CN111733264B - Helicobacter pylori nucleic acid sensor, detection method and application - Google Patents
Helicobacter pylori nucleic acid sensor, detection method and application Download PDFInfo
- Publication number
- CN111733264B CN111733264B CN202010597081.3A CN202010597081A CN111733264B CN 111733264 B CN111733264 B CN 111733264B CN 202010597081 A CN202010597081 A CN 202010597081A CN 111733264 B CN111733264 B CN 111733264B
- Authority
- CN
- China
- Prior art keywords
- sequence
- nucleic acid
- helicobacter pylori
- sensing electrode
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a helicobacter pylori nucleic acid sensor, a detection method and application, wherein the sensor comprises a glassy carbon electrode, a primer sequence, a template sequence, DNA ligase, DNA polymerase, a water-soluble silver salt and a reducing agent; the surface of the glassy carbon electrode is connected with a primer sequence and CdS quantum dots; the template sequence can form a dumbbell-shaped structure, and the dumbbell-shaped structure can be connected and closed by DNA ligase; the template sequence, the primer sequence and the helicobacter pylori nucleic acid sequence can form a trimer structure, the trimer structure can enable the primer sequence to carry out rolling circle amplification under the action of DNA polymerase, and the amplified DNA long chain has a repeat sequence rich in cytosine base. The invention can realize the ultra-sensitive detection of the helicobacter pylori nucleic acid.
Description
Technical Field
The invention relates to a helicobacter pylori nucleic acid sensor, a detection method and application.
Background
The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.
Helicobacter pylori is a gram-negative bacterium, is one of the most common bacterial pathogens, mainly lives in the pylorus position of the stomach of a human body, is a potential cause of gastritis, peptic ulcer, lymphoproliferative gastric lymphoma and other diseases, and 67% -80% of gastric ulcer and 95% of duodenal ulcer are considered to be caused by helicobacter pylori. In recent years, helicobacter pylori infection has been found to be closely related to gastric cancer, and the world health organization defines helicobacter pylori as a type 1 gastric cancer causative agent.
Detection of helicobacter pylori is critical to stomach health. The existing detection methods mainly comprise a gastroscope method, a carbon-13 urea expiration method, a serum method, a stool examination, a urine examination and the like. The gastroscopy can directly sample and detect the thallus, but the invasive examination brings pain to the patient; the carbon 13 urea expiration method needs to use an isotope labeled urea capsule, so that the cost is high, and instruments for detecting the content of the labeled isotope in the expired gas are expensive; the detection of samples against antibodies cannot differentiate the stage of infection due to the persistence of the immune response, and there is a long lag in the follow-up of the healing process in particular. Nucleic acid detection is an important method for detecting microorganisms because of its high specificity and high detection speed. However, the inventor's research shows that the detection sensitivity of the prior art is insufficient because the helicobacter pylori nucleic acid has been highly diluted in both environmental samples and physiological samples, thereby limiting the development of helicobacter pylori nucleic acid detection.
Disclosure of Invention
In order to solve the defects of the prior art, the invention aims to provide a helicobacter pylori nucleic acid sensor, a detection method and application, which can realize the ultra-sensitive detection of the helicobacter pylori nucleic acid.
In order to achieve the purpose, the technical scheme of the invention is as follows:
on one hand, the helicobacter pylori nucleic acid sensor comprises a glassy carbon electrode, a primer sequence, a template sequence, DNA ligase, DNA polymerase, a water-soluble silver salt and a reducing agent; the surface of the glassy carbon electrode is connected with a primer sequence and the CdS quantum dots;
the template sequence can form a dumbbell-shaped structure, and the dumbbell-shaped structure can be connected and closed by DNA ligase; the template sequence, the primer sequence and the helicobacter pylori nucleic acid sequence can form a trimer structure, the trimer structure can enable the primer sequence to carry out rolling circle amplification under the action of DNA polymerase, and the amplified DNA long chain has a repetitive sequence rich in cytosine bases.
On the other hand, a method for detecting a helicobacter pylori nucleic acid, which comprises providing the above-mentioned helicobacter pylori nucleic acid sensor; the method comprises the following steps:
incubating the template sequence into a dumbbell-shaped structure, and connecting and closing the two ends of the DNA of the dumbbell-shaped structure by using DNA ligase;
connecting the surface of the glassy carbon electrode with a primer sequence and CdS quantum dots to obtain a primer sensing electrode;
incubating a sample containing helicobacter pylori nucleic acid to be detected with a template sequence with a closed dumbbell-shaped structure and a sensing electrode, so that a primer sequence on the surface of the primer sensing electrode, the template sequence and the helicobacter pylori nucleic acid form a trimer structure, and under the action of DNA polymerase, the primer sequence with the trimer structure is subjected to rolling circle amplification to obtain a long chain with a repeat sequence, so that the primer sensing electrode becomes an amplification sensing electrode;
adding water-soluble silver salt and a reducing agent into the amplified sensing electrode, and carrying out reduction reaction to enable the nano silver cluster loaded on the amplified DNA long chain to obtain an electrochemical sensing electrode;
electrochemiluminescence detection is carried out in persulfate solution by taking an electrochemical sensing electrode as a working electrode.
In a third aspect, the application of the helicobacter pylori nucleic acid sensor in preparing a reagent for detecting helicobacter pylori is provided.
In a fourth aspect, a helicobacter pylori detection kit comprises the above helicobacter pylori nucleic acid sensor, a buffer solution, and deoxyribonucleoside triphosphates (dNTPs).
The invention has the beneficial effects that:
the invention combines rolling circle amplification reaction and electrochemiluminescence to realize the ultra-sensitive detection of the helicobacter pylori nucleic acid. Its detection limit for helicobacter pylori nucleic acids is as low as 1 pM.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.
Fig. 1 is a schematic diagram of a detection process in embodiment 1 of the present invention.
FIG. 2 is a representation of CdS NCs prepared in example 1 of the present invention, where A is fluorescence spectrum and B is TEM.
FIG. 3 is a diagram showing the gel electrophoresis characterization of the nucleic acid reaction process in example 1 of the present invention.
Fig. 4 is a characteristic diagram of the effect of the presence of the target on the ECL signal in embodiment 1 of the present invention.
FIG. 5 is a graph showing the results of detecting ECL signals of target sequences at different concentrations in example 1 of the present invention.
Detailed Description
It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.
In view of the problem of low detection sensitivity of helicobacter pylori nucleic acid in the prior art, the invention provides a helicobacter pylori nucleic acid sensor, a detection method and application.
The invention provides a helicobacter pylori nucleic acid sensor, which comprises a glassy carbon electrode, a primer sequence, a template sequence, DNA ligase, DNA polymerase, a water-soluble silver salt and a reducing agent, wherein the glassy carbon electrode is a glass carbon electrode; the surface of the glassy carbon electrode is connected with a primer sequence and CdS quantum dots;
the template sequence can form a dumbbell-shaped structure, and the dumbbell-shaped structure can be connected and closed by DNA ligase; the template sequence, the primer sequence and the helicobacter pylori nucleic acid sequence can form a trimer structure, the trimer structure can enable the primer sequence to carry out rolling circle amplification under the action of DNA polymerase, and the amplified DNA long chain has a repeat sequence rich in cytosine base.
The water-soluble silver salt refers to a compound which is dissolved in water and ionizes silver ions, such as silver nitrate and the like.
The reducing agent is a compound capable of reducing silver ions, such as sodium borohydride and the like.
In some embodiments of this embodiment, the sequence of the nucleic acid strand from 5 'to 3' of the template sequence is AGCTTATTCCAGATCCGCTTTATAAATAAGCTTATAACAGGAGGAAGGAGGTGTTATA;
the sequence of the nucleic acid chain of the primer sequence from 5 'end to 3' end is ATACCAATATCTGGA;
the nucleic acid chain sequence of the helicobacter pylori nucleic acid from 5 'end to 3' end is ATTTATAAAGCGGATATTGGTAT.
Experiments show that the sequence can better detect the helicobacter pylori nucleic acid with ultra-sensitivity and has better reproducibility.
In some embodiments of this embodiment, the 5' end of the primer sequence is modified to a thiol group.
In some examples of this embodiment, the surface of the glassy carbon electrode is attached to mercaptoethanol. The site was blocked with mercaptoethanol.
In some embodiments of this embodiment, the DNA ligase is T4 DNA ligase.
In some embodiments of this embodiment, the DNA polymerase is phi29 DNA polymerase.
In another embodiment of the present invention, there is provided a method for detecting a helicobacter pylori nucleic acid, comprising providing the above-mentioned helicobacter pylori nucleic acid sensor; the method comprises the following steps:
incubating the template sequence into a dumbbell-shaped structure, and connecting and closing the two ends of the DNA of the dumbbell-shaped structure by using DNA ligase;
connecting the surface of the glassy carbon electrode with a primer sequence and CdS quantum dots to obtain a primer sensing electrode;
incubating a sample containing helicobacter pylori nucleic acid to be detected with a template sequence with a closed dumbbell-shaped structure and a sensing electrode, so that a primer sequence on the surface of the sensing electrode, the template sequence and the helicobacter pylori nucleic acid form a trimer structure, and under the action of DNA polymerase, the primer sequence with the trimer structure is subjected to rolling circle amplification to obtain a long chain with a repeat sequence, so that the primer sensing electrode becomes an amplification sensing electrode;
adding water-soluble silver salt and a reducing agent into the amplified sensing electrode, and carrying out reduction reaction to enable the nano silver cluster loaded on the amplified DNA long chain to obtain an electrochemical sensing electrode;
electrochemiluminescence detection is carried out in persulfate solution by taking an electrochemical sensing electrode as a working electrode.
The detection method of the invention mainly aims at diagnosis and treatment of non-diseases.
In some embodiments of this embodiment, the CdS quantum dots are prepared by: and (3) dropwise adding the sodium sulfide solution to cadmium nitrate at 65-75 ℃, and carrying out reflux reaction.
In one or more embodiments, after the reflux reaction, centrifuging, collecting the precipitate, adding water for ultrasonic dispersion, centrifuging again, and collecting the supernatant, namely the CdS quantum dot solution.
In some embodiments of this embodiment, the process of incubating the template sequence into a dumbbell structure is: incubating for 5-15 min at 93-97 ℃, cooling to 20-30 ℃ at the speed of 0.05-0.15 ℃/s, and standing for 3-5 h.
In some examples of this embodiment, the template sequence is incubated into a dumbbell structure, then added with DNA ligase and reacted at 15-17 ℃ overnight, heated to 60-70 ℃ for 5-15 min, and then cooled to room temperature.
In some examples of this embodiment, a CdS quantum dot solution is added dropwise to the glassy carbon electrode to attach CdS quantum dots to the surface of the glassy carbon electrode, and then a primer sequence solution is added dropwise to attach primer sequences to the surface of the glassy carbon electrode.
In one or more embodiments, mercaptoethanol is added after the primer sequence is attached to the surface of the glassy carbon electrode, and incubation is performed at room temperature.
In some embodiments of the embodiment, a sample to be detected containing helicobacter pylori nucleic acid is uniformly mixed with a template sequence, DNA polymerase, dNTP, Bovine Serum Albumin (BSA) and a buffer solution to prepare an RCA reaction solution, the RCA reaction solution is dropwise added to the surface of a primer sensing electrode, and incubation is carried out at 27-33 ℃ for 5-7 hours.
In some examples of the embodiment, a water-soluble silver salt solution is dripped on the surface of the amplification sensing electrode, the amplification sensing electrode is incubated at 3-5 ℃, then a reducing agent is dripped, the amplification sensing electrode is frozen, and then the amplification sensing electrode is reacted overnight at 3-5 ℃.
In some examples of this embodiment, the electrochemiluminescence detection is characterized by a sweep rate set at 90-110 mV s-1The potential is set to-1.4V-0V.
In a third embodiment of the invention, the application of the helicobacter pylori nucleic acid sensor in preparing a reagent for detecting helicobacter pylori is provided.
In a fourth embodiment of the present invention, there is provided a helicobacter pylori detection kit comprising the above-mentioned helicobacter pylori nucleic acid sensor, a buffer solution, and deoxyribonucleoside triphosphates (dntps).
In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.
Example 1
And (4) synthesizing a CdS quantum dot solution.
0.1937g of sodium sulfide (Na) were added at 70 ℃ with constant stirring2S) Na dissolved in 30mL of ultrapure water (fresh)2The S solution was slowly added to 0.1861g of cadmium nitrate tetrahydrate (Cd (NO)3·4H2O) was dissolved in 30mL of ultrapure water to give an orange-yellow solution, refluxed at 70 ℃ for 3 hours, and cooled to room temperature. Transferring the solution to a centrifuge tube 15000r/min, centrifuging for 10min, collecting precipitate, washing with ethanol and ultrapure water once respectively, centrifuging at 15000r/min after each washing to remove supernatant, collecting precipitate, adding pure water for ultrasonic dispersion, centrifuging at 12000 r/min, collecting supernatant to obtain CdS quantum dot solution, wherein the obtained CdS quantum dot fluorescence spectrum is shown in FIG. 2A, and TEM is shown in FIG. 2B.
Modification on the electrode and reaction processes.
1) mu.M template (solvent TE buffer) was heated to 95 ℃ for 10min, and the temperature was reduced by program 0.1 ℃ per second to 25 ℃ for 4 hours. 1 XT 4 DNA ligase reaction buffer and T4 DNA ligase (1U/. mu.L) were added thereto, and reacted overnight at 16 ℃. And finally heating to 65 ℃ and maintaining for 10min, cooling to room temperature, and then placing in a refrigerator at 4 ℃ for later use.
2) Firstly, polishing a glassy carbon electrode by using aluminum powder, performing ultrasonic treatment in water and ethanol for 2min respectively, and drying by using nitrogen. Dripping 8 microliter CdS quantum dot solution on the cleaned glassy carbon electrode, staying overnight, and airing. Then 10. mu.L of 2.5. mu.M primer was dropped onto the electrode at 4 ℃ overnight. The electrode was then rinsed with ultrapure water, blown dry with nitrogen, and incubated with 10. mu.L of 1mM Mercaptoethanol (MCH) for 2 hours at room temperature. And washing the electrode with ultrapure water, drying the electrode with nitrogen, dropwise adding the RCA reaction solution, and incubating for 6 hours at 30 ℃. The RCA reaction solution contained 2. mu.L of 100nM target (helicobacter pylori nucleic acid), 2. mu.L of template, 1. mu.L of 1000U/mL phi29 polymerase, 2. mu.L of 2.5mM dNTP, 0.5. mu.L of 10mg/mL BSA, and 2. mu.L of 10 XPi 29 polymerase reaction buffer. The electrode was then rinsed with ultra pure water and blown dry with nitrogen. 1.44 μ L of 25mM silver nitrate (AgNO)3) The solution was added to 450. mu.L of 20mM PBS (pH 7.3, containing 1.0mM MgCl)2) After being mixed evenly, 10 mu L of the mixture is dripped on an electrode and incubated for 30min at 4 ℃, and the mixture is protected from light. Finally, 10. mu.L of 12.5mM freshly prepared sodium borohydride (NaBH)4) The solution was dropped on the electrode, frozen for 1min, and reacted at 4 ℃ overnight, with care taken away from light.
Electrochemiluminescence detection process.
0.1M PBS (pH 7.3) contains 0.05M potassium persulfate (K)2S2O8) The platinum wire electrode is a counter electrode, the Ag/AgCl electrode is a reference electrode, the modified glassy carbon electrode is a working electrode, and the sweep rate is set to be 100mV s-1The potential is set to-1.4V-0V.
The sequences employed in the examples are as follows:
template:
5'-AGCTTATTCCAGATCCGCTTTATAAATAAGCTTATAACAGGAGGAAGGAGGTGTTATA-3', see SEQ ID NO. 1.
Primer 5 '-SH-ATACCAATATCTGGA-3' shown in SEQ ID NO. 2.
Target: 5'-ATTTATAAAGCGGATATTGGTAT-3', see SEQ ID NO. 3.
The detection principle of this example is shown in FIG. 1, and includes a nucleic acid amplification process and electrochemiluminescence detection.
The nucleic acid amplification process is as follows: firstly, a double hairpin template DNA is constructed by annealing a designed special sequence, and a dumbbell template DNA is formed after adding T4 DNA ligase for ring closure. And modifying and fixing the primer DNA on the substrate gold electrode through a covalent bond, wherein when the target DNA exists, the primer chain, the template chain and the target chain form a trimer stable structure on the substrate gold electrode. Adding phi29 DNA polymerase and ATP, using dNTPs as raw material, initiating DNA replication, extending the primer chain along the direction of the template chain, and breaking the double hairpin structure of the template DNA to form a single loop due to the rigid structure of the double-stranded DNA. As the polymerization reaction continues, the primer chain is extended, the target chain is released, a new cycle can be initiated, and the primer chain forms a long DNA chain with a repetitive sequence under the action of rolling circle amplification.
Electrochemiluminescence detection: CdS quantum dots are pre-hatched on the surface of the electrode to construct CdS-S2O8 -An electrochemiluminescent system. After the surface of the electrode generates a DNA long chain with a repetitive sequence under the drive of a target sequence, silver nitrate and sodium borohydride are used for synthesizing a nano silver cluster on the DNA long chain rich in C basic group, and the silver cluster can catalyze S2O8 -Decomposition reaction occurs, and the co-reactant on the surface of the electrode is consumed, so that the electrochemiluminescence signal is quenched. The more the target sequence is, the more the DNA long chain is generated, so that the number of nano silver clusters is increased, the quenching effect is enhanced, and the ECL signal is reduced.
The RCA process can be verified using polyacrylamide gel electrophoresis experiments. The verification results are shown in fig. 3. Primer, target DNA, and template single strands were added to lanes 2, 3, and 4, respectively, to form a single band on the gel-run map. Lanes 5 and 6 contain two different single-stranded combinations primer + template and target + template, with only two bands indicating that no stable duplex is formed between the two single strands. In lane 7, primer, target DNA and template are added simultaneously, and a new band is observed at the boxed position, demonstrating that the three single strands have reacted to form a trimer. Finally, we performed characterization of RCA cycles for No. 8 and No. 9, where no target DNA was added for negative control No. 8. As shown in the results of fig. 3: the band appearing in the sample addition region in lane 9 demonstrates the generation of a long DNA chain with a high base number, whereas the band is not seen in the negative control group, indicating the generation of the RCA product chain.
The electrochemiluminescence detection result is shown in FIG. 4, and the prepared CdS nanocrystalline film and coreactant S can be seen from the curve 12O8 2-The ions can generate strong and stable ECL luminescence, when RCA circulation is triggered by the target sequence and silver clusters are synthesized, luminescent signals are quenched strongly due to the consumption effect of the silver clusters, a curve 2 is ECL signals after 1nM target sequences are used for reaction, and obvious signal reduction can be seen compared with a curve 1, and the quenching efficiency reaches 95%.
The electrochemiluminescence detection results of targets with different concentrations are shown in FIG. 5, a working curve is established by using final ECL signals generated after RCA circulation is triggered by target sequences with different concentrations, the detection limit is 1pM, and the linear interval is 10 pM-100 nM. The method provided by the embodiment is proved to have a wider linear range, a lower detection limit and an ultra-sensitive detection performance.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Fujian medical university
<120> helicobacter pylori nucleic acid sensor, detection method and application
<130>
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 58
<212> DNA
<213> Artificial sequence
<400> 1
agcttattcc agatccgctt tataaataag cttataacag gaggaaggag gtgttata 58
<210> 2
<211> 15
<212> DNA
<213> Artificial sequence
<400> 2
ataccaatat ctgga 15
<210> 3
<211> 23
<212> DNA
<213> Artificial sequence
<400> 3
atttataaag cggatattgg tat 23
Claims (15)
1. A helicobacter pylori nucleic acid sensor is characterized by comprising a glassy carbon electrode, a primer sequence, a template sequence, DNA ligase, DNA polymerase, a water-soluble silver salt and a reducing agent; the surface of the glassy carbon electrode is connected with a primer sequence and CdS quantum dots;
the template sequence can form a dumbbell-shaped structure, and the dumbbell-shaped structure can be connected and closed by DNA ligase; the template sequence, the primer sequence and the helicobacter pylori nucleic acid sequence can form a tripolymer structure, the tripolymer structure can enable the primer sequence to carry out rolling circle amplification under the action of DNA polymerase, and the amplified DNA long chain has a repetitive sequence rich in cytosine base;
the sequence of the nucleic acid chain from the 5 'end to the 3' end of the template sequence is AGCTTATTCCAGATCCGCTTTATAAATAAGCTTATAACAGGAGGAAGGAGGTGTTATA;
the sequence of the nucleic acid chain of the primer sequence from 5 'end to 3' end is ATACCAATATCTGGA;
the nucleic acid chain sequence of the helicobacter pylori nucleic acid from 5 'end to 3' end is ATTTATAAAGCGGATATTGGTAT.
2. The helicobacter pylori nucleic acid sensor according to claim 1, wherein the 5' -end of the primer sequence is modified to a thiol group.
3. The helicobacter pylori nucleic acid sensor according to claim 1, wherein mercaptoethanol is connected to the surface of the glassy carbon electrode.
4. The helicobacter pylori nucleic acid sensor according to claim 1, wherein the DNA ligase is T4 DNA ligase.
5. The helicobacter pylori nucleic acid sensor according to claim 1, wherein the DNA polymerase is phi29 DNA polymerase.
6. Use of the helicobacter pylori nucleic acid sensor according to any one of claims 1 to 5 in preparation of a reagent for detecting helicobacter pylori.
7. The use according to claim 6, wherein a helicobacter pylori nucleic acid sensor according to any one of claims 1 to 5 is provided; the following steps are adopted for detection:
incubating the template sequence into a dumbbell-shaped structure, and connecting and closing the two ends of the DNA of the dumbbell-shaped structure by using DNA ligase;
connecting the surface of the glassy carbon electrode with a primer sequence and CdS quantum dots to obtain a primer sensing electrode;
incubating a sample containing helicobacter pylori nucleic acid to be detected with a template sequence with a closed dumbbell-shaped structure and a sensing electrode, so that a primer sequence on the surface of the sensing electrode, the template sequence and the helicobacter pylori nucleic acid form a trimer structure, and under the action of DNA polymerase, the primer sequence with the trimer structure is subjected to rolling circle amplification to obtain a long chain with a repeat sequence, so that the primer sensing electrode becomes an amplification sensing electrode;
adding water-soluble silver salt and a reducing agent into the amplified sensing electrode, and carrying out reduction reaction to enable the nano silver cluster loaded on the amplified DNA long chain to obtain an electrochemical sensing electrode;
electrochemiluminescence detection is carried out in persulfate solution by taking an electrochemical sensing electrode as a working electrode.
8. The application of claim 7, wherein the CdS quantum dot is prepared by the following steps: and (3) dropwise adding the sodium sulfide solution to cadmium nitrate at 65-75 ℃, and carrying out reflux reaction.
9. The use according to claim 7, wherein the incubation of the template sequence into a dumbbell structure is carried out by: incubating for 5-15 min at 93-97 ℃, cooling to 20-30 ℃ at the speed of 0.05-0.15 ℃/s, and standing for 3-5 h.
10. The method of claim 7, wherein the template sequence is incubated into a dumbbell structure, then added with DNA ligase to react at 15-17 ℃ overnight, heated to 60-70 ℃ for 5-15 min, and then cooled to room temperature.
11. The use of claim 7, wherein the CdS quantum dot solution is dropped onto the glassy carbon electrode to connect CdS quantum dots to the surface of the glassy carbon electrode, and then the primer sequence solution is dropped to connect the primer sequence to the surface of the glassy carbon electrode.
12. The application of claim 7, wherein a sample to be tested containing helicobacter pylori nucleic acid is uniformly mixed with a template sequence, DNA polymerase, dNTP, bovine serum albumin and a buffer solution to prepare an RCA reaction solution, the RCA reaction solution is dripped onto the surface of a primer sensing electrode, and the primer sensing electrode is incubated at 27-33 ℃ for 5-7 hours.
13. The method as claimed in claim 7, wherein the water soluble silver salt solution is dropped on the surface of the amplification sensing electrode, the amplification sensing electrode is incubated at 3-5 ℃, then the reducing agent is dropped on the surface of the amplification sensing electrode, the amplification sensing electrode is frozen, and then the amplification sensing electrode is reacted overnight at 3-5 ℃.
14. Use according to claim 7, wherein the parameter of electrochemiluminescence detection is scanningThe speed is set to 90-110 mV s-1The potential is set to-1.4V-0V.
15. A helicobacter pylori detection kit, comprising the helicobacter pylori nucleic acid sensor according to any one of claims 1 to 5, a buffer solution, and deoxyribonucleoside triphosphates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010597081.3A CN111733264B (en) | 2020-06-28 | 2020-06-28 | Helicobacter pylori nucleic acid sensor, detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010597081.3A CN111733264B (en) | 2020-06-28 | 2020-06-28 | Helicobacter pylori nucleic acid sensor, detection method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111733264A CN111733264A (en) | 2020-10-02 |
| CN111733264B true CN111733264B (en) | 2022-05-17 |
Family
ID=72651329
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010597081.3A Active CN111733264B (en) | 2020-06-28 | 2020-06-28 | Helicobacter pylori nucleic acid sensor, detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111733264B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113355400B (en) * | 2021-04-06 | 2023-08-22 | 南京师范大学 | Cadmium ion detection method based on T3 DNA ligase |
| CN113388616B (en) * | 2021-07-27 | 2022-04-26 | 中国海洋大学 | Aptamer specifically binding to helicobacter pylori, biological element, biosensor and detection method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101608210A (en) * | 2008-06-18 | 2009-12-23 | 中山大学达安基因股份有限公司 | Quantitative detection kit for helicobacter pylori nucleic acid |
| CN109182569A (en) * | 2018-10-31 | 2019-01-11 | 济南市中心医院 | The loop-mediated isothermal amplification detection method and kit of high virulence helicobacter pylori |
| CN109628457A (en) * | 2019-02-03 | 2019-04-16 | 淮海工学院 | Single stranded DNA nucleic acid aptamers and its screening technique and purposes |
| CN110982881A (en) * | 2019-12-20 | 2020-04-10 | 宁波美康盛德医学检验所有限公司 | Molecular beacon probe and kit for detecting helicobacter pylori and detection method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060199187A1 (en) * | 2005-03-02 | 2006-09-07 | Meyerhoff Mark E | Enzyme amplified electrochemical DNA detection |
-
2020
- 2020-06-28 CN CN202010597081.3A patent/CN111733264B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101608210A (en) * | 2008-06-18 | 2009-12-23 | 中山大学达安基因股份有限公司 | Quantitative detection kit for helicobacter pylori nucleic acid |
| CN109182569A (en) * | 2018-10-31 | 2019-01-11 | 济南市中心医院 | The loop-mediated isothermal amplification detection method and kit of high virulence helicobacter pylori |
| CN109628457A (en) * | 2019-02-03 | 2019-04-16 | 淮海工学院 | Single stranded DNA nucleic acid aptamers and its screening technique and purposes |
| CN110982881A (en) * | 2019-12-20 | 2020-04-10 | 宁波美康盛德医学检验所有限公司 | Molecular beacon probe and kit for detecting helicobacter pylori and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| Silver Nanoclusters for High-Efficiency Quenching of CdS Nanocrystal Electrochemiluminescence and Sensitive Detection of microRNA;Zhang YanYan等;《Acs Appl Mater Interfaces》;20151111;全文 * |
| 基于目标物引发的滚环扩增信号放大策略构建电致化学发光传感器用于microRNA检测;何晓静等;《化学传感器》;20170315;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111733264A (en) | 2020-10-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111733264B (en) | Helicobacter pylori nucleic acid sensor, detection method and application | |
| Tang et al. | Highly sensitive and rapid detection of Pseudomonas aeruginosa based on magnetic enrichment and magnetic separation | |
| CN107101997B (en) | A kind of building of the electrochemical luminescence sensor for acetyltransferase activity detection | |
| Ye et al. | Ultrasensitive electrochemical DNA sensor for virulence invA gene of Salmonella using silver nanoclusters as signal probe | |
| CN104792753B (en) | Suppress to click on the biological method for sensing that chemical reaction detects smaller ligand target protein based on combining | |
| CN109655512A (en) | A kind of excretion body detecting method based on aptamers and rolling circle amplification | |
| CN106323951B (en) | The preparation method of the electrogenerated chemiluminescence cell sensor of super sensitivity detection cancer cell | |
| KR102310223B1 (en) | Composition for Cell-lysis to apply to a structure with a lab-on-paper chip | |
| Krishnan | Colorimetric visual sensors for point-of-needs testing | |
| CN111440851B (en) | Electrochemical biosensor for detecting miRNA and preparation method and application thereof | |
| CN109540860B (en) | Fluorescent biosensor for detecting kanamycin and preparation method and application thereof | |
| Chu et al. | Recent advances and challenges of biosensing in point-of-care molecular diagnosis | |
| CN109507256B (en) | Unmarked electrochemiluminescence aptamer sensor for detecting carcino-embryonic antigen and preparation method and using method thereof | |
| CN113237928A (en) | Electrochemical luminescence sensor for detecting hepatitis B virus DNA and preparation and application thereof | |
| CN110257482A (en) | A kind of blood coagulation enzyme assay method based on aptamer and telomere enzymatic amplification | |
| CN114410790B (en) | Biosensing detection system for detecting ctDNA and detection method thereof | |
| Cao et al. | An ultrasensitive biosensor for virulence ompA gene of Cronobacter sakazakii based on boron doped carbon quantum dots-AuNPs nanozyme and exonuclease III-assisted target-recycling strategy | |
| Liu et al. | A novel method for sensitive detection of Escherichia coli O157: H7 based on an aptamer and hybridization chain reaction | |
| CN113913561B (en) | SARS-CoV-2 delta variant strain detection method based on primer design and copper nano cluster | |
| Wasiewska et al. | Electrochemical nucleic acid‐based sensors for detection of Escherichia coli and Shiga toxin‐producing E. coli—Review of the recent developments | |
| CN108982458A (en) | A kind of magnetic bead particles based on deoxyribozyme modification are used for the fluorescent method of zinc ion detection | |
| CN111337557A (en) | Based on CeO2@MnO2Preparation method and application of immunosensor | |
| Shahrashoob et al. | Detection of Helicobacter pylori genome with an optical biosensor based on hybridization of urease gene with a gold nanoparticles-labeled probe | |
| CN113249443B (en) | Amplification detection method of prefabricated amplification unit based on DNA self-assembly | |
| CN114965984A (en) | Preparation method of fluorescence sensor based on hairpin DNA chain cascade DNA assembly reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |