CN111705043A - Ketoreductase mutant with improved catalytic activity and application thereof - Google Patents
Ketoreductase mutant with improved catalytic activity and application thereof Download PDFInfo
- Publication number
- CN111705043A CN111705043A CN202010647366.3A CN202010647366A CN111705043A CN 111705043 A CN111705043 A CN 111705043A CN 202010647366 A CN202010647366 A CN 202010647366A CN 111705043 A CN111705043 A CN 111705043A
- Authority
- CN
- China
- Prior art keywords
- ala
- ser
- val
- gly
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/02—Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
- C12P41/002—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by oxidation/reduction reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01002—Alcohol dehydrogenase (NADP+) (1.1.1.2), i.e. aldehyde reductase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The embodiment of the invention discloses a ketoreductase mutant with improved catalytic activity and application thereof, belonging to the technical field of biological catalysis methods and application, wherein the ketoreductase mutant is derived from wild ketoreductase of Starmerella magnoliae, can convert 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol into (2S,3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, has higher alcohol dehydrogenase activity compared with a wild sequence, has more than 90% of similarity with SEQ ID NO.8 and has one or more mutations in the following characteristics: I54E, S85A and K182V, wherein the sequence of the ketoreductase mutant is SEQ ID NO. 6. The invention uses alcohols for coenzyme circulation, the concentration of the substrate is as high as 110g/L, the dosage of the substrate/NADP dosage is as high as 1100:1, the circulating times of the coenzyme are high, and the downstream application range is effectively enlarged.
Description
Technical Field
The invention belongs to the technical field of biological catalysis methods and application, and particularly relates to a ketoreductase mutant with improved catalytic activity and application thereof.
Background
Darunavir, also known as darunavir, sold under the tradename Prezista, is a non-peptide aids protease inhibitor for use by qiangsheng corporation, which was approved by the U.S. Food and Drug Administration (FDA) for marketing in 2006. 2011 the united states Food and Drug Administration (FDA) announced approval of an oral suspension formulation of Prezista (darunavir). Is the second non-peptide protease inhibitor on the market worldwide and is one of the major anti-AIDS drugs in the world at present.
(2S,3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol is used as a key intermediate for preparing darunavir, and the main production processes at present comprise a chemical synthesis method and a biological method, wherein the biological method can be obtained by performing biotransformation on 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol by using corresponding ketoreductase or microbial whole cells.
Ketoreductases are versatile catalysts that selectively reduce an aldehyde or ketone enantiomer to the corresponding alcohol. The (R) -specific ketoreductase enzymes have different properties from the (S) -specific ketoreductase enzymes, and these catalysts are used more and more frequently in the industrial synthesis of optically active alcohols. Optical activity is a prerequisite for the selective action of many pharmaceutically and pesticidally active compounds, in some cases one enantiomer having beneficial pharmaceutical activity and the other enantiomer having genotoxic effect. Therefore, in the synthesis of active compounds for pharmaceutical and agricultural chemicals, it is necessary to synthesize optically active alcohols using a catalyst having the required stereospecificity.
The published report shows that brazilian Amanda et al biologically prepare (2S,3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol (DOI:10.1002/cctc.201403023) by asymmetrically reducing (3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanone using RasADH, a source of Ralstonia sp, to produce (2S,3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol. The method uses coenzyme NADPH, has high market price and limits the application to a certain extent. The concentration of the substrate is 10mg/ml converted into 10g/L, and the optical purity is only 90%, so that the preparation requirements of related medical intermediates cannot be met.
JP4746548B2, the earliest proposition to biologically prepare (2R, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, utilizes a novel carbonyl-escapement enzyme to asymmetrically reduce (3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanone to produce (2R, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol. The patent was also filed in china and granted 2011 (CN 1993464B). Other companies such as Codexis in the United states optimize and promote the conditions such as enzyme types, reaction conditions, coenzyme circulation and the like, and further improve the production efficiency so as to reduce the requirements and cost of the conditions (US 8796002). At present, (2R, 3S) alcohol can be industrially amplified by ketoreductase mutant (not less than 100g/L substrate), but the industrial production of (2S,3S) alcohol is not reported.
There have been various reports on attempts to produce (2R, 3S) or (2S,3S) compounds using ketoreductases derived from microorganisms, such as Candida grophylogenesseri, Candida sp, Candida vaccinii, Candida geochromes, and the like. But still has the problems of low optical purity (50-70 percent) or low conversion rate and the like, and has no practical production prospect.
Disclosure of Invention
The invention aims to solve the technical problems of low enzyme activity and low conversion efficiency in the catalytic preparation process of (2S,3S) -1-chloro-3-tert-butyloxycarbonylamino-4-phenyl-2-butanol in the prior art. Provides a ketoreductase mutant method for producing a darunavir intermediate, which has the technical scheme as follows:
a ketoreductase mutant with improved enzymatic activity, which is derived from wild-type ketoreductase of Starmerella magnolae, can convert 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol to (2S,3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, has higher alcohol dehydrogenase activity than the wild-type sequence, has more than 90% similarity to SEQ ID NO.8, and has one or more of the following characteristics: I54E, S85A and K182V, wherein the sequence of the ketoreductase mutant is SEQ ID NO. 6.
Preferably, the ketoreductase mutant has an enzymatic activity that is at least 2-15 fold enhanced over the activity of the wild-type ketoreductase.
A polynucleotide encoding a ketoreductase recombinant polypeptide having the sequence of SEQ ID No. 6.
Preferably, the sequence of the polynucleotide is SEQ ID NO. 5.
A recombinant plasmid comprising an expression vector having a polynucleotide having the sequence of SEQ ID No.5 attached thereto.
A host cell comprising the recombinant plasmid of claim 5.
Preferably, the cell is an E.coli cell.
Preferably, the codons of the recombinant plasmid have been optimized for expression in a host cell.
By adopting the technical scheme, the technical effects are as follows:
wild-type ketoreductase enzyme derived from Starmerella magnolae, capable of converting 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol to (2S,3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, ketoreductase mutant having higher alcohol dehydrogenase activity than the wild-type sequence, greater than 90% similarity to SEQ ID NO.8 and having one or more of the following characteristics: I54E, S85A and K182V, wherein the sequence of the ketoreductase mutant is SEQ ID NO. 6. The whole system of the invention uses single enzyme for catalysis, uses alcohol for coenzyme circulation, has the substrate concentration as high as 110g/L, the substrate dosage/NADP dosage as high as 1100:1, has high coenzyme circulation frequency, and effectively enlarges the downstream application range. The method has the advantages of low requirement on equipment, no need of high temperature or cooling in the production process, low energy consumption, high efficiency and specific selectivity of enzyme catalysis, no byproduct generation and convenient purification of the key intermediate (2S,3S) -1-chloro-3-tert-butyloxycarbonylamino-4-phenyl-2-butanol produced by the method; the concentration of the substrate can reach 110g/L, which is about 10 times of that of a reference document, and in addition, the reaction solvent is mainly water, so that the three wastes are low in emission and the method is green and environment-friendly.
Drawings
FIG. 1 is a map of an expression plasmid for Sma-3;
FIG. 2 is a TLC image of the Sma, Sma-3 bioconversion reaction for 3 hours, with Sma in the first column from left to right, Sma-3 in the fourth column, substrate in the upper band and product in the lower band.
Detailed Description
In order to better explain the invention, the invention is further illustrated below with reference to examples. The instruments and reagents used in the present examples are commercially available products unless otherwise specified.
Example 1
The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method so as to realize high expression in escherichia coli. The splicing primers are obtained by utilizing Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /) to carry out design, and ensuring that the Tm difference is controlled within 3 ℃ and the Primer length is controlled within 60 base.
The above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.
The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 55 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.5 and is named as Sma-3, and the corresponding amino acid sequence is SEQ ID NO. 6. The expression plasmid map is shown in FIG. 1.
Example 2 Synthesis of control protein CKSm Gene sequences
According to the sequence shown in SEQ ID NO.7, the Nanjing Kinshire organism is entrusted to carry out whole gene synthesis on the coding sequence of the protein, and the coding sequence is cloned into pET30a to obtain a control protein expression plasmid NYK-CKSm. The corresponding amino acid sequence is SEQID NO. 8.
Example 3 Shake flask expression test
Coli single colonies containing the expression vector were picked and inoculated into 10ml of autoclaved medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin to 50 mg/L. The culture was carried out at 30 ℃ and 250rpm overnight. Taking a 1L triangular flask the next day, and carrying out the following steps: 100 into 100ml of autoclaved medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L. The cells were cultured at 30 ℃ until the OD 5-6 of the cells became zero, and the cells were immediately placed in a flask in a shaker at 25 ℃ and cultured at 250rpm for 1 hour. IPTG was added to a final concentration of 0.1mM and incubation was continued at 25 ℃ for 16 hours at 250 rpm. After completion of the culture, the culture was centrifuged at 12000g at 4 ℃ for 20 minutes to collect wet cells. Then the bacterial pellet is washed twice with distilled water, and the bacterial is collected and preserved at-70 ℃. Meanwhile, a small amount of thallus is taken for SDS-PAGE detection.
Example 4 fed-batch fermentation
The fed-batch fermentation was carried out in a computer-controlled bioreactor (Shanghai Seisaku) with a reactor capacity of 15L and a working volume of 8L, using 24g/L yeast extract, 12g/L peptone, 0.4% glucose, 2.31g/L catalase phosphate and 12.54g/L dipotassium hydrogen phosphate as the medium, pH 7.0. 200ml of culture was prepared for the primary inoculum and inoculated at OD 2.0. Throughout the fermentation, the temperature was maintained at 37 ℃, the dissolved oxygen concentration during fermentation was automatically controlled at 30% by the agitation rate (rpm) and aeration supply cascade, while the pH of the medium was maintained at 7.0 by 50% (v/v) orthophosphoric acid and 30% (v/v) aqueous ammonia. During the fermentation, when a large amount of dissolved oxygen rises, feeding is started. The feed solution contained 9% w/v peptone, 9% w/v yeast extract, 14% w/v glycerol. Induction with 0.2mM IPTG occurred at an OD600 of about 35.0 (wet weight of about 60 g/L).
Example 5 bioconversion reactions
Adding a magneton stirrer into a 500ml three-mouth beaker, sequentially adding 3ml of toluene, 21ml of isopropanol and 21g of 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, uniformly mixing the mixture to obtain a pre-melting substrate, and adding 1mM MgCl20.1M PBpH8.5 made the total about 190ml, and after mixing the pH was adjusted to 8.5. Finally, 21mg of NADP and 10ml of crude enzyme Sma-3 are added, and the mixture is reacted in water bath at 30 ℃.
Example 6 bioconversion reactions
Adding a magneton stirrer into a 500ml three-mouth beaker, sequentially adding 3ml of toluene, 21ml of isopropanol and 21g of 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, uniformly mixing the mixture to obtain a pre-melting substrate, and adding 1mM MgCl20.1M PBpH8.5 made the total about 190ml, and after mixing the pH was adjusted to 8.5. Finally, 21mg of NADP and 10ml of crude enzyme Sma are added, and the mixture is reacted in a water bath at 30 ℃.
Example 7 thin layer chromatography
The 3-hour reaction conversion system in the above example was subjected to TLC detection, and the results are shown in FIG. 2. It can be seen that the substrate residue of Sma-3 is significantly less than that of the control Sma, and that almost no substrate residue of Sma-3 remains, so that it can be judged that Sma-3 has a significantly better reaction rate in catalyzing 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol than the wild-type protein Sma before mutation.
Example 8 enzyme Activity detection
Taking 65 ml centrifuge tubes, respectively marking 1-6, respectively adding 3mM NADPH solution 0ul, 40ul, 80ul, 100ul, 120ul and 160ul, then supplementing 0.1M phosphate buffer solution with pH7.0 to 3ml each tube, mixing uniformly, detecting at 340nm and recording the absorbance value; from the above-mentioned measured values, a standard curve Y of NADPH, where Y is the value of absorbance, X is the concentration (mM) of NADPH, and R of the curve is obtained2>99.5 percent; diluting the enzyme solution with pure water by a certain ratio (reference dilution)Multiple: 600-1000 times), the dilution is proper, and the light absorption value per minute is changed by 0.02-0.04 by the dilution times; 5ml of centrifuge tube is taken, the samples are added into the centrifuge tube according to the following proportion, the mixture is quickly mixed, and the mixture is immediately poured into a cuvette.
Detecting the change in absorbance at 340nm, recording the value every 1min, and the rate of change is substantially the same every minute, wherein the absorbance at 0min is S0And absorbance at 3min is S3；
The enzyme activity calculation formula is as follows:
enzyme activity (U/ml) [ (S0-S3) × 3ml × N ]/[ kXtime (t/min) × enzyme addition (ml) ]
Wherein N is the dilution multiple of the enzyme solution.
The detection results are as follows:
therefore, the alcohol dehydrogenase mutant provided by the invention has the alcohol dehydrogenase activity at least 2-15 times higher than that of the wild-type alcohol dehydrogenase. The conversion rate of a substrate (e.g., 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol) to a product (e.g., (2S,3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol) is greatly increased as compared to a wild-type alcohol dehydrogenase. And further, the substrate concentration of unit volume is increased, and the production efficiency is improved during industrial amplification.
The above description is only for the purpose of illustrating the present invention and is not intended to limit the scope of the present invention, and any person skilled in the art can substitute or change the technical solution of the present invention and its conception within the scope of the present invention.
Sequence listing
<110> Nanjing Langen Biotech Ltd
<120> ketoreductase mutant with improved catalytic activity and application thereof
<130>2020
<160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>741
<212>DNA
<213> Artificial sequence ()
<400>1
atgacctctt cttcttctcc gtctctgaac gctctggtta ccggtggttc tcgtggtatc 60
ggtgaagcta tctctatgca gctggctgct gaaggttact ctgttaccat cgcttctcgt 120
ggtctggaacagctggaagc tgttaaagct aaactgccgg aagttaaaca gggtcagacc 180
caccacgttt ggcagctgga cctgtctgac gttgaagctg ctggttcttt caaaggtgct 240
ccgctgccgg ctgcttctta cgacgttttc gtttctaacg ctggtatctc tcagttctct 300
ccgatcgctg aacacgctga cgctgactgg cagaacatgc tgaccgttaa cctgaccgct 360
ccgatcgctc tgaccaaagc tgttgttaaa gctatctctg acaaaccgcg tcagaccccg 420
gctcacatca tcttcatctc taccggtctg tctaaacgtg gtgctccgat ggttggtgtt 480
tactctgctt ctaaagctgg tatcgacggt ttcatgcgtt ctctggctcg tgaactgggt 540
ccggttggta tcaacgttaa ctgcgtttct ccgggtgtta cccgtacctc tatggctgaa 600
ggtatcgacc cgtctatgtt cgacctgccg atcaacggtt ggatcgaagt tgacgctatc 660
gctgacgctg ttacctacct ggttaaatct aaaaacgtta ccggtaccac cgtttctgtt 720
gacaacggtt actgcgctta a 741
<210>2
<211>246
<212>PRT
<213> Artificial sequence ()
<400>2
Met Thr Ser Ser Ser Ser Pro Ser Leu Asn Ala Leu Val Thr Gly Gly
1 5 10 15
Ser Arg Gly Ile Gly Glu Ala Ile Ser Met Gln Leu Ala Ala Glu Gly
20 25 30
Tyr Ser Val Thr Ile Ala Ser Arg Gly Leu Glu Gln Leu Glu Ala Val
35 40 45
Lys Ala Lys Leu Pro Glu Val Lys Gln Gly Gln Thr His His Val Trp
50 55 60
Gln Leu Asp Leu Ser Asp Val Glu Ala Ala Gly Ser Phe Lys Gly Ala
65 70 75 80
Pro Leu Pro Ala Ala Ser Tyr Asp Val Phe Val Ser Asn Ala Gly Ile
85 90 95
Ser Gln Phe Ser Pro Ile Ala Glu His Ala Asp Ala Asp Trp Gln Asn
100 105 110
Met Leu Thr Val Asn Leu Thr Ala Pro Ile Ala Leu Thr Lys Ala Val
115 120 125
Val Lys Ala Ile Ser Asp Lys Pro Arg Gln Thr Pro Ala His Ile Ile
130 135 140
Phe Ile Ser Thr Gly Leu Ser Lys Arg Gly Ala Pro Met Val Gly Val
145 150 155 160
Tyr Ser Ala Ser Lys Ala Gly Ile Asp Gly Phe Met Arg Ser Leu Ala
165 170 175
Arg Glu Leu Gly Pro Val Gly Ile Asn Val Asn Cys Val Ser Pro Gly
180 185 190
Val Thr Arg Thr Ser Met Ala Glu Gly Ile Asp Pro Ser Met Phe Asp
195 200 205
Leu Pro Ile Asn Gly Trp Ile Glu Val Asp Ala Ile Ala Asp Ala Val
210 215 220
Thr Tyr Leu Val Lys Ser Lys Asn Val Thr Gly Thr Thr Val Ser Val
225 230 235 240
Asp Asn Gly Tyr Cys Ala
245
<210>3
<211>741
<212>DNA
<213> Artificial sequence ()
<400>3
atgacctctt cttcttctcc gtctctgaac gctctggtta ccggtggttc tcgtggtatc 60
ggtgaagcta tctctatgca gctggctgct gaaggttact ctgttaccat cgcttctcgt 120
ggtctggaac agctggaagc tgttaaagct aaactgccgg aagttaaaca gggtcagacc 180
caccacgttt ggcagctgga cctgtctgac gttgaagctg ctggttcttt caaaggtgct 240
ccgctgccgg cttcttctta cgacgttttc gtttctaacg ctggtatctc tcagttctct 300
ccgatcgctg aacacgctga cgctgactgg cagaacatgc tgaccgttaa cctgaccgct 360
ccgatcgctc tgaccaaagc tgttgttaaa gctatctctg acaaaccgcg tcagaccccg 420
gctcacatca tcttcatctc taccggtctg tctaaacgtg gtgctccgat ggttggtgtt 480
tactctgctt ctaaagctgg tatcgacggt ttcatgcgtt ctctggctcg tgaactgggt 540
ccggttggta tcaacgttaa ctgcgtttct ccgggtgtta cccgtacctc tatggctgaa 600
ggtatcgacc cgtctatgtt cgacctgccg atcaacggtt ggatcgaagt tgacgctatc 660
gctgacgctg ttacctacct ggttaaatct aaaaacgtta ccggtaccac cgtttctgtt 720
gacaacggtt actgcgctta a 741
<210>4
<211>246
<212>PRT
<213> Artificial sequence ()
<400>4
Met Thr Ser Ser Ser Ser Pro Ser Leu Asn Ala Leu Val Thr Gly Gly
1 5 10 15
Ser Arg Gly Ile Gly Glu Ala Ile Ser Met Gln Leu Ala Ala Glu Gly
20 25 30
Tyr Ser Val Thr Ile Ala Ser Arg Gly Leu Glu Gln Leu Glu Ala Val
35 40 45
Lys Ala Lys Leu Pro Glu Val Lys Gln Gly Gln Thr His His Val Trp
50 55 60
Gln Leu Asp Leu Ser Asp Val Glu Ala Ala Gly Ser Phe Lys Gly Ala
65 70 75 80
Pro Leu Pro Ala Ser Ser Tyr Asp Val Phe Val Ser Asn Ala Gly Ile
85 90 95
Ser Gln Phe Ser Pro Ile Ala Glu His Ala Asp Ala Asp Trp Gln Asn
100 105 110
Met Leu Thr Val Asn Leu Thr Ala Pro Ile Ala Leu Thr Lys Ala Val
115 120 125
Val Lys Ala Ile Ser Asp Lys Pro Arg Gln Thr Pro Ala His Ile Ile
130 135 140
Phe Ile Ser Thr Gly Leu Ser Lys Arg Gly Ala Pro Met Val Gly Val
145 150 155 160
Tyr Ser Ala Ser Lys Ala Gly Ile Asp Gly Phe Met Arg Ser Leu Ala
165 170 175
Arg Glu Leu Gly Pro Val Gly Ile Asn Val Asn Cys Val Ser Pro Gly
180 185 190
Val Thr Arg Thr Ser Met Ala Glu Gly Ile Asp Pro Ser Met Phe Asp
195 200 205
Leu Pro Ile Asn Gly Trp Ile Glu Val Asp Ala Ile Ala Asp Ala Val
210 215 220
Thr Tyr Leu Val Lys Ser Lys Asn Val Thr Gly Thr Thr Val Ser Val
225 230 235 240
Asp Asn Gly Tyr Cys Ala
245
<210>5
<211>741
<212>DNA
<213> Artificial sequence ()
<400>5
atgacctctt cttcttctcc gtctctgaac gctctggtta ccggtggttc tcgtggtatc 60
ggtgaagcta tctctatgca gctggctgct gaaggttact ctgttaccat cgcttctcgt 120
ggtctggaac agctggaagc tgttaaagct aaactgccga tcgttaaaca gggtcagacc 180
caccacgttt ggcagctgga cctgtctgac gttgaagctg ctggttcttt caaaggtgct 240
ccgctgccgg cttcttctta cgacgttttc gtttctaacg ctggtatctc tcagttctct 300
ccgatcgctg aacacgctga cgctgactgg cagaacatgc tgaccgttaa cctgaccgct 360
ccgatcgctc tgaccaaagc tgttgttaaa gctatctctg acaaaccgcg tcagaccccg 420
gctcacatca tcttcatctc taccggtctg tctaaacgtg gtgctccgat ggttggtgtt 480
tactctgctt ctaaagctgg tatcgacggt ttcatgcgtt ctctggctcg tgaactgggt 540
ccggttggta tcaacgttaa ctgcgtttct ccgggtgtta cccgtacctc tatggctgaa 600
ggtatcgacc cgtctatgtt cgacctgccg atcaacggtt ggatcgaagt tgacgctatc 660
gctgacgctg ttacctacct ggttaaatct aaaaacgtta ccggtaccac cgtttctgtt 720
gacaacggtt actgcgctta a 741
<210>6
<211>246
<212>PRT
<213> Artificial sequence ()
<400>6
Met Thr Ser Ser Ser Ser Pro Ser Leu Asn Ala Leu Val Thr Gly Gly
1 5 10 15
Ser Arg Gly Ile Gly Glu Ala Ile Ser Met Gln Leu Ala Ala Glu Gly
20 25 30
Tyr Ser Val Thr Ile Ala Ser Arg Gly Leu Glu Gln Leu Glu Ala Val
35 40 45
Lys Ala Lys Leu Pro Ile Val Lys Gln Gly Gln Thr His His Val Trp
50 55 60
Gln Leu Asp Leu Ser Asp Val Glu Ala Ala Gly Ser Phe Lys Gly Ala
65 70 75 80
Pro Leu Pro Ala Ser Ser Tyr Asp Val Phe Val Ser Asn Ala Gly Ile
85 90 95
Ser Gln Phe Ser Pro Ile Ala Glu His Ala Asp Ala Asp Trp Gln Asn
100 105 110
Met Leu Thr Val Asn Leu Thr Ala Pro Ile Ala Leu Thr Lys Ala Val
115 120 125
Val Lys Ala Ile Ser Asp Lys Pro Arg Gln Thr Pro Ala His Ile Ile
130 135 140
Phe Ile Ser Thr Gly Leu Ser Lys Arg Gly Ala Pro Met Val Gly Val
145 150 155 160
Tyr Ser Ala Ser Lys Ala Gly Ile Asp Gly Phe Met Arg Ser Leu Ala
165 170 175
Arg Glu Leu Gly Pro Val Gly Ile Asn Val Asn Cys Val Ser Pro Gly
180 185 190
Val Thr Arg Thr Ser Met Ala Glu Gly Ile Asp Pro Ser Met Phe Asp
195 200 205
Leu Pro Ile Asn Gly Trp Ile Glu Val Asp Ala Ile Ala Asp Ala Val
210 215 220
Thr Tyr Leu Val Lys Ser Lys Asn Val Thr Gly Thr Thr Val Ser Val
225 230 235 240
Asp Asn Gly Tyr Cys Ala
245
<210>7
<211>741
<212>DNA
<213> Artificial sequence ()
<400>7
atgacctctt cttcttctcc gtctctgaac gctctggtta ccggtggttc tcgtggtatc 60
ggtgaagcta tctctatgca gctggctgct gaaggttact ctgttaccat cgcttctcgt 120
ggtctggaac agctggaagc tgttaaagct aaactgccga tcgttaaaca gggtcagacc 180
caccacgttt ggcagctgga cctgtctgac gttgaagctg ctggttcttt caaaggtgct 240
ccgctgccgg cttcttctta cgacgttttc gtttctaacg ctggtatctc tcagttctct 300
ccgatcgctg aacacgctga cgctgactgg cagaacatgc tgaccgttaa cctgaccgct 360
ccgatcgctc tgaccaaagc tgttgttaaa gctatctctg acaaaccgcg tcagaccccg 420
gctcacatca tcttcatctc taccggtctg tctaaacgtg gtgctccgat ggttggtgtt 480
tactctgctt ctaaagctgg tatcgacggt ttcatgcgtt ctctggctcg tgaactgggt 540
ccgaaaggta tcaacgttaa ctgcgtttct ccgggtgtta cccgtacctc tatggctgaa 600
ggtatcgacc cgtctatgtt cgacctgccg atcaacggtt ggatcgaagt tgacgctatc 660
gctgacgctg ttacctacct ggttaaatct aaaaacgtta ccggtaccac cgtttctgtt 720
gacaacggtt actgcgctta a 741
<210>8
<211>246
<212>PRT
<213>Starmerella magnoliae
<400>8
Met Thr Ser Ser Ser Ser Pro Ser Leu Asn Ala Leu Val Thr Gly Gly
1 5 10 15
Ser Arg Gly Ile Gly Glu Ala Ile Ser Met Gln Leu Ala Ala Glu Gly
20 25 30
Tyr Ser Val Thr Ile Ala Ser Arg Gly Leu Glu Gln Leu Glu Ala Val
35 40 45
Lys Ala Lys Leu Pro Ile Val Lys Gln Gly Gln Thr His His Val Trp
50 55 60
Gln Leu Asp Leu Ser Asp Val Glu Ala Ala Gly Ser Phe Lys Gly Ala
65 70 75 80
Pro Leu Pro Ala Ser Ser Tyr Asp Val Phe Val Ser Asn Ala Gly Ile
85 90 95
Ser Gln Phe Ser Pro Ile Ala Glu His Ala Asp Ala Asp Trp Gln Asn
100 105110
Met Leu Thr Val Asn Leu Thr Ala Pro Ile Ala Leu Thr Lys Ala Val
115 120 125
Val Lys Ala Ile Ser Asp Lys Pro Arg Gln Thr Pro Ala His Ile Ile
130 135 140
Phe Ile Ser Thr Gly Leu Ser Lys Arg Gly Ala Pro Met Val Gly Val
145 150 155 160
Tyr Ser Ala Ser Lys Ala Gly Ile Asp Gly Phe Met Arg Ser Leu Ala
165 170 175
Arg Glu Leu Gly Pro Lys Gly Ile Asn Val Asn Cys Val Ser Pro Gly
180 185 190
Val Thr Arg Thr Ser Met Ala Glu Gly Ile Asp Pro Ser Met Phe Asp
195 200 205
Leu Pro Ile Asn Gly Trp Ile Glu Val Asp Ala Ile Ala Asp Ala Val
210 215 220
Thr Tyr Leu Val Lys Ser Lys Asn Val Thr Gly Thr Thr Val Ser Val
225 230 235 240
Asp Asn Gly Tyr Cys Ala
245
Claims (8)
1. A ketoreductase mutant with improved enzymatic activity, which is derived from wild-type ketoreductase of Starmerella magnolae, can convert 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol to (2S,3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, has higher alcohol dehydrogenase activity than the wild-type sequence, has more than 90% similarity to SEQ ID NO.8, and has one or more of the following characteristics: I54E, S85A and K182V, wherein the sequence of the ketoreductase mutant is SEQ ID NO. 6.
2. The ketoreductase mutant with improved enzymatic activity of claim 1, wherein the enzymatic activity of the ketoreductase mutant is at least 2-15 fold enhanced compared to the activity of the wild-type ketoreductase.
3. A polynucleotide encoding a ketoreductase recombinant polypeptide having the sequence of SEQ ID No. 6.
4. The polynucleotide of claim 2, wherein the sequence of the polynucleotide is SEQ id No. 5.
5. A recombinant plasmid comprising an expression vector having a polynucleotide having the sequence of SEQ ID No.5 attached thereto.
6. A host cell, characterized in that it comprises the recombinant plasmid according to claim 5.
7. A host cell according to claim 6, wherein said cell is an E.coli cell.
8. A host cell according to claim 7, wherein the codons of the recombinant plasmid have been optimized for expression in the host cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010647366.3A CN111705043B (en) | 2020-07-07 | 2020-07-07 | Ketoreductase mutant with improved catalytic activity and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010647366.3A CN111705043B (en) | 2020-07-07 | 2020-07-07 | Ketoreductase mutant with improved catalytic activity and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111705043A true CN111705043A (en) | 2020-09-25 |
| CN111705043B CN111705043B (en) | 2022-03-04 |
Family
ID=72545322
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010647366.3A Active CN111705043B (en) | 2020-07-07 | 2020-07-07 | Ketoreductase mutant with improved catalytic activity and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111705043B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116948999A (en) * | 2023-09-20 | 2023-10-27 | 瑞博(苏州)制药有限公司 | Ketone reductase mutant, composition, biological material and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109735553A (en) * | 2018-12-29 | 2019-05-10 | 南京诺云生物科技有限公司 | A kind of preparation method of anti-AIDS drug atazanavir intermediate |
-
2020
- 2020-07-07 CN CN202010647366.3A patent/CN111705043B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109735553A (en) * | 2018-12-29 | 2019-05-10 | 南京诺云生物科技有限公司 | A kind of preparation method of anti-AIDS drug atazanavir intermediate |
Non-Patent Citations (4)
| Title |
|---|
| AMANDA S. DE MIRANDA等: "Chiral Chlorohydrins from the Biocatalyzed Reduction of Chloroketones: Chiral Building Blocks for Antiretroviral Drugs", 《CHEMCATCHEM》 * |
| FRISO S AALBERS等: "Approaching boiling point stability of an alcohol dehydrogenase through computationally-guided enzyme engineering", 《ELIFE》 * |
| FRISO S AALBERS等: "登录号6TQ3_A", 《NCBI_GENPEPT》 * |
| 郑昆: "阿扎那韦手性中间体（3S）-3-（叔丁氧羰基）氨基-1-氯-4-苯基-（2R）-丁醇的酶法制备研究", 《中国优秀硕士学位论文全文数据库工程科技Ⅰ辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116948999A (en) * | 2023-09-20 | 2023-10-27 | 瑞博(苏州)制药有限公司 | Ketone reductase mutant, composition, biological material and application thereof |
| CN116948999B (en) * | 2023-09-20 | 2023-12-15 | 瑞博(苏州)制药有限公司 | Ketone reductase mutant, composition, biological material and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111705043B (en) | 2022-03-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109735553B (en) | Preparation method of anti-AIDS drug atazanavir intermediate | |
| CN106929521B (en) | Aldehyde ketone reductase gene recombination co-expression vector, engineering bacterium and application thereof | |
| CN111041010B (en) | Ketoreductase and application thereof in production of (R) -4-chloro-3-hydroxy ethyl butyrate | |
| CN111454921B (en) | Ketoreductase mutant with improved enzyme activity and application thereof | |
| CN110923277B (en) | Method for preparing S-3-dimethylamino-1- (2-thienyl) -1-propanol by biocatalysis | |
| CN111235123B (en) | Carbonyl reductase with high-concentration tolerance of alcoholic solution and application thereof | |
| CN109943542B (en) | Alcohol dehydrogenase for producing atazanavir intermediate | |
| CN111593077B (en) | Method for preparing (R) -4-chloro-3-hydroxy ethyl butyrate through biocatalysis | |
| CN111705043B (en) | Ketoreductase mutant with improved catalytic activity and application thereof | |
| CN110938609B (en) | Ketoreductase mutant with enhanced activity and application thereof | |
| CN111662889B (en) | Ketoreductase mutant for producing darunavir intermediate | |
| CN109943577B (en) | Biotransformation method of anti-AIDS drug atazanavir intermediate | |
| CN111690696B (en) | Method for preparing darunavir intermediate through biocatalysis | |
| CN108410831A (en) | Ketone acid reductase, gene, engineering bacteria and the application in synthesis of chiral fragrance 2- hydroxy acids | |
| CN111635893A (en) | Ketoreductase and application thereof in production of darunavir intermediate | |
| CN110964703B (en) | Enzyme for preparing intermediate of antidepressant duloxetine, biocatalysis method and application thereof | |
| CN114908129B (en) | Dehydrogenase for the preparation of (R) -4-chloro-3-hydroxybutyric acid ethyl ester | |
| CN113151131B (en) | Self-induction culture medium for producing isoeugenol monooxygenase and application thereof | |
| CN111575256B (en) | Ketoreductase mutant for producing (R) -4-chloro-3-hydroxybutyric acid ethyl ester | |
| CN110904061B (en) | Alcohol dehydrogenase mutant with enhanced thermal stability and application thereof | |
| CN110951704B (en) | Alcohol dehydrogenase mutant with enhanced thermal stability and sequence thereof | |
| CN106047826B (en) | Aldehyde dehydrogenase, its recombinant expression transformants and the application in the synthesis of statin precursor | |
| CN112592913B (en) | Thermally stable threonine deaminase and application thereof | |
| CN112625993B (en) | Preparation of alpha-ketoglutaric acid by microbial conversion method | |
| CN109234325A (en) | A kind of application of lactic dehydrogenase in asymmetric syntheses chiral hydroxyl group compound |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |