CN111635893A - Ketoreductase and application thereof in production of darunavir intermediate - Google Patents

Ketoreductase and application thereof in production of darunavir intermediate Download PDF

Info

Publication number
CN111635893A
CN111635893A CN202010647352.1A CN202010647352A CN111635893A CN 111635893 A CN111635893 A CN 111635893A CN 202010647352 A CN202010647352 A CN 202010647352A CN 111635893 A CN111635893 A CN 111635893A
Authority
CN
China
Prior art keywords
ala
ser
val
gly
ketoreductase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010647352.1A
Other languages
Chinese (zh)
Inventor
丁雪峰
王乾
李佳松
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Lang'en Biological Science & Technology Co ltd
Original Assignee
Nanjing Lang'en Biological Science & Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Lang'en Biological Science & Technology Co ltd filed Critical Nanjing Lang'en Biological Science & Technology Co ltd
Priority to CN202010647352.1A priority Critical patent/CN111635893A/en
Publication of CN111635893A publication Critical patent/CN111635893A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/02—Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
    • C12P41/002—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by oxidation/reduction reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01002—Alcohol dehydrogenase (NADP+) (1.1.1.2), i.e. aldehyde reductase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The embodiment of the invention discloses a ketoreductase and application thereof in production of a darunavir intermediate, belonging to the technical field of biocatalysis methods and application, wherein the ketoreductase is derived from Starmerella magnolae and can be used for converting 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol to generate (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, and the sequence of the ketoreductase is SEQ ID NO. 8. The ketoreductase has rich sources, low cost and simple acquisition. The whole system of the invention uses single enzyme for catalysis, uses alcohols for coenzyme circulation, has low requirement on equipment, does not need high temperature or cooling in the production process, has low energy consumption, and has high efficiency and specific selectivity due to enzyme catalysis, so that the key intermediate (2S, 3S) -1-chloro-3-tert-butyloxycarbonylamino-4-phenyl-2-butanol for producing the darunavir by the method has no by-product and is convenient to purify; in addition, the reaction solvent is mainly water, the discharge of three wastes is low, and the method is green and environment-friendly.

Description

Ketoreductase and application thereof in production of darunavir intermediate
Technical Field
The invention belongs to the technical field of biocatalysis methods and application, relates to ketoreductase and application thereof in production of darunavir intermediates, and particularly relates to ketoreductase and application thereof in production of (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol.
Background
Ketoreductases are versatile catalysts that selectively reduce an aldehyde or ketone enantiomer to the corresponding alcohol. The (R) -specific ketoreductase enzymes have different properties from the (S) -specific ketoreductase enzymes, and these catalysts are used more and more frequently in the industrial synthesis of optically active alcohols. Optical activity is a prerequisite for the selective action of many pharmaceutically and pesticidally active compounds, in some cases one enantiomer having beneficial pharmaceutical activity and the other enantiomer having genotoxic effect. Therefore, in the synthesis of active compounds for pharmaceutical and agricultural chemicals, it is necessary to synthesize optically active alcohols using a catalyst having the required stereospecificity.
Darunavir, also known as darunavir, sold under the tradename Prezista, is a non-peptide aids protease inhibitor for use by qiangsheng corporation, which was approved by the U.S. Food and Drug Administration (FDA) for marketing in 2006. 2011 the united states Food and Drug Administration (FDA) announced approval of an oral suspension formulation of Prezista (darunavir). Is the second non-peptide protease inhibitor on the market worldwide and is one of the major anti-AIDS drugs in the world at present.
(2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol is used as a key intermediate for preparing darunavir, and the main production processes at present comprise a chemical synthesis method and a biological method, wherein the biological method can be obtained by performing biotransformation on 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol by using corresponding ketoreductase or microbial whole cells.
The published report shows that brazilian Amanda et al biologically prepare (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol (DOI:10.1002/cctc.201403023) by asymmetrically reducing (3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanone using RasADH, a source of Ralstonia sp, to produce (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol. The method uses an auxiliary biological method to prepare the enzyme NADPH, has high market price and limits the application to a certain extent. The concentration of the substrate is 10mg/ml converted into 10g/L, and the optical purity is only 90%, so that the preparation requirements of related medical intermediates cannot be met.
Disclosure of Invention
The invention aims to solve the technical problems of high cost, low substrate concentration, large coenzyme consumption and low optical purity of the biological method for preparing (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol in the prior art. Provides a ketoreductase and application thereof in the production of a darunavir intermediate.
The technical scheme provided by the invention is as follows:
a ketoreductase enzyme derived from Starmerella magnolae useful for the conversion of 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol to (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, said ketoreductase enzyme having the sequence of SEQ ID No. 8.
Preferably, the source of the ketoreductase is recombinant expression in E.coli.
Preferably, the codons of the ketoreductase expression plasmid have been optimized for expression in a host cell.
A process for the production of a darunavir intermediate comprising converting 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol to (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol in the presence of a ketoreductase having the sequence of SEQ ID No. 8.
A method for producing a darunavir intermediate, characterized in that it uses isopropanol or glucose for coenzyme NADP regeneration to NADPH.
By adopting the technical scheme, the technical effects are as follows:
the ketoreductase naturally existing in Starmerella meliae is easy to obtain and has higher alcohol dehydrogenase activity, the whole system of the invention uses single enzyme catalysis, uses alcohol for coenzyme circulation, has low requirement on equipment, does not need high temperature or cooling in the production process, has low energy consumption, has high efficiency and specific selectivity due to enzyme catalysis, produces no by-product of a key intermediate (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol of darunavir, and is convenient to purify; the concentration of the substrate can reach 55g/L, which is about 5 times of that of a reference document, and in addition, the reaction solvent is mainly water, so that the three wastes are low in emission, and the method is green and environment-friendly.
Drawings
FIG. 1 is a TLC chart of Sma biotransformation reactions at 0 hours, 6 hours, 12 hours and 18 hours, the first column from left to right being a 0 hour reaction sample, the second being a 6 hour reaction sample, the third being a 12 hour reaction sample, the fourth being an 18 hour reaction sample, the upper band being a substrate and the lower band being a product;
Detailed Description
In order to better explain the invention, the invention is further illustrated below with reference to examples. The instruments and reagents used in the present examples are commercially available products unless otherwise specified.
Example 1 Synthesis of CKSm Gene sequences
According to the sequence shown in SEQ ID NO.7, the Nanjing Kinshire organism is entrusted to carry out whole gene synthesis on the coding sequence of the protein, and the coding sequence is cloned into pET30a to obtain a control protein expression plasmid NYK-CKSm. The corresponding amino acid sequence is SEQID NO. 8.
Example 2 Shake flask expression test
Coli single colonies containing the expression vector were picked and inoculated into 10ml of autoclaved medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin to 50 mg/L. The culture was carried out at 30 ℃ and 250rpm overnight. Taking a 1L triangular flask the next day, and carrying out the following steps: 100 into 100ml of autoclaved medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L. The cells were cultured at 30 ℃ until the OD 5-6 of the cells became zero, and the cells were immediately placed in a flask in a shaker at 25 ℃ and cultured at 250rpm for 1 hour. IPTG was added to a final concentration of 0.1mM and incubation was continued at 25 ℃ for 16 hours at 250 rpm. After completion of the culture, the culture was centrifuged at 12000g at 4 ℃ for 20 minutes to collect wet cells. Then the bacterial pellet is washed twice with distilled water, and the bacterial is collected and preserved at-70 ℃. Meanwhile, a small amount of thallus is taken for SDS-PAGE detection.
Example 3 fed-batch fermentation
The fed-batch fermentation was carried out in a computer-controlled bioreactor (Shanghai Seisaku) with a reactor capacity of 15L and a working volume of 8L, using 24g/L yeast extract, 12g/L peptone, 0.4% glucose, 2.31g/L catalase phosphate and 12.54g/L dipotassium hydrogen phosphate as the medium, pH 7.0. 200ml of culture was prepared for the primary inoculum and inoculated at OD 2.0. Throughout the fermentation, the temperature was maintained at 37 ℃, the dissolved oxygen concentration during fermentation was automatically controlled at 30% by the agitation rate (rpm) and aeration supply cascade, while the pH of the medium was maintained at 7.0 by 50% (v/v) orthophosphoric acid and 30% (v/v) aqueous ammonia. During the fermentation, when a large amount of dissolved oxygen rises, feeding is started. The feed solution contained 9% w/v peptone, 9% w/v yeast extract, 14% w/v glycerol. Induction with 0.2mM IPTG occurred at an OD600 of about 35.0 (wet weight of about 60 g/L).
Example 455 g/L substrate concentration bioconversion reaction
Adding a magneton stirrer into a 500ml three-mouth beaker, sequentially adding 3ml of toluene, 21ml of isopropanol and 11g of 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, uniformly mixing the mixture to obtain a pre-melting substrate, and adding 1mM MgCl20.1M PBpH8.5 made the total about 190ml, and after mixing the pH was adjusted to 8.5. Finally, 10mg of NADP and 10ml of crude enzyme Sma are added, and the mixture is reacted in water bath at 30 ℃.
Example 5 thin layer chromatography
The conversion system was subjected to TLC detection at 0 hr, 6 hr, 12 hr and 18 hr in the above example, and the results are shown in FIG. 1, and it can be seen that the substrate was significantly reduced and the product was significantly produced after 6 hr of reaction. Bioconversion of 55g/L substrate was completed in 18 hours.
Example 6 enzyme Activity assay
Taking 6 5ml centrifuge tubes, respectively labeling 1-6,respectively adding 0ul, 40ul, 80ul, 100ul, 120ul and 160ul of 3mM NADPH solution, supplementing 0.1M phosphate buffer solution with pH of 7.0 to 3ml each tube, mixing uniformly, detecting at 340nm and recording the absorbance value; from the above-mentioned measured values, a standard curve Y of NADPH, where Y is the value of absorbance, X is the concentration (mM) of NADPH, and R of the curve is obtained2>99.5 percent; diluting the enzyme solution with pure water by a certain dilution ratio (reference dilution ratio: 600-1000 times), wherein the dilution ratio is suitable for changing the light absorption value per minute by 0.02-0.04; 5ml of centrifuge tube is taken, the samples are added into the centrifuge tube according to the following proportion, the mixture is quickly mixed, and the mixture is immediately poured into a cuvette.
Figure BDA0002573632510000041
Detecting the change of absorbance at 340nm, recording a value every 1min, and keeping the change rate basically the same every minute, wherein the absorbance at 0min is S0, and the absorbance at 3min is S3;
the enzyme activity calculation formula is as follows:
enzyme activity (U/ml) [ (S0-S3) × 3ml × N ]/[ kXtime (t/min) × enzyme addition (ml) ]
Wherein N is the dilution multiple of the enzyme solution.
And (3) detection results: the enzyme activity is 83U/ml.
The above description is only for the purpose of illustrating the present invention and is not intended to limit the scope of the present invention, and any person skilled in the art can substitute or change the technical solution of the present invention and its conception within the scope of the present invention.
Sequence listing
<110> Nanjing Langen Biotech Ltd
<120> ketoreductase and application thereof in production of darunavir intermediate
<130>2020
<160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>741
<212>DNA
<213> Artificial sequence ()
<400>1
atgacctctt cttcttctcc gtctctgaac gctctggtta ccggtggttc tcgtggtatc 60
ggtgaagcta tctctatgca gctggctgct gaaggttact ctgttaccat cgcttctcgt 120
ggtctggaac agctggaagc tgttaaagct aaactgccgg aagttaaaca gggtcagacc 180
caccacgttt ggcagctgga cctgtctgac gttgaagctg ctggttcttt caaaggtgct 240
ccgctgccgg ctgcttctta cgacgttttc gtttctaacg ctggtatctc tcagttctct 300
ccgatcgctg aacacgctga cgctgactgg cagaacatgc tgaccgttaa cctgaccgct 360
ccgatcgctc tgaccaaagc tgttgttaaa gctatctctg acaaaccgcg tcagaccccg 420
gctcacatca tcttcatctc taccggtctg tctaaacgtg gtgctccgat ggttggtgtt 480
tactctgctt ctaaagctgg tatcgacggt ttcatgcgtt ctctggctcg tgaactgggt 540
ccggttggta tcaacgttaa ctgcgtttct ccgggtgtta cccgtacctc tatggctgaa 600
ggtatcgacc cgtctatgtt cgacctgccg atcaacggtt ggatcgaagt tgacgctatc 660
gctgacgctg ttacctacct ggttaaatct aaaaacgtta ccggtaccac cgtttctgtt 720
gacaacggtt actgcgctta a 741
<210>2
<211>246
<212>PRT
<213> Artificial sequence ()
<400>2
Met Thr Ser Ser Ser Ser Pro Ser Leu Asn Ala Leu Val Thr Gly Gly
1 5 10 15
Ser Arg Gly Ile Gly Glu Ala Ile Ser Met Gln Leu Ala Ala Glu Gly
20 25 30
Tyr Ser Val Thr Ile Ala Ser Arg Gly Leu Glu Gln Leu Glu Ala Val
35 40 45
Lys Ala Lys Leu Pro Glu Val Lys Gln Gly Gln Thr His His Val Trp
50 55 60
Gln Leu Asp Leu Ser Asp Val Glu Ala Ala Gly Ser Phe Lys Gly Ala
65 70 75 80
Pro Leu Pro Ala Ala Ser Tyr Asp Val Phe Val Ser Asn Ala Gly Ile
85 90 95
Ser Gln Phe Ser Pro Ile Ala Glu His Ala Asp Ala Asp Trp Gln Asn
100 105 110
Met Leu Thr Val Asn Leu Thr Ala Pro Ile Ala Leu Thr Lys Ala Val
115 120 125
Val Lys Ala Ile Ser Asp Lys Pro Arg Gln Thr Pro Ala His Ile Ile
130 135 140
Phe Ile Ser Thr Gly Leu Ser Lys Arg Gly Ala Pro Met Val Gly Val
145 150 155 160
Tyr Ser Ala Ser Lys Ala Gly Ile Asp Gly Phe Met Arg Ser Leu Ala
165 170 175
Arg Glu Leu Gly Pro Val Gly Ile Asn Val Asn Cys Val Ser Pro Gly
180 185 190
Val Thr Arg Thr Ser Met Ala Glu Gly Ile Asp Pro Ser Met Phe Asp
195 200 205
Leu Pro Ile Asn Gly Trp Ile Glu Val Asp Ala Ile Ala Asp Ala Val
210 215 220
Thr Tyr Leu Val Lys Ser Lys Asn Val Thr Gly Thr Thr Val Ser Val
225 230 235 240
Asp Asn Gly Tyr Cys Ala
245
<210>3
<211>741
<212>DNA
<213> Artificial sequence ()
<400>3
atgacctctt cttcttctcc gtctctgaac gctctggtta ccggtggttc tcgtggtatc 60
ggtgaagcta tctctatgca gctggctgct gaaggttact ctgttaccat cgcttctcgt 120
ggtctggaac agctggaagc tgttaaagct aaactgccgg aagttaaaca gggtcagacc 180
caccacgttt ggcagctgga cctgtctgac gttgaagctg ctggttcttt caaaggtgct 240
ccgctgccgg cttcttctta cgacgttttc gtttctaacg ctggtatctc tcagttctct 300
ccgatcgctg aacacgctga cgctgactgg cagaacatgc tgaccgttaa cctgaccgct 360
ccgatcgctc tgaccaaagc tgttgttaaa gctatctctg acaaaccgcg tcagaccccg 420
gctcacatca tcttcatctc taccggtctg tctaaacgtg gtgctccgat ggttggtgtt 480
tactctgctt ctaaagctgg tatcgacggt ttcatgcgtt ctctggctcg tgaactgggt 540
ccggttggta tcaacgttaa ctgcgtttct ccgggtgtta cccgtacctc tatggctgaa 600
ggtatcgacc cgtctatgtt cgacctgccg atcaacggtt ggatcgaagt tgacgctatc 660
gctgacgctg ttacctacct ggttaaatct aaaaacgtta ccggtaccac cgtttctgtt 720
gacaacggtt actgcgctta a 741
<210>4
<211>246
<212>PRT
<213> Artificial sequence ()
<400>4
Met Thr Ser Ser Ser Ser Pro Ser Leu Asn Ala Leu Val Thr Gly Gly
1 5 10 15
Ser Arg Gly Ile Gly Glu Ala Ile Ser Met Gln Leu Ala Ala Glu Gly
20 25 30
Tyr Ser Val Thr Ile Ala Ser Arg Gly Leu Glu Gln Leu Glu Ala Val
35 40 45
Lys Ala Lys Leu Pro Glu Val Lys Gln Gly Gln Thr His His Val Trp
50 55 60
Gln Leu Asp Leu Ser Asp Val Glu Ala Ala Gly Ser Phe Lys Gly Ala
65 70 75 80
Pro Leu Pro Ala Ser Ser Tyr Asp Val Phe Val Ser Asn Ala Gly Ile
85 90 95
Ser Gln Phe Ser Pro Ile Ala Glu His Ala Asp Ala Asp Trp Gln Asn
100 105 110
Met Leu Thr Val Asn Leu Thr Ala Pro Ile Ala Leu Thr Lys Ala Val
115 120 125
Val Lys Ala Ile Ser Asp Lys Pro Arg Gln Thr Pro Ala His Ile Ile
130 135 140
Phe Ile Ser Thr Gly Leu Ser Lys Arg Gly Ala Pro Met Val Gly Val
145 150 155 160
Tyr Ser Ala Ser Lys Ala Gly Ile Asp Gly Phe Met Arg Ser Leu Ala
165 170 175
Arg Glu Leu Gly Pro Val Gly Ile Asn Val Asn Cys Val Ser Pro Gly
180 185 190
Val Thr Arg Thr Ser Met Ala Glu Gly Ile Asp Pro Ser Met Phe Asp
195 200 205
Leu Pro Ile Asn Gly Trp Ile Glu Val Asp Ala Ile Ala Asp Ala Val
210 215 220
Thr Tyr Leu Val Lys Ser Lys Asn Val Thr Gly Thr Thr Val Ser Val
225 230 235 240
Asp Asn Gly Tyr Cys Ala
245
<210>5
<211>741
<212>DNA
<213> Artificial sequence ()
<400>5
atgacctctt cttcttctcc gtctctgaac gctctggtta ccggtggttc tcgtggtatc 60
ggtgaagcta tctctatgca gctggctgct gaaggttact ctgttaccat cgcttctcgt 120
ggtctggaac agctggaagc tgttaaagct aaactgccga tcgttaaaca gggtcagacc 180
caccacgttt ggcagctgga cctgtctgac gttgaagctg ctggttcttt caaaggtgct 240
ccgctgccgg cttcttctta cgacgttttc gtttctaacg ctggtatctc tcagttctct 300
ccgatcgctg aacacgctga cgctgactgg cagaacatgc tgaccgttaa cctgaccgct 360
ccgatcgctc tgaccaaagc tgttgttaaa gctatctctgacaaaccgcg tcagaccccg 420
gctcacatca tcttcatctc taccggtctg tctaaacgtg gtgctccgat ggttggtgtt 480
tactctgctt ctaaagctgg tatcgacggt ttcatgcgtt ctctggctcg tgaactgggt 540
ccggttggta tcaacgttaa ctgcgtttct ccgggtgtta cccgtacctc tatggctgaa 600
ggtatcgacc cgtctatgtt cgacctgccg atcaacggtt ggatcgaagt tgacgctatc 660
gctgacgctg ttacctacct ggttaaatct aaaaacgtta ccggtaccac cgtttctgtt 720
gacaacggtt actgcgctta a 741
<210>6
<211>246
<212>PRT
<213> Artificial sequence ()
<400>6
Met Thr Ser Ser Ser Ser Pro Ser Leu Asn Ala Leu Val Thr Gly Gly
1 5 10 15
Ser Arg Gly Ile Gly Glu Ala Ile Ser Met Gln Leu Ala Ala Glu Gly
20 25 30
Tyr Ser Val Thr Ile Ala Ser Arg Gly Leu Glu Gln Leu Glu Ala Val
35 40 45
Lys Ala Lys Leu Pro Ile Val Lys Gln Gly Gln Thr His His Val Trp
50 55 60
Gln Leu Asp Leu Ser Asp Val Glu Ala Ala Gly Ser Phe Lys Gly Ala
65 70 75 80
Pro Leu Pro Ala Ser Ser Tyr Asp Val Phe Val Ser Asn Ala Gly Ile
85 90 95
Ser Gln Phe Ser Pro Ile Ala Glu His Ala Asp Ala Asp Trp Gln Asn
100 105 110
Met Leu Thr Val Asn Leu Thr Ala Pro Ile Ala Leu Thr Lys Ala Val
115 120 125
Val Lys Ala Ile Ser Asp Lys Pro Arg Gln Thr Pro Ala His Ile Ile
130 135 140
Phe Ile Ser Thr Gly Leu Ser Lys Arg Gly Ala Pro Met Val Gly Val
145 150 155 160
Tyr Ser Ala Ser Lys Ala Gly Ile Asp Gly Phe Met Arg Ser Leu Ala
165 170 175
Arg Glu Leu Gly Pro Val Gly Ile Asn Val Asn Cys Val Ser Pro Gly
180 185 190
Val Thr Arg Thr Ser Met Ala Glu Gly Ile Asp Pro Ser Met Phe Asp
195 200 205
Leu Pro Ile Asn Gly Trp Ile Glu Val Asp Ala Ile Ala Asp Ala Val
210 215 220
Thr Tyr Leu Val Lys Ser Lys Asn Val Thr Gly Thr Thr Val Ser Val
225 230 235 240
Asp Asn Gly Tyr Cys Ala
245
<210>7
<211>741
<212>DNA
<213> Artificial sequence ()
<400>7
atgacctctt cttcttctcc gtctctgaac gctctggtta ccggtggttc tcgtggtatc 60
ggtgaagcta tctctatgca gctggctgct gaaggttact ctgttaccat cgcttctcgt 120
ggtctggaac agctggaagc tgttaaagct aaactgccga tcgttaaaca gggtcagacc 180
caccacgttt ggcagctgga cctgtctgac gttgaagctg ctggttcttt caaaggtgct 240
ccgctgccgg cttcttctta cgacgttttc gtttctaacg ctggtatctc tcagttctct 300
ccgatcgctg aacacgctga cgctgactgg cagaacatgc tgaccgttaa cctgaccgct 360
ccgatcgctc tgaccaaagc tgttgttaaa gctatctctg acaaaccgcg tcagaccccg 420
gctcacatca tcttcatctc taccggtctg tctaaacgtg gtgctccgat ggttggtgtt 480
tactctgctt ctaaagctgg tatcgacggt ttcatgcgtt ctctggctcg tgaactgggt 540
ccgaaaggta tcaacgttaa ctgcgtttct ccgggtgtta cccgtacctc tatggctgaa 600
ggtatcgacc cgtctatgtt cgacctgccg atcaacggtt ggatcgaagt tgacgctatc 660
gctgacgctg ttacctacct ggttaaatct aaaaacgtta ccggtaccac cgtttctgtt 720
gacaacggtt actgcgctta a 741
<210>8
<211>246
<212>PRT
<213>Starmerella magnoliae
<400>8
Met Thr Ser Ser Ser Ser Pro Ser Leu Asn Ala Leu Val Thr Gly Gly
1 5 10 15
Ser Arg Gly Ile Gly Glu Ala Ile Ser Met Gln Leu Ala Ala Glu Gly
20 25 30
Tyr Ser Val Thr Ile Ala Ser Arg Gly Leu Glu Gln Leu Glu Ala Val
35 40 45
Lys Ala Lys Leu Pro Ile Val Lys Gln Gly Gln Thr His His Val Trp
50 55 60
Gln Leu Asp Leu Ser Asp Val Glu Ala Ala Gly Ser Phe Lys Gly Ala
65 70 75 80
Pro Leu Pro Ala Ser Ser Tyr Asp Val Phe Val Ser Asn Ala Gly Ile
85 90 95
Ser Gln Phe Ser Pro Ile Ala Glu His Ala Asp Ala Asp Trp Gln Asn
100 105 110
Met Leu Thr Val Asn Leu Thr Ala Pro Ile Ala Leu Thr Lys Ala Val
115 120 125
Val Lys Ala Ile Ser Asp Lys Pro Arg Gln Thr Pro Ala His Ile Ile
130 135 140
Phe Ile Ser Thr Gly Leu Ser Lys Arg Gly Ala Pro Met Val Gly Val
145 150 155 160
Tyr Ser Ala Ser Lys Ala Gly Ile Asp Gly Phe Met Arg Ser Leu Ala
165 170 175
Arg Glu Leu Gly Pro Lys Gly Ile Asn Val Asn Cys Val Ser Pro Gly
180 185 190
Val Thr Arg Thr Ser Met Ala Glu Gly Ile Asp Pro Ser Met Phe Asp
195 200 205
Leu Pro Ile Asn Gly Trp Ile Glu Val Asp Ala Ile Ala Asp Ala Val
210 215 220
Thr Tyr Leu Val Lys Ser Lys Asn Val Thr Gly Thr Thr Val Ser Val
225 230 235 240
Asp Asn Gly Tyr Cys Ala
245

Claims (5)

1. A ketoreductase enzyme derived from Starmerella magnolae useful for the conversion of 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol to (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol, said ketoreductase enzyme having the sequence of SEQ ID No. 8.
2. The ketoreductase enzyme of claim 1, wherein the source of the ketoreductase enzyme is recombinant expression in E.coli.
3. The ketoreductase enzyme of claim 2 in which the codons of the ketoreductase enzyme's expression plasmid have been those of an expression plasmid optimized for expression in a host cell.
4. A process for the production of a darunavir intermediate comprising converting 3S-1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol to (2S, 3S) -1-chloro-3-tert-butoxycarbonylamino-4-phenyl-2-butanol in the presence of a ketoreductase having the sequence of SEQ ID No. 8.
5. A method for producing a darunavir intermediate, characterized in that it uses isopropanol or glucose for coenzyme NADP regeneration to NADPH.
CN202010647352.1A 2020-07-07 2020-07-07 Ketoreductase and application thereof in production of darunavir intermediate Pending CN111635893A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010647352.1A CN111635893A (en) 2020-07-07 2020-07-07 Ketoreductase and application thereof in production of darunavir intermediate

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010647352.1A CN111635893A (en) 2020-07-07 2020-07-07 Ketoreductase and application thereof in production of darunavir intermediate

Publications (1)

Publication Number Publication Date
CN111635893A true CN111635893A (en) 2020-09-08

Family

ID=72328309

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010647352.1A Pending CN111635893A (en) 2020-07-07 2020-07-07 Ketoreductase and application thereof in production of darunavir intermediate

Country Status (1)

Country Link
CN (1) CN111635893A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113430240A (en) * 2021-06-29 2021-09-24 华东理工大学 Method for synthesizing atazanavir intermediate chlorohydrin by continuous flow biocatalysis

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1993464A (en) * 2004-08-06 2007-07-04 株式会社钟化 Novel carbonyl reductase, gene thereof and method of using the same
CN109735553A (en) * 2018-12-29 2019-05-10 南京诺云生物科技有限公司 A kind of preparation method of anti-AIDS drug atazanavir intermediate

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1993464A (en) * 2004-08-06 2007-07-04 株式会社钟化 Novel carbonyl reductase, gene thereof and method of using the same
CN109735553A (en) * 2018-12-29 2019-05-10 南京诺云生物科技有限公司 A kind of preparation method of anti-AIDS drug atazanavir intermediate

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AMANDA S. DE MIRANDA等: "Chiral Chlorohydrins from the Biocatalyzed Reduction of Chloroketones: Chiral Building Blocks for Antiretroviral Drugs", 《CHEMCATCHEM》 *
FRISO S AALBERS等: "Approaching boiling point stability of an alcohol dehydrogenase through computationally-guided enzyme engineering", 《ELIFE》 *
FRISO S AALBERS等: "登录号6TQ3_A", 《NCBI_GENPEPT》 *
郑昆: "阿扎那韦手性中间体（3S）-3-（叔丁氧羰基）氨基-1-氯-4-苯基-（2R）-丁醇的酶法制备研究", 《中国优秀硕士学位论文全文数据库工程科技Ⅰ辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113430240A (en) * 2021-06-29 2021-09-24 华东理工大学 Method for synthesizing atazanavir intermediate chlorohydrin by continuous flow biocatalysis
CN113430240B (en) * 2021-06-29 2023-07-04 华东理工大学 Method for synthesizing atazanavir intermediate chlorohydrin by continuous flow biocatalysis

Similar Documents

Publication Publication Date Title
CN109735553B (en) Preparation method of anti-AIDS drug atazanavir intermediate
CN111041010B (en) Ketoreductase and application thereof in production of (R) -4-chloro-3-hydroxy ethyl butyrate
CN111454921B (en) Ketoreductase mutant with improved enzyme activity and application thereof
CN110923277B (en) Method for preparing S-3-dimethylamino-1- (2-thienyl) -1-propanol by biocatalysis
CN111593077B (en) Method for preparing (R) -4-chloro-3-hydroxy ethyl butyrate through biocatalysis
CN110938609B (en) Ketoreductase mutant with enhanced activity and application thereof
CN109943542B (en) Alcohol dehydrogenase for producing atazanavir intermediate
CN111705043B (en) Ketoreductase mutant with improved catalytic activity and application thereof
CN113817693A (en) Short-chain carbonyl reductase PpYSDR mutant, encoding gene, recombinant expression vector, genetic engineering bacterium and application
CN111662889B (en) Ketoreductase mutant for producing darunavir intermediate
CN111635893A (en) Ketoreductase and application thereof in production of darunavir intermediate
CN108410831A (en) Ketone acid reductase, gene, engineering bacteria and the application in synthesis of chiral fragrance 2- hydroxy acids
CN109679978B (en) Recombinant co-expression system for preparing L-2-aminobutyric acid and application thereof
CN111690696B (en) Method for preparing darunavir intermediate through biocatalysis
CN110964703B (en) Enzyme for preparing intermediate of antidepressant duloxetine, biocatalysis method and application thereof
CN114908129B (en) Dehydrogenase for the preparation of (R) -4-chloro-3-hydroxybutyric acid ethyl ester
CN113151131B (en) Self-induction culture medium for producing isoeugenol monooxygenase and application thereof
CN111808893B (en) Novel biological preparation method of amino alcohol drug intermediate
CN111575256B (en) Ketoreductase mutant for producing (R) -4-chloro-3-hydroxybutyric acid ethyl ester
CN110904061B (en) Alcohol dehydrogenase mutant with enhanced thermal stability and application thereof
CN110951704B (en) Alcohol dehydrogenase mutant with enhanced thermal stability and sequence thereof
CN112592913B (en) Thermally stable threonine deaminase and application thereof
CN114317620B (en) Biological preparation method of (R) -2- (2-chlorophenyl) oxirane
CN114480315B (en) Baeyer-Villiger monooxygenase and application thereof in brivaracetam synthesis
CN110527671B (en) L-pantolactone dehydrogenase derived from Nocardia farcina and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20200908

RJ01 Rejection of invention patent application after publication