CN111748553B

CN111748553B - Pathogenic related milRNAs of banana fusarium oxysporum and precursor and application thereof

Info

Publication number: CN111748553B
Application number: CN202010641713.1A
Authority: CN
Inventors: 李敏慧; 苑曼琳; 王猛; 毕芸田; 姜子德; 习平根; 李华平
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-07-06
Filing date: 2020-07-06
Publication date: 2021-12-14
Anticipated expiration: 2040-07-06
Also published as: CN111748553A

Abstract

The invention discloses pathogenic related milRNAs of banana fusarium oxysporum and precursors and application thereof, wherein the sequences of the milRNAs and the precursors thereof are respectively shown as SEQ ID No: 1. SEQ ID No: 2 and SEQ ID No: 3, respectively. The inventor finds that the milRNAs in the banana fusarium oxysporum infected with the host are remarkably improved; the precursors of the mil RNAs are knocked out from the banana fusarium wilt by using a homologous recombination method, and the pathogenicity of the obtained deletion mutant is obviously reduced. The invention proves that the milRNAs are necessary for the pathogenicity of banana fusarium wilt. The invention is helpful to deeply elucidate the pathogenic mechanism of banana fusarium wilt and provides a target for developing bactericides.

Description

Pathogenic related milRNAs of banana fusarium oxysporum and precursor and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to pathogenic milRNAs of banana fusarium oxysporum and precursors and application thereof.

Background

Bananas, mainly planted in tropical regions, are the largest fruit traded in the world and are the fourth major food crops following rice, wheat and corn in developing countries identified by food and agriculture organizations of the United nations. China is the second major banana producing country in the world and is also the main consuming country of bananas in the world, and bananas become one of the agricultural support industries in tropical and subtropical regions in China nowadays. However, banana wilt, known as "banana cancer", is a serious threat to the development of the world banana industry, causing losses that exceed $ 4 billion, and limiting banana production and trade worldwide.

Banana vascular wilt, also known as banana yellow leaf Disease, originates in southeast asia, and is known as Panama Disease (Panama Disease) because Panama is prevalent in central and south america in 1910 years, and the banana vascular wilt is fast in spreading and difficult to cure radically. Banana wilt has spread worldwide in banana growing areas, few areas can survive, and it also continues to spread to non-diseased banana growing areas. Most of the researches on banana vascular wilt in China are concentrated in the south, the researches on pathogenic mechanisms of pathogenic bacteria are relatively lagged, and the physical and chemical control effects are poor. In recent years, researchers find that microRNA (miRNA, small endogenous non-coding RNA with the length of about 22 nt) is an important posttranscriptional regulatory factor in animals and plants, and the microRNA is combined with a coding region or 5 'and 3' untranslated regions of a target gene to cut the target gene so as to inhibit the translation of the target gene, so that the microRNA participates in various biological processes. In fungi, small non-coding RNAs exist that have a similar structure to animal and plant mirnas, called microRNA-like RNAs (milrnas). Among neurospora crassa, there have been reported at least 4 types of milRNAs, one of which is closely related to Argonaute (AGO) protein (encoded by the FoQDE2 gene in fusarium oxysporum f.sp.cubense), whose synthesis does not require Dicer enzyme cleavage, but relies on the catalytic activity of AGO, which substitutes Dicer to process the milRNA precursor and remove the non-functional strand, ultimately producing mature miRNA. The research results of the subject groups at the early stage show that compared with wild strains, the pathogenicity of the banana fusarium oxysporum FoQDE2 gene knockout mutant is obviously reduced (identification and functional analysis of related genes FoQDE2 of banana fusarium oxysporum miRNA synthesis [ D ]. Guangzhou: south China university of agriculture, 2018.). In order to further explore the reason for the reduced pathogenicity of the FoQDE2 gene knockout mutant, the method searches for the milRNA which is synthesized by relying on the FoQDE2 through a high-throughput sequencing method, and tries to analyze the action mechanism of the milRNA in the pathogenic process of the fusarium oxysporum f.sp.cubense through analyzing and identifying the function of the milRNA. And the identification and function analysis of the milRNA related to pathogenic bacteria of banana wilt not only provides a new action target for prevention and control of banana wilt, but also lays a foundation for further research on the action mechanism of the milRNA in the pathogenic bacteria of banana wilt, and has important application value.

Disclosure of Invention

One of the purposes of the invention is to overcome the defects in the prior art and provide milRNAs related to pathogenic bacteria of banana wilt, and the biosynthesis of the milRNAs is closely related to Argonaute protein.

Another object of the present invention is to provide precursors of the above pathogenic milRNAs against banana vascular wilt bacteria.

Still another object of the present invention is to provide the use of the above pathogenic milRNAs of banana vascular wilt and their precursors.

The purpose of the invention is realized by the following technical scheme: pathogenic-related mil rnas of fusarium oxysporum f.sp.cubense include two mil rnas produced from the same precursor: mil r109 and mil r 123.

The nucleotide sequence of the milR109 is shown as follows:

ACAGCTCGTCCGATTGTGCGA。

the nucleotide sequence of the milR123 is shown as follows:

ACTTGCACACTCGTTCGAGCTGCG。

the nucleotide sequence of the precursor of the pathogenic mil RNAs of the banana vascular wilt pathogen is shown as follows: CTCGGGCCCTGGTTGCGTTGGAGTCACAGCTCGTCCGATTGTGCGAGATCTGCACTGTATGTCTTGGTATGAACGGGGTTCATATCATTGCATACAGTGTCGAACTTGCACACTCGTTCGAGCTGCGACACCAACGCAACCAGGACTTTGATGGCCTTCGCACACTTGACACACCACACACACTCACTCTCTCTTTATCGCACTCATTGAAATGCCTGGGAGGATTGACTTGACTTGACTTGATTTGGCTTGGACTTGGACTT。

The application of the pathogenic mil RNAs of banana vascular wilt pathogens and the precursors thereof in regulating and controlling the pathogenicity of the banana vascular wilt pathogens.

The milRNA and the precursor deletion thereof can reduce the pathogenicity of the banana fusarium wilt.

The application of the pathogenic milRNAs of the banana fusarium wilt bacteria and the precursors thereof in preventing and treating the banana fusarium wilt disease.

The banana vascular wilt is caused by banana vascular wilt.

The application of the pathogenic milRNAs of the banana fusarium oxysporum and the precursors thereof as targets of plant disease control medicines.

The plant disease is banana vascular wilt caused by banana vascular wilt.

A method for treating banana vascular wilt caused by banana vascular wilt is characterized by blocking or inhibiting the expression of pathogenic related milRNAs of banana vascular wilt in banana vascular wilt.

The application of the medicament for blocking or inhibiting the expression of pathogenic related milRNAs in banana vascular wilt in the preparation of medicaments.

The medicine is used for preventing and treating banana vascular wilt caused by banana vascular wilt.

The Fusarium oxysporum f.sp.cubense, FOC is Fusarium oxysporum f.sp.cubense) No. 4 physiological race.

The name of the wild type strain of the fusarium oxysporum cubeba specialization type is XJZ 2.

Compared with the prior art, the invention has the following advantages and effects:

according to the invention, homologous fragments at two sides of the precursors of milR109 and milR123 related to pathogenic bacteria of banana wilt are amplified, and hygromycin phosphotransferase genes are fused to construct the deletion mutants of the precursors of milR109 and milR 123. Experiments prove that compared with a wild strain XJZ2, the pathogenicity of the deletion mutant is obviously reduced; the milR109 and the milR123 in the banana fusarium wilt bacteria infected with the host are obviously improved. The invention proves that the milRNAs are necessary for the pathogenicity of the banana fusarium oxysporum, are helpful for deeply clarifying the pathogenic mechanism of the banana fusarium oxysporum, and provide a target for developing a bactericide.

Drawings

FIG. 1 is a statistical graph of sRNA expression differences obtained by sequencing, analysis and screening in example 1; in the scattergram analysis, the ratio of the y axis (sRNA expression level in the FoQDE2 gene deletion mutant) to the x axis (sRNA expression level in XJZ2) was used, and the dots above the line y ═ x indicated that the expression level was up-regulated in the FoQDE2 gene deletion mutant, and the expression level was down-regulated in the FoQDE2 gene deletion mutant.

FIG. 2 is a statistical graph of sRNA length statistics and initial base bias statistics obtained by sequencing, analysis and screening in example 1; wherein a is the distribution condition of 16-40nt reads in the sequencing analysis result; b is the ratio of the initial base; c is the ratio of 20-24nt initial base.

FIG. 3 is a secondary structure diagram of the precursors of predicted mil RNAs (mil R109 and mil R123).

FIG. 4 is a graph showing the results of quantitative detection of mil RNAs in example 3; wherein a is the expression quantity detection condition of the milRNAs in the synthetic related pathway gene deletion mutant strain; b is the expression condition of the milRNAs after 36h infection after host inoculation.

FIG. 5 is the electrophoresis chart of the RT-PCR results of the sequences of the milRNAs of example 4.

FIG. 6 is a graph showing the results of PCR validation of the precursor knockout mutant of example 5; wherein, the verification result of the primer HPH-F/HPH-R is as follows: lanes 1-3 are knockout mutants Δ mil R109-6, Δ mil R109-8, Δ mil R109-10, fragment sizes are all 518bp, 4 is a positive control XJZ2, 5 is a clear water negative control; the verification result of the primer milR109-JCF1/HPH-R is as follows: lanes 1-3 are knockout mutants Δ mil R109-6, Δ mil R109-8, Δ mil R109-10, respectively, with fragment sizes of 3715bp, 4 as a positive control XJZ2, and 5 as a clear water negative control; the verification result of the primer milR109-JCF1/94 is as follows: the mutants, Δ mil R109-6, Δ mil R109-8, and Δ mil R109-10, were knocked out in lanes 1-3, respectively, with fragment sizes of 2941bp, 4 as a positive control XJZ2, and 5 as a clear water negative control.

FIG. 7 is a graph showing the results of measuring the relative expression levels of mil R109 and mil R123 in the precursor deletion mutant of example 5; where differences were analyzed using ttext (two-tailed, equal variance two-sample test), representing very significant differences (p < 0.01).

FIG. 8 is a photograph showing the infection of the tissue culture seedlings of Musa paradisiaca with the deletion mutant and the wild type of the precursor of milR109/123 in example 6.

FIG. 9 is a statistical plot of the virulence results of the deletion mutant and wild type of example 6milR109/123 precursor on tissue culture seedlings of Brazil bananas.

Detailed Description

The present invention will be described in further detail below with reference to specific examples and drawings, but the embodiments of the present invention are not limited thereto. Those who do not specify the conditions are performed according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

Example 1 sequencing and bioinformatic analysis of Small molecule RNAs

High-throughput small molecule RNA (sRNA) sequencing is carried out by taking Fusarium oxysporum special type (Fusarium oxysporum f.sp.cubense, FOC) No. 4 physiological race wild strain (XJZ2) and Argonaute protein coding gene FoQDE2 deletion mutant (delta FoQDE2) (Wangfei. banana Fusarium wilt bacterium miRNA synthesis related gene identification and function analysis [ D ]. Hongkong agriculture university, 2015:13-18.) as samples under pure culture conditions, total RNA of the samples is extracted by using Trizol reagent of TianGen company, and samples with qualified RNA quality (RIN value >9.0) are handed to Nonokia genesis company to complete sequencing.

And performing bioinformatics analysis on the small molecular RNA data obtained by sequencing. After the company's sequencing data was obtained, the sequence obtained by sequencing was first processed: removing sequences with pollution, low quality and length less than 16nt or more than 40nt, wherein the obtained sequences are called clean data, and then removing the sequences which are not aligned to the whole genome of the fusarium oxysporum f.sp.cubense, and the results are shown in table 1; the remaining sRNA sequences were then further classified and annotated according to their source, with the results shown in table 2; the sRNA sequences of the intron (intron), the non-coding region (3 '/5' UTR) and the intergenic region were further analyzed for expression level. The expression level of sRNA is expressed as a TPM value (Transcripts Per Million).

The calculation formula of the TPM is as follows:

in the formula, N is the number of reads aligned to a certain gene or transcript, and L is the fragment length of the gene or transcript.

Using an algorithm log₂(TPM (sample2)/TPM (sample1)) further analyzed the data as | log | (₂(TPM(sample2)/TPM(sample1))|>1 and p-Value<0.05, this indicates that the expression of sRNA in this position is significantly different between sample1 and sample 2. According to the screening method, 178 sRNA which are differentially expressed in the mutant of the fusarium oxysporum f.sp.cubense delta FoQDE2 are obtained, wherein 156 sRNA are obviously reduced and 22 sRNA are obviously increased, and the statistical result is shown in figure 1.

TABLE 1 sRNA sequencing results and data analysis

TABLE 2 sRNA sequencing data Classification Annotation

From the analysis of sRNA length statistics and initial base bias, it was found that the number of sRNA sequences between 20 and 24nt was significantly smaller in the Δ FoQDE2 mutant than in the wild-type strain, and that most sRNA sequences of this size begin with U and A bases (FIG. 2).

Further, 156 sRNAs in the banana fusarium oxysporum delta FoQDE2 mutant are remarkably reduced to predict the precursor secondary structure, thereby obtaining milRNAs with good stem-loop structures, wherein two of the milRNAs are named as milR109 and milR123, and the sequences are respectively as follows: ACAGCTCGTCCGATTGTGCGA (SEQ ID No.1), ACTTGCACACTCGTTCGAGCTGCG (SEQ ID No. 2). Both share a single precursor, and the precursor sequence (SEQ ID No.3), positional information and secondary structure predictions are shown in FIG. 3.

Example 2 extraction of Total RNA

1. Extraction of Total RNA from the Strain under pure culture conditions (Trizol method, Trizol reagent from Tianggen Co.)

(1) Pure cultured wild type strains (Li Shihui et al, 2007) and the FoQDE2 gene deletion mutant delta FoQDE2 of example 1 were cultured on PDA plates at 28 ℃ for 5d, a bacterial dish with uniform growth was taken at the edge of the colony with a punch (d ═ 5mm), inoculated into a flask previously poured with 100mL of PD medium, shake-cultured in a shaker at 28 ℃ and 180rpm for 2d, filtered, and mycelia were collected for liquid nitrogen freezing treatment.

(2) Weighing about 100mg of freeze-dried mycelia, placing into a mortar subjected to sterilization treatment in advance, adding liquid nitrogen, grinding until the mycelia become uniform powder, quickly placing into a centrifuge tube with RNase removed 2mL, adding 1mL of Trizol and 20 muL of mercaptoethanol, vortexing to uniformly distribute the mycelia for full lysis, and standing at room temperature for 5-10 min.

(3) 200mL of chloroform was added, vortexed for 15s, allowed to stand on ice for 10min, and centrifuged at 12000rpm at 4 ℃ for 10 min.

(4) And (4) taking the supernatant and repeating the step (3).

(5) Taking about 500 mu L of supernatant, adding into a new 1.5mL RNase removal centrifuge tube, adding isopropanol with the same volume, turning upside down, mixing uniformly, standing on ice for 15min, and centrifuging at 12000rpm and 4 ℃ for 15 min.

(6) Discarding the supernatant, adding 1mL of 75% anhydrous ethanol pre-cooled at-20 deg.C, washing the precipitate, and centrifuging at 12000rpm and 4 deg.C for 5 min.

(7) The wash solution is decanted and step (6) is repeated.

(8) The supernatant was discarded, and the residual liquid was aspirated off, and left to air-dry at room temperature for precipitation.

(9) Adding DEPC water 30-60 μ L, dissolving RNA precipitate, and storing at-80 deg.C.

Extraction of Total RNA from host infected Strain by CTAB method

(1) Wild type strains were cultured on PDA plates for 5d at 28 ℃ and a well-grown dish was picked up at the edge of the colony using a punch (d ═ 5mm), inoculated into a flask previously poured with 100mL YPD and shake-cultured for 2d at 28 ℃ and 180rpm in a shaker, and spores were collected by filtration.

(2) Collecting spores, and making into spore suspension (spore concentration is about 10) with MM liquid culture medium⁶seed/mL), soaking Brazilian banana seedlings growing to 4-5 leaves in a spore suspension, culturing in a shaking table at 28 ℃ and 80rpm for 36h by illumination, collecting banana roots with dense hypha attachments, and quickly freezing by using liquid nitrogen.

(3) Weighing 100mg banana root, placing into a sterilized mortar, adding liquid nitrogen, grinding into uniform powder, quickly transferring into a 15mL centrifuge tube without RNase, adding 5mL 2% (w/v) CTAB buffer solution and 100 μ L mercaptoethanol, vortex mixing, heating and cracking in water bath at 65 ℃ for 10min, and centrifuging at 8000rpm and 4 ℃ for 15 min.

(4) The supernatant was transferred to a 2mL RNase-free centrifuge tube, and 5M KAc solution (1/3 vol.) was added thereto, and the mixture was stirred by inverting the mixture and then ice-cooled for 30min, and 700. mu.L of a mixture of chloroform and isoamyl alcohol (chloroform: isoamyl alcohol: 24: 1) was added thereto, and the mixture was centrifuged at 12000rpm and 4 ℃ for 10 min.

(5) Collecting supernatant, adding 500 μ L water-saturated phenol into 2mL centrifuge tube without RNase, mixing, adding 500 μ L mixture of chloroform and isoamyl alcohol (chloroform: isoamyl alcohol is 24: 1), vortex mixing, and centrifuging at 12000rpm at 4 deg.C for 10 min.

(6) The supernatant was put into a 2mL RNase-free centrifuge tube, mixed with a mixture of chloroform and isoamyl alcohol (chloroform: isoamyl alcohol: 24: 1) at an equal volume, mixed well, and centrifuged at 12000rpm at 4 ℃ for 10 min.

(7) Taking the supernatant to a 2mL centrifuge tube without RNase, adding isopropanol with the same volume, turning upside down, mixing uniformly, then carrying out ice bath for 40min, and centrifuging at 12000rpm and 4 ℃ for 10 min.

(8) Removing supernatant, adding 1mL-20 deg.C pre-cooled 75% (v/v) anhydrous ethanol, repeatedly sucking, sufficiently cleaning precipitate, and centrifuging at 12000rpm and 4 deg.C for 5 min.

(9) And (4) discarding the supernatant, and repeating the step (8) to clean the precipitate.

(10) Discarding the supernatant, air-drying the precipitate at room temperature, adding 30-60 μ L DEPC water, dissolving the precipitate sufficiently, and storing at-80 deg.C.

Example 3 detection of expression levels of target milRNAs

The expression of target milRNA is detected by respectively taking total RNA of wild type strains XJZ2 and FoQDE2 gene deletion mutant delta FoQDE2 of fusarium oxysporum f.sp.cubense under pure culture conditions and total RNA of wild type strains XJZ2 (obtained in example 2) of 36h inoculated host banana seedlings under culture conditions as templates. All-in-One from GeneCopoeia was used^TMAnd the miRNA qRT-PCR detection kit is used for detecting the expression of target milRNAs.

Reverse transcription of milRNA

Taking the RNA of the sample as a template, firstly adding Poly-A tail (PolyA) to the 3' end of the milRNAs under the action of Poly A polymerase, and then generating first strand cDNA corresponding to the milRNAs under the action of reverse transcriptase by using Oligo-dT adaptor primer provided by the kit.

Detection of expression level of milRNA

Quantitative PCR is carried out by respectively taking cDNA obtained by reverse transcription in the step 1 as a template, designing a specific primer according to the sequence of target milRNAs and a joint primer provided by a kit, (milR109 specific primer: ACAGCTCGTCCGATTGTGCGA; specific primer of milR 123: CTTGCACACTCGTTCGAGCT) and taking snRNA U4 (detection primer: GGGAATTTTTGGAACTCTTT) as an internal reference by utilizing 2^-ΔΔCtThe method is used for expression quantity analysis.

Through detection, the result is shown in fig. 4, compared with the wild strain, the expression levels of both the milR109 and the milR123 in the mutant delta FoQDE2 are obviously reduced; after inoculation for 36h, the expression levels of both the milR109 and the milR123 are obviously higher than those in the pure culture state. The sRNA sequencing and qRT-PCR detection results both show that the synthesis of the milR109 and the milR123 depends on the function of the FoQDE2 gene, and has certain relevance to pathogenicity.

Example 4 clonal sequencing of mil R109 and mil R123

To detect the fragment sizes of target milRNAs, milR109 and milR123, total RNA of wild type strain was extracted (same as step 1 of example 2), and after passing quality detection, reverse-transcribed into cDNA (same as step 1 of example 3), and the cDNA was used as a template, ddH was added₂O is a negative control, and the target band is amplified by using primers milR109 and milR123 (the primer sequences are the same as those used for quantitative PCR detection) and a linker primer respectively, and the electrophoresis detection is shown in FIG. 5. After gel cutting recovery and escherichia coli transformation, sequencing shows that the lengths of the milR109 and the milR123 are 21nt and 24nt respectively, and both start with the A, and belong to the more typical milRNAs.

Example 5 construction and validation of the precursor deletion mutants of mil R109 and mil R123

Constructing a homologous fragment containing a resistance gene to replace a target fragment by adopting a split marker homologous recombination method to realize the knockout of the target milRNA, and specifically operating as follows:

A. target milRNA left and right homologous arm sequence amplification and fusion

Respectively amplifying homologous fragments at two sides of a target milRNA precursor and simultaneously fusing hygromycin genes by adopting a split marker homologous recombination method, constructing homologous fragments containing resistance genes to replace the target fragments, and performing PCR amplification in the following steps:

first round of PCR amplification, using specific primers mil R109-P1/P2, mil R109-P3/P4 and general primers M13F +226, M13F +225 (see Table 3 for details), high Fidelity enzyme Phanta Max Super-Fidelity DNApolymerase (Vazyme) respectively using wild type strain DNA and pDA vector (L, MH et al. functional characterization of the gene Fooch1 encoding a useful α -1, 6-manosyltransferase in Fungal oxygen complex f.sp. cube [ J ]. functional Genetics and biology.65,1-13.) as template, left and right arm fragments of target RNA precursor and hygromycin gene were amplified as follows:

the procedure is as follows: pre-denaturation at 95 deg.C for 3 min; denaturation at 95 deg.C for 15s, annealing at 56 deg.C for 15s, extension at 72 deg.C for 90s, and 30 cycles; finally, the extension is carried out for 5min at 72 ℃.

And performing second round of PCR amplification (fusion), namely obtaining a purified PCR product by a gel cutting recovery or PCR product purification method, and performing amplification by using the high-fidelity KOD FX Polymerase (TOYOBO) by using the purified PCR product as a template.

The procedure is as follows: pre-denaturation at 94 deg.C for 2 min; denaturation at 98 deg.C for 10s, annealing extension at 68 deg.C for 1min/kb, and performing 34 cycles; finally, the extension is carried out for 7 min.

B. Preparation of protoplasts

(1) Taking XJZ2 strain which is activated and cultured for 3d at 28 ℃, using a sterilization puncher (d is 5mm) to punch a bacteria dish at the edge of a bacterial colony, transferring a new PDA culture medium, and culturing for 6-7d at 28 ℃.

(2) By ddH₂O-scrubbing flat plate and sterilizing brush penThe spores were gently swept down to a final suspension concentration of 10⁶-10⁸Each/mL was inoculated in 100mL PD liquid medium, incubated at 28 ℃ for 8-9h (no longer than 10h) at 180rpm, and microscopically examined.

(3) Collecting young hypha with spores, centrifuging at 4 deg.C and 3500rmp for 10min, discarding supernatant, and enriching; or filtering with 4-6 layers of lens-wiping paper to collect compact mass-shaped hyphae.

(4) Wash at least 2 times with 0.75M isotonic NaCl solution.

(5) Preparing an enzymolysis solution: both Enzymes (crashed enzyme: Lysing Enzymes ═ 1:1) were dissolved in 0.75M NaCl solution at a final concentration of 10mg/mL, and centrifuged to remove impurities.

(6) Placing the collected mycelia into enzymolysis solution, performing shaking enzymolysis at 32 deg.C and 90-100rpm for 3.5-4h, and performing microscopic examination on the enzymolysis condition.

(7) After the enzymolysis is finished, the mixture is filtered by 3-4 layers of Mira/cloth, the filtrate is centrifuged for 10min at 4 ℃ and 3000rmp, and the protoplast is collected.

(8) The supernatant was discarded, and the protoplasts were washed with 0.75M NaCl solution.

(9) Centrifuge for 5min, discard the supernatant, wash 2 times with 0.75M NaCl.

(10) The supernatant was discarded, 800. mu.L of STC, 200. mu.L and 20. mu.L of DMSO (STC: PTC: DMSO ═ 4: 1: 0.1) were added to resuspend the protoplasts, and the number of the protoplasts was counted on a hemocyte plate so that the number of protoplasts became 10⁷-10⁸Per mL;

(11) the mixture was placed on ice and dispensed into 1.5mL sterile centrifuge tubes, 100. mu.L per tube, and frozen at-80 ℃.

PEG-mediated protoplast transformation

(1) mu.L of the purified fused fragment (2-5. mu.g of each fragment) was added to 100. mu.L of protoplast of the wild type strain (about 10)⁷one/mL), and is mixed gently and ice-cooled for 30min (the mixture can not be inverted up and down);

(2) sequentially adding 100 μ L, 300 μ L and 600 μ L of 50% PEG solution, mixing, and standing at room temperature for 20 min;

(3) sequentially adding 1mL, 3mL and 4mL of STC precooled at 4 ℃, and gently mixing uniformly each time;

(4) centrifuging at 3000rpm at room temperature for 10 min;

(5) carefully discard the supernatant, leave about 400. mu.L of liquid, add 1.6mL of RM and suspend thoroughly;

(6) shaking and culturing at 28 deg.C and 65rpm for 3-4 hr;

(7) melting RMA regeneration culture medium (the specific formula is Li, 2014), cooling to about 45 ℃, and adding hygromycin until the final concentration is 100 mug/mL;

(8) pouring a proper amount of prepared RMA culture medium containing antibiotics (100 mu g/mL), mixing the protoplast cells with the double walls, and pouring the mixture into a flat plate after the mixture is uniform;

(9) after culturing at 28 ℃ for about 2 days, suspected positive mutants were picked up on PDA plates containing antibiotics (100. mu.g/mL).

D. Screening and verification of target milRNA precursor knockout mutant

Obtaining correct knockout mutant strains through selective plate screening, PCR and qRT-PCR verification, which comprises the following steps:

(1) selective plate screening: transformants suspected of being positive colonies were picked and inoculated onto HPH (100. mu.g/mL) containing PDA rescreened plates, incubated at 28 ℃ in the dark for 3 days, and well grown transformants were selected for further identification using XJZ2 as a control for growth on antibiotic plates.

(2) PCR and qRT-PCR identification: specific primers HPH-F (225) and HPH-R (226) are designed according to hygromycin resistance genes, the target milRNA precursor sequence specificity detection primers milR109-JCF1 and 226, and milR109-JCF1 and delta L715-JCR1(94) are shown in Table 3; and (2) taking the XJZ2 template DNA as a positive control and clear water as a negative control, extracting the DNA of the transformant obtained in the step (1), taking the DNA as a template, amplifying the fragment by using Green Taq Mix (Vazyme), performing PCR verification, and identifying whether the target milRNA precursor fragment in the corresponding mutant is successfully knocked out. Then, total RNA of the PCR-verified correct knockout mutant is extracted by using Trizol method (same as example 2); carrying out qRT-PCR detection on the cDNA through reverse transcription; and (4) selecting strains with the expression level being basically zero according to the expression level of the target milRNA in the mutant, namely obtaining the next test mutant.

Since the mil R109 and the mil R123 are generated from the same precursor structure and are knocked out together in the experiment, the relative expression amounts of the mil R109 and the mil R123 are analyzed (the primers are shown in Table 3) to represent that the precursor structures are knocked out successfully, the results are shown in FIG. 7, the sizes of the fragments amplified by the specific primers are correct as shown in the clear and bright bands (the specific sizes are shown in FIG. 6), the mutant strains are obtained successfully, three obtained mutant strains are named by using the delta mil R109-6, the delta mil R109-8 and the delta mil R109-10 respectively, and the related detection primers are shown in Table 3.

TABLE 3

Note: all oligonucleotide primers were synthesized by Shanghai Bioengineering, Inc. and purified by PAGE.

Example 6 determination of the pathogenic ability of the deletion mutant of the precursor of milR109/123

The method for determining the pathogenic capability of the mutant strain compared with the wild strain by taking the young Brazilian banana tissue culture seedling with 4-5 leaves as an inoculation object comprises the following steps:

selecting healthy Brazilian banana tissue culture seedlings with similar growth vigor (4-5 leaves) under the same culture condition, shaking the wild type strains and the mutant strains obtained in the example 5 by using an YPD liquid culture medium to culture and produce spores, and diluting the concentration of the spores to 1 × 10⁷one/mL, ddH₂O washing spores to suspension without liquid culture medium, and ddH for control group₂Soaking roots in O; inoculating 30 seedlings to each strain, and setting three biological repetitions; placing in an artificial culture room with a constant temperature of 28 deg.C and a relative humidity of 50-70%, observing the disease condition for about 20 days, obliquely cutting the pseudostem base of banana seedling, observing the browning degree, and taking a picture to record, wherein the result is shown in FIG. 8. The first grade with the larger number of plants with the same disease level is taken as a representative, the vascular bundle browning range is larger and the color is dark after the XJZ2 infection can be clearly seen, and all mutant strains are compared with the vascular bundle browning range after the XJZ2 infectionThe degrees are weakened in different degrees; CK is expressed as a total absence of disease.

According to the browning condition of the vascular bundles at the roots of the bananas, the disease conditions are classified according to the classification standard of the disease conditions in the literature (Li Yi Hui et al, 2009), the specific standard is shown in Table 4 (figure 9), and the disease index is calculated at the same time. After grading, statistics shows that: the number of first-stage pathogenic plants of the milR109 and milR123 precursor deletion mutant strains is more than that of the wild type, and the number of fourth-stage pathogenic plants is less than that of the wild type; the disease index of the mutant strain is 49.63, which is obviously reduced compared with the wild type 79.26 (Table 5). In conclusion, the knockout of the precursors of milR109 and milR123 weakens the pathogenicity of the host infected by the fusarium oxysporum f.sp.cubense.

TABLE 4 grading Standard of disease symptoms at the base of pseudostem of tissue culture seedlings of bananas

TABLE 5 statistics of host disease index after inoculation of strains

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> banana vascular wilt pathogenic related milRNAs and precursor and application thereof

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> nucleotide sequence of mil R109

<400> 1

acagctcgtc cgattgtgcg a 21

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> milR123 nucleotide sequence

<400> 2

acttgcacac tcgttcgagc tgcg 24

<210> 3

<211> 263

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> precursors of mil RNAs

<400> 3

ctcgggccct ggttgcgttg gagtcacagc tcgtccgatt gtgcgagatc tgcactgtat 60

gtcttggtat gaacggggtt catatcattg catacagtgt cgaacttgca cactcgttcg 120

agctgcgaca ccaacgcaac caggactttg atggccttcg cacacttgac acaccacaca 180

cactcactct ctctttatcg cactcattga aatgcctggg aggattgact tgacttgact 240

tgatttggct tggacttgga ctt 263

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> snRNA U4 qRT-PCR qRT-PCR detection primer

<400> 4

gggaattttt ggaactcttt 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> HPH-F

<400> 5

gcaagacctg cctgaaaccg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> HPH-R

<400> 6

ggtcaagacc aatgcggagc 20

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> M13F

<400> 7

cagggttttc ccagtcacga c 21

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> M13R

<400> 8

tcacacagga aacagctatg acc 23

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> milR109 qRT-PCR qRT-PCR detection primer

<400> 9

acagctcgtc cgattgtgcg a 21

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> milR123 qRT-PCR qRT-PCR detection primer

<400> 10

cttgcacact cgttcgagct 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> milR109-P1

<400> 11

cttaagttca gcttggagcc 20

<210> 13

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> milR109-P2

<400> 13

gtcgtgactg ggaaaaccct ggcaagcatg cctggtcaat a 41

<210> 13

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> milR109-P3

<400> 13

ggtcatagct gtttcctgtg tgaggacttg gactagacag ga 42

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> milR109-P4

<400> 14

tgatgttgcg actgcgattg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> milR109-JCF1

<400> 15

cttggtcgct tcaggagaac 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> ∆L715-JCR1

<400> 16

gaaacttctc gacagacgtc 20

Claims

1. The pathogenic related milRNAs of banana vascular wilt pathogen are characterized by comprising two milRNAs generated by the same precursor: mil r109 and mil r 123;

the nucleotide sequence of the milR109 is as follows: ACAGCTCGTCCGATTGTGCGA, respectively;

the nucleotide sequence of the milR 123: ACTTGCACACTCGTTCGAGCTGCG are provided.

2. The precursors of pathogenic milRNAs of banana vascular wilt bacteria as described in claim 1, wherein the nucleotide sequence is as follows: CTCGGGCCCTGGTTGCGTTGGAGTCACAGCTCGTCCGATTGTGCGAGATCTGCACTGTATGTCTTGGTATGAACGGGGTTCATATCATTGCATACAGTGTCGAACTTGCACACTCGTTCGAGCTGCGACACCAACGCAACCAGGACTTTGATGGCCTTCGCACACTTGACACACCACACACACTCACTCTCTCTTTATCGCACTCATTGAAATGCCTGGGAGGATTGACTTGACTTGACTTGATTTGGCTTGGACTTGGACTT。

3. The use of the pathogenic-related mil RNAs of banana vascular wilt bacteria of claim 1 or the precursors of pathogenic-related mil RNAs of banana vascular wilt bacteria of claim 2 for modulating the virulence of banana vascular wilt bacteria,

the banana fusarium wilt bacteria is fusarium oxysporum cubeba specialization type (C)Fusariumoxysporum f. sp. cubenseFOC) No. 4 physiological races.

4. The use of claim 3, wherein the deletion of the milRNAs or precursors reduces the virulence of the species Fusarium oxysporum.

5. Use of the pathogenic milRNAs of banana vascular wilt bacteria as defined in claim 1 or precursors of the pathogenic milRNAs of banana vascular wilt bacteria as defined in claim 2 as targets of drugs for preventing and treating banana vascular wilt diseases.

6. A method for treating banana vascular wilt caused by banana vascular wilt, characterized by blocking or inhibiting the expression of the pathogenic-related milRNAs of banana vascular wilt as claimed in claim 1;