcgtacg ccgtggcctc caagctggcc caggccggca aacacccccg tctggcgggc 7740

tttgtcttgg tagacacata cctgaccatg acgggacggg gcgatccaga ctggctcaac 7800

gccttgccgg ccgaggcgct cgtgtcgcgt ctcggaggac cggacagcac aggggagagt 7860

ctggtgggag atttggatct ggcattggcc aaggtgggcg ggtactttag aactctgcga 7920

gactgggacc aagagcttta tcccctaccc gatgcactgt cgactctctt tgtgcgagct 7980

ctagatccgt cggagaagat gcccaagaac gcggatatat ggcgtccaag atggcaacgg 8040

gcgaatcaca cggttgaggt gcctggaagt catttggccc ttcttgacaa gcgctatgct 8100

ccggcaattg ctgttgaaat tgaacattgg gcaaaggagc agttgggggt ttga 8154

Claims (3)

1. A recombinant bacterium comprising an expression vector linked to an NRPS-PKS hybrid protein gene;

the starting strain of the recombinant strain is Aspergillus nidulans LO8030, and the nucleotide sequence of the NRPS-PKS hybrid protein is shown as SEQ ID NO. 2; or (b)

The starting strain of the recombinant strain is Saccharomyces cerevisiae BJ5464, and the nucleotide sequence of the NRPS-PKS hybrid protein is shown as SEQ ID NO. 3.

2. The preparation method of naringenin chalcone is characterized by comprising the following steps: fermenting the recombinant Aspergillus nidulans bacterium of claim 1.

3. A method for preparing naringenin and naringenin chalcone, comprising the steps of: fermenting the recombinant saccharomyces cerevisiae of claim 1; the fermentation substrate is selected from one or more of parahydroxybenzoic acid, coumaric acid, parahydroxybenzaldehyde and benzoic acid.