CN111690656B - Construction of novel transformation reporter system for plants by using RNA aptamer - Google Patents

Abstract

The present invention belongs to the field of plant gene engineering technology. In particular to a novel transformation report system constructed by using an RNA aptamer. A series of novel aptamers are designed by using a bioinformatics method, and a batch of RNA aptamers with high fluorescence intensity and good stability are screened through in-vitro transcription and fluorescence imaging. And respectively fusing the target genes and the target genes to transform escherichia coli for prokaryotic expression, and screening out candidate aptamers suitable for living cell imaging through laser confocal imaging. Then, an expression vector of the aptamer fusion target gene is constructed, the expression vector is introduced into tobacco leaves by using a transient transformation method, the aptamer which can be used for plant cell RNA imaging is identified by using laser confocal imaging analysis, and finally the aptamer fusion target gene is used to obtain a stable transgenic strain. The aptamer/DFHBI-1T was used for RNA level transgene identification and the binding molecule identification characterized the efficiency of the reporter system.

Description

Construction of novel transformation reporter system for plants by using RNA aptamer

Technical Field

The present invention belongs to the field of plant gene engineering technology. In particular to a method for constructing a novel plant transformation report system by using RNA aptamer. The invention successfully designs the RNA aptamer capable of being applied to RNA imaging of the plant living cells for the first time, and the RNA aptamer is utilized to construct a plant genetic transformation report system with RNA level for the first time. The invention can generate important promoting effect on plant gene engineering.

Background

Genetic engineering is a central approach for functional genomics research, molecular genetic improvement and biomedical research. In plant genetic engineering, marker genes are key elements for efficiently obtaining positively transformed plants. At present, marker genes widely used in plant genetic engineering include two types, namely a selection marker gene and a reporter gene. Selectable marker genes screen transformants by conferring resistance to harmful substances to plants, but the use of such markers may pose a potential risk to ecosystem and human health (Puchta, 2000). Unlike selectable marker genes, reporter genes report transformation events and aid in transgene selection by expressing protein products (Miki and McHugh, 2004). At present, reporter genes used in plant genetic engineering, such as GUS, GFP and the like, have some inherent defects, on one hand, target gene escape events frequently occur in the regeneration process of transgenic plants (Jiang et al, 2008), and the expression of the reporter genes cannot really reflect the existence and the expression of the target genes in receptor cells; on the other hand, reporter gene-dependent protein products play a screening role, thus leading to a large accumulation of foreign proteins in recipient cells, interfering with the normal expression of endogenous genes in plants (Page and Angell, 2002), affecting plant physiology and metabolism (Karlowski and Hirsch, 2003), while also raising some food safety concerns (Kuiper et al, 2001). Furthermore, protein-dependent reporter systems cannot be applied in characterization studies of non-coding RNAs. Therefore, it is essential to construct a novel reporter system that is independent of protein product.

RNA, a key product of the transcription process, is one of the important products for characterizing the presence and expression of genes in receptors. In recent years, research on biological effects of various RNAs has become a focus of molecular biology research, and especially, mRNA behavior research is concerned (Xia et al, 2018, yang et al, 2019). Meanwhile, RNA is easy to degrade, and the existence period in cells is short. Therefore, the construction of the RNA level report system has important advantages and application prospects. The invention aims to construct an RNA marker which can stably and efficiently play a role in RNA imaging of plant cells and establish a novel genetic transformation report system of an RNA level. The report system can not only break through the application limit of the existing report system; and dynamic report tracing can be carried out at the RNA level, so that a more accurate identification means is provided for the research of plant RNA behaviors and functions.

At present, no RNA level dynamic imaging technology is reported in plants. RNA aptamers have been successfully used and are increasing in prokaryotic and mammalian cells as important tools for RNA dynamic imaging. In 2011, researchers screened a series of RNA aptamers by structures that mimic GFP in order to directly achieve live cell RNA tagging and localization without the aid of fluorescent proteins (Paige et al, 2011). These RNA aptamers all have a three-dimensional cylindrical structure with a small fluorescent molecule (3, 5-difluoro-4-hydroxybenzylideneimidazolidinone, DFHBI) bound to the center to excite green fluorescence (Strack et al, 2013). The fluorescence intensity of the RNA aptamer Spinach screened in the early stage is influenced by factors such as self-limited folding rate and thermal instability, and the potential of the RNA aptamer Spinach for high-quality live cell RNA imaging is limited. Subsequently, researchers modified the Spinach to form Spinach2, and although the fluorescence intensity of the Spinach2 was greatly increased compared to the Spinach, the stability was not improved (Stracket al, 2013). To enhance fluorescence stability, huang et al (2014) demonstrated the fluorescence excitation mechanism of the Spinach-DFHBI complex by crystal structure analysis of Spinach and DFHBI. Warner et al (2014) found that G-tetranector is a key structure for Spinach luminescence through base mutation and nuclear magnetic resonance analysis, and the structure is stable without departing from potassium ions (K +). Later, researchers have condensed the Spinach sequence on the basis of keeping the J2-3 stem-loop structure to obtain babySpinach with the length of only 51nt, and the aptamer reduces the influence on target RNA and cells when being used for live cell RNA imaging (Song et al, 2014, warner et al, 2014), but still has K + dependency. To enhance the thermostability of the Spinach series and reduce their dependence on K + ions, autour et al (2016) screened the Spinach gene library using a microfluid assisted in vitro interval procedure to isolate an iSpinach suitable for functioning in high temperature and K + free environments. In recent years, some researchers have focused on RNA aptamer development and improvement of fluorescein, and on the one hand, a new method of combining microbead-fluorophore with Fluorescence Activated Cell Sorting (FACS) successfully screens an RNA aptamer with higher fluorescence intensity than Spinach and Spinach2, named Broccoli; on the other hand, the analogue DFHBI-1T of DFHBI was developed, which releases stronger fluorescence upon binding to Broccoli (Filonov et al, 2014). To increase the stability of Broccoli, the structure of Broccoli was further stabilized using tRNA scaffolds and trifurcated structure (3 WJ) scaffolds (Filonov et al, 2015). In the last year, researchers reported a new RNA aptamer, pepper, and its ligand fluorescent small molecule HBC series, which emit different colors of fluorescence when the Pepper binds to different HBCs. Pepper has the advantages of short sequence, strong fluorescence brightness, and wide fluorescence spectrum range (Chen et al, 2019).

RNA aptamer studies have increased to date in prokaryotic and mammalian cells. Zhang et al (2015) adopts tandem repeat Spinach labeled red fluorescent protein gene (RFP) mRNA to be transiently expressed in prokaryotic cells, and imaging analysis shows that the fluorescence intensity of tandem repeat Spinach labeled mRNA is enhanced by more than 17 times compared with single molecule Spinach labeled mRNA. Filonov et al (2015) imaged aptamer-labeled RNA in prokaryotic and mammalian cells and developed a gel staining method to analyze the differences in expression levels of different aptamer-labeled RNAs and the manner in which they are cleaved by intracellular nucleases. Whereas the aptamer peper reported previously could achieve positional imaging of genomic targets in mammalian cells by labeling grnas in conjunction with CRISPR/Cas technology (Chen et al, 2019).

In conclusion, the existing genetic transformation reporter systems rely on the function of the protein product of the marker gene, and no report has been made on the RNA level reporter system so far. RNA aptamers have been successfully used and are increasing in prokaryotic and mammalian cells as an important tool for RNA dynamic imaging, but have never been used in plant cells. Furthermore, previous studies on RNA aptamers have mainly focused on transient expression and imaging tracing of target RNA in cells, and the concept of RNA aptamers as markers for genetic transformation reporter systems has never been reported. The invention provides a brand-new thought for a plant genetic transformation report system, widens the existing report system from the aspect of molecules and application, and has an important promoting effect on plant genetic engineering.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and construct an aptamer capable of being efficiently applied to RNA imaging of living cells of plants. The invention designs and synthesizes a series of novel RNA aptamers, screens a batch of RNA aptamers with high fluorescence intensity and good stability through in vitro transcription and fluorescence imaging, respectively fuses the RNA aptamers with target genes to transform escherichia coli for prokaryotic expression, and screens candidate aptamers suitable for living cell imaging through a laser confocal imaging method. And then, identifying and verifying candidate aptamers in model plant tobacco to construct an expression vector of the aptamer fusion target gene, and introducing the expression vector into host tobacco leaves by using a transient transformation method. By utilizing laser confocal imaging analysis, the first aptamer which can be effectively used for RNA imaging of plant cells is successfully identified in a series of candidate aptamers. Finally, the aptamer is fused with a target gene to construct a stable transgenic line, RNA level transgenic identification is carried out by using the aptamer/DFHBI-1T, and the effectiveness of the report system for transgenic identification is analyzed by combining gPCR. The invention successfully designs the RNA aptamer applicable to RNA imaging of the living plant cells for the first time, and the RNA level plant genetic transformation report system is constructed by utilizing the aptamer for the first time.

The technical scheme of the invention is as follows:

a series of novel aptamers such as 3WJ-broccolis are designed by utilizing a bioinformatics method, and a batch of RNA aptamers with high fluorescence intensity and good stability are screened through in-vitro transcription and fluorescence imaging. And respectively fusing the target genes and the target genes to transform escherichia coli for prokaryotic expression, and screening out candidate aptamers suitable for living cell imaging through laser confocal imaging. Then, an expression vector of the aptamer fusion target gene is constructed, the expression vector is introduced into tobacco leaves by using a transient transformation method, the aptamer capable of being used for plant cell RNA imaging is identified by using laser confocal imaging analysis, and finally the stable transgenic strain is obtained by using the aptamer fusion target gene. aptamer/DFHBI-1T was used for RNA level transgene identification and binding molecule identification characterizes the efficiency of this reporter system.

The invention specifically discloses the processes of RNA aptamer design, vector construction, in-vitro imaging, prokaryotic cell and plant cell imaging, aptamer/DFHBI-1T-based RNA level transgene identification, transformed plant molecular identification and the like.

The method comprises the following specific steps:

a series of novel aptamers 3WJ-broccolis are designed by utilizing a bioinformatics method, and a batch of RNA aptamers with high fluorescence intensity and good stability are screened through in-vitro transcription and fluorescence imaging. And respectively fusing the target genes and the target genes to transform escherichia coli for prokaryotic expression, and screening out candidate aptamers suitable for living cell imaging through laser confocal imaging. Then, constructing an expression vector of the aptamer fusion target gene, introducing the expression vector into tobacco leaves by using a transient transformation method, and identifying the aptamer for plant cell RNA imaging by using laser confocal imaging analysis. Finally, an aptamer is fused with a target gene to construct a stable transgenic strain. The invention utilizes aptamer/DFHBI-1T to perform RNA level transgene identification, and combines molecular identification to characterize the efficiency of the report system.

The core locus of original broncoli was optimized using RNAfold online service system and a new trifurcate scaffold structure (3 WJ) was designed. Based on the new 3WJ scaffold and broccolis, a series of new aptamers 3WJ-broccolis were formed. The designed 3WJ-broccolis series aptamer is artificially synthesized in vitro.

A batch of RNA aptamer with high fluorescence intensity and good stability is screened out by using in vitro transcription and in vitro fluorescence imaging. The target genes are respectively marked to construct prokaryotic expression vectors, prokaryotic expression is carried out in escherichia coli, and candidate aptamers suitable for living cell imaging are screened out through laser confocal imaging.

Carrying out subsequent identification on the aptamer screened by the prokaryotic cell: the aptamer is fused with a target gene to construct a plant expression vector, transient expression is carried out on tobacco leaves, and the aptamer for RNA imaging of plant cells is identified by laser confocal imaging analysis. Finally, an aptamer is used for fusing a target gene to construct a stable transgenic strain, RNA level transgenic identification is carried out by using the aptamer/DFHBI-1T, and the efficiency of the report system is represented by combining molecular identification.

The further specific technical scheme is as follows:

a plant transformation report system for constructing RNA level by using RNA aptamer, wherein the plant transformation report system is expressed by a sequence table SEQ ID NO:1 as the RNA aptamer 3WJ-4 xBro genetic marker, using RNAfold online service system to optimize the core site of original broccolii, linking to new trifurcate scaffold 3WJ with four copies to form a 3WJ-4 xBro marker (the nucleotide sequence is shown in SEQ ID NO: 1), linking 3WJ-4 xBro marker to the 3' end of new trifurcate scaffold, introducing the fusion gene into a conventional plant expression vector NtTub alpha-3 WJ-4 xBro (the nucleotide sequence is shown in SEQ ID NO: 2), forming a recombinant new plant expression vector pFGC5941-NtTub alpha-3 WJ-4 xBro (the nucleotide sequence is shown in SEQ ID NO: 4), transforming the receptor plant, penetrating small fluorescent molecule dark DFI-1T into the leaf of the receptor plant, processing for 10h, collecting the leaf, placing the plant under a fluorescent microscope to observe green fluorescent signals, and identifying the transformed plant.

The invention has the advantages that:

(1) The invention breaks through the limitation of the traditional plant genetic transformation report system based on protein level, constructs the genetic transformation report system with RNA level, thereby realizing the diversification of the report system, effectively avoiding the accumulation of foreign protein generated by marker genes in plants, and applying the report system to the research of non-coding RNA.

(2) The invention successfully designs the aptamer which can be applied to RNA imaging of the plant living cells for the first time, and the aptamer is utilized to construct a genetic transformation report system on the RNA level for the first time. The invention can generate important promoting effect for plant gene engineering.

Drawings

FIG. 1: technical route diagrams of the invention.

FIG. 2: is the pFGC5941 plasmid map of the invention. The invention utilizes the plasmid skeleton to construct and obtain a plant transformation vector. FIG. 3: the structural diagram of the recombinant transformation vector constructed by the invention, namely pFGC5941-NtTub alpha-3 WJ-4 xBro, is shown.

FIG. 4 is a schematic view of: results of in vitro imaging of the invention. Description of reference numerals: panel a in fig. 4: in vitro fluorescence imaging of different aptamers fused to the 3' end of NtTub α mRNA; b diagram in fig. 4: fluorescence quantification of the 3' end of the fusion of different aptamers to NtTub α mRNA. * Indicating significance of difference between free aptamer tag and aptamer tag of fusion mRNA (P < 0.05). FIG. 5: and (5) prokaryotic expression result. Description of reference numerals: the left column of fig. 5 is a dark field, the middle column is a bright field, and the right column is a fused image of the first two columns.

FIG. 6: results of transient transformation of tobacco. Description of the reference numerals: the left column of the graph a in fig. 6 is a dark field, the middle column is a bright field, and the right column is a fusion image of the first two columns. Panel b in figure 6 is fluorescence and background signal detection.

FIG. 7: results of stable transformation of Arabidopsis thaliana.

FIG. 8:3WJ-4 XBro/DFHBI-1T System and gPCR for T ₁ And (3) generation of comparison results of transgenic Arabidopsis identification.

FIG. 9: design of 3WJ scaffold. Description of the drawings: FIG. 9, panel a, is a secondary structure diagram of the original F30 scaffold, wherein the black arrows indicate the insertion sites required for the introduction of newly designed loops into F30 for the design of 3WJ new scaffolds, the gray arrows indicate the original broccoli insertion sites in F30, and the gray boxes indicate the optimized base sites required for the modification of F30. Panel b of FIG. 9 is a secondary structure diagram of a newly designed 3WJ scaffold, in which the secondary structure of the new loop introduced in the 3WJ scaffold is indicated by a black solid line box. The optimized base sequence in the 3WJ scaffold is marked by a grey solid box, the corresponding F30 backbone portion in the 3WJ scaffold is indicated by a grey dashed box, and the two new broncoli insertion sites of the 3WJ are indicated by grey arrowheads.

Detailed Description

Description of the sequence listing

Sequence listing SEQ ID NO:1 is the sequence of aptamer 3WJ-4 xBro designed by the invention and can be used for RNA imaging of plant living cells. The sequence length is 368bp.

Sequence listing SEQ ID NO:2 the fusion gene sequence of the target gene NtTub alpha after connecting the aptamer 3WJ-4 xBro, and the sequence length is 1721bp.

Sequence listing SEQ ID NO:3 is the nucleotide sequence of the prokaryotic expression vector constructed by the invention pMal-c2X-NtTub alpha-3 WJ-4 xBro, and the sequence length is 8301bp.

Sequence listing SEQ ID NO:4 is the nucleotide sequence of the plant expression vector constructed by the invention, pFGC5941-NtTub alpha-3 WJ-4 xBro, and the sequence length is 11406bp.

Sequence listing SEQ ID NO:5-6 are PCR primer sequences designed by the invention.

Example 1: design synthesis of RNA aptamers

The core locus of the original broccoli is optimized by using an RNAfold online service system (http:// rna.tbi.univie.ac.at/cgi-bin/RNAaweb Suite/RNAfold.cgi), and GC bases are respectively added at the 5 'end and the 3' end of the broccoli to enhance the stability of the secondary structure of the broccoli. The design of the structure of the three-fork bracket (3 WJ) is as follows: (1) Optimizing base pairs on three arms on the basis of an F30 bracket (namely, replacing C on the 1,4 position of the arm with A, replacing G on the 2, 16 positions of the arm with U, replacing C on the 29 position with U, and replacing A on the 3, 23 positions of the arm with U) so as to meet the requirement of minimum free energy of a secondary structure; (2) Inserting a new design sequence (AUUAAACCCUGAUGAUUGAGUUCAG) into the loop 2 to introduce a new insertion site loop and a structural loop; (3) The aucuucggga sequence in loop 3 was optimized to augugguug to achieve reduced steric hindrance and enhanced steric folding (as shown in figure 9). A series of novel aptamers 3WJ-broccolis were formed based on the novel 3WJ scaffold and broccolis. The DNA sequence of the 3WJ-broccolis series aptamer was artificially synthesized in vitro (DNA synthesis was performed by commercial Co., ltd.).

Example 2: in vitro and prokaryotic expression imaging assays

The RNA product of 3WJ-broccolis obtained by in vitro transcription with an in vitro transcription kit (purchased from TaKaRa, dahlian, biotechnology engineering Co., ltd.) is purified and recovered by 8% urea polyacrylamide gel electrophoresis, and the RNA concentration and purity are determined. 3WJ-broccolis RNA is incubated by 1 XHEPES buffer containing DFHBI-1T, a fluorescence spectrophotometer (model: hitachi F7000) is adopted to perform spectrum scanning on a mixture at an excitation wavelength of 400-560nm and an emission wavelength of 450-610nm, the fluorescence spectrum difference after different aptamers are combined with the DFHBI-1T is analyzed, the excitation wavelength (488 nm and the emission wavelength (527 nm) of an aptamer compound is selected and determined, a fluorescence imager is adopted to perform time-lapse imaging on the 3WJ-broccolis RNA under a light source with the wavelength of 488nm, the fluorescence intensity is determined in real time by the fluorescence spectrophotometer, the fluorescence stability of different aptamers is analyzed, the 3WJ-broccolis RNA product is subjected to gradient dilution, the fluorescence intensity at each concentration is determined, the correlation between the fluorescence intensity and the 3WJ-broccolis RNA concentration is represented by linear regression, and the detectable sensitivity of the 3WJ-broccolis RNA is determined.

Respectively marking target gene NtTub alpha (accession number 107797065) by different aptamers of 3WJ-broccolis series to construct a prokaryotic expression vector, transforming escherichia coli BL21 competent cells through heat shock, selecting positive clone after resistance screening and PCR identification, and inducing escherichia coli to express fusion mRNA by IPTG; coli cells were incubated with DFHBI-1T at 25 ℃ for 30min. Live cell time-delay fluorescence imaging is carried out on escherichia coli by using a laser confocal microscope (Leica) (63 x objective lens, numerical aperture of 1.46 objective lens, excitation wavelength of 488 +/-20 nm and emission wavelength of 525 +/-25 nm). Prokaryotic expression results show that RNA fluorescence imaging effect of the aptamer 3WJ-4 xBro labeled target gene NtTub alpha in Escherichia coli is optimal. The nucleotide sequence of the aptamer 3WJ-4 xBro is shown as SEQ ID NO:1, the fusion sequence of NtTub alpha-3 WJ-4 xBro is shown as SEQ ID NO:2 is shown in the specification; the sequence of the prokaryotic expression vector pMal-c2X-NtTub alpha-3 WJ-4 xBro related by the invention is shown as SEQ ID NO:3, respectively.

Example 3: construction of plant expression vectors

Unless otherwise specified, reference methods and corresponding molecular biological routine procedures of the present invention are referenced: J. sambrook et al, "guidelines for molecular cloning (second edition)," the book of changes, "scientific press, 1996 edition.

The target gene (i.e., target gene) used in the present invention was NtTub α (accession number 107797065), and the fusion sequence of NtTub α -3WJ-4 XBro was synthesized by GENEWIZ (Suzhou) King Zhi Biotech Ltd and cloned into pBluescript II SK (+) cloning vector. The original transformation vector used in the present invention was Agrobacterium Ti binary vector pFGC5941 (see FIG. 2), which is a laboratory-maintained vector of the present applicant. The pFGC5941 vector was digested with AscI + Xba I and ligated into the nucleic acid sequence of SEQ ID NO: the NtTub alpha-3 WJ-4 XBro sequence shown in 2 forms a recombinant plant expression vector (plasmid) pFGC5941-NtTub alpha-3 WJ-4 XBro (nucleotide sequence shown in SEQ ID NO: 4). The recombinant plasmid pFGC5941-NtTub alpha-3 WJ-4 xBro is used for transforming the agrobacterium strain EHA105, and the transformed agrobacterium strain EHA105 is preserved at the temperature of-70 ℃ for standby.

Example 4: plant cell imaging assays

Agrobacterium EHA105 strain containing the pFGC5941-NtTub alpha-3 WJ-4 xBro recombinant plasmid was inoculated in LB medium containing 50. Mu.g/mL kanamycin and 25. Mu.g/mL rifampicin and shake-cultured (28 ℃,180 rpm) to OD ₆₀₀ Was 1.6. The cells were collected by centrifugation at 8000rpm for 5min and resuspended (containing MgCl at a concentration of 10 mM) ₂ 10mM MES and 10mM AS) to OD ₆₀₀ Is 0.8-1.0. Agrobacterium was injected into the tobacco lamina subepithelial cells using a 1mL syringe. Sucking the agrobacterium on the surface of the leaf blade by using absorbent paper, after marking, carrying out dark treatment on the injected tobacco for 16 hours at room temperature, and then carrying out light culture (the light cycle is 16 hours of light/8 hours of dark) for 3 days. 10uM of fluorescent small molecule DFHBI-1T (3, 5-difluoro-4-hydroxybenzylideneimidazolidinone) was injected into tobacco lamina subepithelial cells using a 1mL straight injector. And irradiating the tobacco leaves by using a handheld ultraviolet lamp after keeping out of the sun for 4 hours, and observing green fluorescence of the leaves. Meanwhile, a tobacco leaf is cut and sliced, and fluorescence observation and time-delay imaging observation (the excitation wavelength is 488nm, and the emission wavelength is 527 nm) are carried out on the tobacco leaf by adopting a disc type laser confocal microscope. The location and amount of candidate aptamer RNA in plant cells were analyzed based on the location and intensity of fluorescence in the cells (fig. 6).

Example 5: aptamer/DFHBI-1T based RNA level transgene identification

Get T ₁ Placing the seeds of Arabidopsis thaliana into a centrifuge tube, adding 1mL of sterile water, performing vernalization treatment in a refrigerator at 4 ℃ for 3d, and performing vernalization on the seedsSeeds were sown on sterilized culture medium (nutrient soil: vermiculite volume ratio =3: 1) and then placed in a light culture room for growth (culture temperature: 25 ℃; photoperiod: 16h light/8 h dark). When the arabidopsis grows to 4-6 leaves, 0.03% (v/v) Basta herbicide is sprayed, most seedlings begin to yellow after 3 days, and yellow seedlings are removed. After 10 days, 10 mu M DFHBI-1T is permeated into the resistant seedlings, the dark treatment is carried out for 10 hours, and leaves of arabidopsis thaliana are collected and placed under a fluorescence microscope to observe green fluorescence signals. The number of fluorescing shoots in resistant shoots was counted and the results are shown in FIG. 8.

Example 6: PCR detection of transgenic plants

The method for extracting the arabidopsis genomic DNA in a small amount is carried out according to a conventional method or by using a professional commercial kit. The primers used for tTub alpha-3 WJ-4 XBro gene amplification were: pB-Nt-F:5 'and GCTCTAGAATGAGAGTGCATATC-3' (see SEQ ID NO: 5); pB-mC-R:5 'and CGGAGCTCCCGGCCAGTGTGTGATG-3' (see SEQ ID NO: 6), and the size of the PCR amplification product is 1740bp.

And (3) PCR reaction system: DNA template 30-50ng,10X PCR buffer 2.0. Mu.l, 2mM dNTP 1.5. Mu.l, 25mM MgCl ₂ 2.0. Mu.l of each 10. Mu.M primer (pB-Nt-FF/pB-mC-R) 0.4. Mu.l, sterilized ddH ₂ O to 25. Mu.l.

PCR amplification reaction procedure: 4min at 94 ℃; 30min at 94 ℃, 20sec at 58 ℃, 30sec at 72 ℃,35cycles; 5min at 72 ℃. The amplification products were detected on a 0.8% agarose gel.

TABLE 13 WJ-4 xBro/DFHBI-1T System and gPCR of the invention for T ₂ Identification of transgenic Arabidopsis thaliana

Description of Table 1: the χ 2 test was used to test the genetic segregation ratio of F-P plants to N-N plants 3. Significance level was 0.01, χ 2 _1,0.01 ＝6.63

F-P represents a plant which not only emits fluorescence, but also is positive for RT-PCR; N-N represents plants that are neither fluorescent nor RT-PCR positive; F-N represents plants that fluoresce but are not RT-PCR positive; N-P represents plants that did not fluoresce but were RT-PCR positive.

Reference documents:

1.Autour A,Westhof E,Ryckelynck M.iSpinach:a fluorogenic RNA aptamer optimized for in vitro applications.Nucleic Acids Research,2016,44:2491-2500；

2.Chen X,Zhang D,Su N,Bao B,Xie X,Zuo F,Yang L,Wang H,Jiang L,Lin Q,Fang M,Li N,Hua X,Chen Z,Bao C,Xu J,Du W,Zhang L,Zhao Y,Zhu L,Loscalzo J,Yang Y.Visualizing RNA dynamics in live cells with bright and stable fluorescent RNAs.Nature Biotechnology,2019,37:1287-1293；

3.Filonov GS,Kam CW,Song W,Jaffrey SR.In-gel imaging of RNA processing using broccoli reveals optimal aptamer expression strategies.Chemistry and Biology,2015,22:649-660；

4.GS,Moon JD,Svensen N,Jaffrey SR.Broccoli:rapid selection of an RNA mimic of green fluorescent protein by fluorescence-based selection and directed evolution.Journal of the American Chemical Society,2014,136:16299-16308

5.Huang H,Suslov NB,Li NS,Shelke SA,Evans ME,Koldobskaya Y,Rice PA,Piccirill JA.A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore.Nature Chemical Biology,2014,10:686-691；

6.Jiang T,Xing B,Rao J.Recent developments of biological reporter technology for detecting gene expression.Biotechnology and Genetic Engineering Reviews,2008,25:41-76；

7.Karlowski WM,Hirsch AM.The over-expression of an alfalfa RING-H2gene induces pleiotropic effects on plant growth and development.Plant Molecular Biology,2003,52:121-133；

8.Kuiper HA,Kleter GA,Noteborn HP,Kok EJ.Assessment of the food safety issues related to genetically modified foods.The Plant Journal,2001,27:503-528；

9.Miki B,McHugh S.Selectable marker genes in transgenic plants:applications,alternatives and biosafety.Journal of Biotechnology,2004,107:193-232；

10.Page A,Angell S.Transient expression of reporter proteins can alter plant gene expression.Plant Science,2002,163:431-437；

11.Paige JS,Wu KY,Jaffrey SR.RNA mimics of green fluorescent protein.Science,2011,333:642-646；

12.Puchta H.Removing selectable marker genes:taking the shortcut.Trends in Plant Science,2000,5:273-274；

13.Song W,Strack RL,Svensen N,Jaffrey SR.Plug-and-play fluorophores extend the spectral properties of Spinach.Journal of the American Chemical Society,2014,136:1198-1201；

14.Strack RL,Disney MD,Jaffrey SR.A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat-containing RNA.Nature Methods,2013,10:1219-1224；

15.Warner KD,Chen MC,Song W,Strack RL,Thorn A,Jaffrey SR,Ferré-D'AmaréAR.Structural basis for activity of highly efficient RNA mimics of green fluorescent protein.Nature Structural and Molecular Biology,2014,21:658-663；

16.Xia C,Zheng Y,Huang J,Zhou X,Li R,Zha M,Wang S,Huang Z,Lan H,Turgeon R,Fei Z,Zhang C.Elucidation of the mechanisms of long-distance mRNA movement in a Nicotiana benthamiana/tomato heterograft system.Plant Physiology,2018,177:745-758；

17.Yang L,Perrera V,Saplaoura E,Apelt F,Bahin M,Kramdi A,Olas J,Mueller-Roeber B,Sokolowska E,Zhang W,Li R,Pitzalis N,Heinlein M,Zhang S,Genovesio A,Colot V,Kragler F.m ⁵ C methylation guides systemic transport of messenger RNA over graft junctions in plants.Current Biology,2019,29:2465-2476.e2465

18.Zhang J,Fei J,Leslie BJ,Han KY,Kuhlman TE,Ha T.Tandem spinach array for mRNA imaging in living bacterial cells.Scientific Reports,2015,5:17295-17295。

sequence listing

<110> Sichuan university

<120> construction of novel transformation reporter System for plants Using RNA aptamers

<141> 2020-06-15

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 368

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> gene

<222> (1)..(368)

<400> 1

ggtaccttgt catgtgtatg ttggggagac ggtcgggtcc agatattcgt atctgtcgag 60

tagagtgtgg gctccccaca tactttgttg accgagacgg tcgggtccag atattcgtat 120

ctgtcgagta gagtgtgggc tcggtcaatc atggcaagga tccactagta acggccgcca 180

gtgtgctgga attcttgtca tgtgtatgtt ggggagacgg tcgggtccag atattcgtat 240

ctgtcgagta gagtgtgggc tccccacata ctttgttgac cgagacggtc gggtccagat 300

attcgtatct gtcgagtaga gtgtgggctc ggtcaatcat ggcaagatat ccatcacact 360

ggcggccg 368

<210> 2

<211> 1721

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> gene

<222> (1)..(1721)

<400> 2

atgagagagt gcatatcgat ccacattggt caggccggta ttcaggtcgg aaatgcatgc 60

tgggaacttt actgcctcga gcatggcatt cagcctgatg gccagatgcc aggtgacaag 120

acagttggag gaggtgatga tgcattcaac accttcttca gtgaaactgg ggcaggaaaa 180

cacgtccctc gtgctgtctt tgtggatctt gagcctactg tcattgacga agtcaggact 240

ggaacataca ggcagctctt tcaccctgag cagcttatca gtggcaaaga agatgcagcc 300

aacaactttg cccgcggaca ttatacaatt gggaaagaga tagttgatct ctgcttggat 360

cgcatcagga agcttgcaga taactgtact ggtcttcaag gttttctggt tttcaatgct 420

gttggtggtg gaactggttc aggtctaggg tcacttctgc tggagcgtct ctctgtggac 480

tacggcaaga aatcaaaact tggtttcacc atttatccat caccacaggt ctcaacctct 540

gtggtggaac cttacaacag tgtcctgtca acccactccc ttcttgagca cactgatgtt 600

gcagttcttc ttgacaatga ggccatttat gacatttgca gacgctcatt ggacattgag 660

cgacccacat acaccaatct gaaccgactt atttcacagg tcatttcttc gttgactgct 720

tcgttgaggt ttgatggggc actgaatgtt gatgtgaatg aattccagac caaccttgtt 780

ccctacccca ggattcattt tatgctttcc tcctatgctc ctgtcatttc agctgagaag 840

gcctaccatg agcagctctc agttgcagag atcaccaaca gtgcttttga gccatcttcc 900

atgatggtta agtgtgatcc tcgccatggc aagtacatgg cgtgctgcct tatgttccgt 960

ggtgatgttg tgccaaagga tgtcaatgct gctgtggcta ccatcaagac taagcgcacc 1020

atccaatttg ttgactggtg ccctaccgga ttcaagtgtg gtatcaacta tcagccacca 1080

actgttgttc ctggaggtga tcttgccaag gtgcaaaggg ctgtatgtat gatatccaac 1140

tcaaccagtg ttgctgaggt cttctcacgc attgaccaca agttcgatct tatgtatgcc 1200

aaacgtgctt tcgtgcactg gtatgttggt gagggtatgg aggaaggtga gttcagtgaa 1260

gcgcgtgaag atctggctgc tctggaaaag gattacgagg aagttggtgc tgaattggag 1320

gaaggagaag aggatgatca tgaggaatac taaggtacct tgtcatgtgt atgttgggga 1380

gacggtcggg tccagatatt cgtatctgtc gagtagagtg tgggctcccc acatactttg 1440

ttgaccgaga cggtcgggtc cagatattcg tatctgtcga gtagagtgtg ggctcggtca 1500

atcatggcaa ggatccacta gtaacggccg ccagtgtgct ggaattcttg tcatgtgtat 1560

gttggggaga cggtcgggtc cagatattcg tatctgtcga gtagagtgtg ggctccccac 1620

atactttgtt gaccgagacg gtcgggtcca gatattcgta tctgtcgagt agagtgtggg 1680

ctcggtcaat catggcaaga tatccatcac actggcggcc g 1721

<210> 3

<211> 8301

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> gene

<222> (1)..(8301)

<400> 3

ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga 60

gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg 120

gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa 180

cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac 240

aacaactggc gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc 300

acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg 360

tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc 420

ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca 480

ttgctgtgga agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga 540

cacccatcaa cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc 600

tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg 660

cgcgtctgcg tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag 720

cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga 780

atgagggcat cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa 840

tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg 900

acgataccga agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc 960

gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga 1020

agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata 1080

cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt 1140

cccgactgga aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag 1200

gcacaattct catgtttgac agcttatcat cgactgcacg gtgcaccaat gcttctggcg 1260

tcaggcagcc atcggaagct gtggtatggc tgtgcaggtc gtaaatcact gcataattcg 1320

tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt gcgccgacat cataacggtt 1380

ctggcaaata ttctgaaatg agctgttgac aattaatcat cggctcgtat aatgtgtgga 1440

attgtgagcg gataacaatt tcacacagga aacagccagt ccgtttaggt gttttcacga 1500

gcacttcacc aacaaggacc atagcatatg aaaatcgaag aaggtaaact ggtaatctgg 1560

attaacggcg ataaaggcta taacggtctc gctgaagtcg gtaagaaatt cgagaaagat 1620

accggaatta aagtcaccgt tgagcatccg gataaactgg aagagaaatt cccacaggtt 1680

gcggcaactg gcgatggccc tgacattatc ttctgggcac acgaccgctt tggtggctac 1740

gctcaatctg gcctgttggc tgaaatcacc ccggacaaag cgttccagga caagctgtat 1800

ccgtttacct gggatgccgt acgttacaac ggcaagctga ttgcttaccc gatcgctgtt 1860

gaagcgttat cgctgattta taacaaagat ctgctgccga acccgccaaa aacctgggaa 1920

gagatcccgg cgctggataa agaactgaaa gcgaaaggta agagcgcgct gatgttcaac 1980

ctgcaagaac cgtacttcac ctggccgctg attgctgctg acgggggtta tgcgttcaag 2040

tatgaaaacg gcaagtacga cattaaagac gtgggcgtgg ataacgctgg cgcgaaagcg 2100

ggtctgacct tcctggttga cctgattaaa aacaaacaca tgaatgcaga caccgattac 2160

tccatcgcag aagctgcctt taataaaggc gaaacagcga tgaccatcaa cggcccgtgg 2220

gcatggtcca acatcgacac cagcaaagtg aattatggtg taacggtact gccgaccttc 2280

aagggtcaac catccaaacc gttcgttggc gtgctgagcg caggtattaa cgccgccagt 2340

ccgaacaaag agctggcaaa agagttcctc gaaaactatc tgctgactga tgaaggtctg 2400

gaagcggtta ataaagacaa accgctgggt gccgtagcgc tgaagtctta cgaggaagag 2460

ttggcgaaag atccacgtat tgccgccact atggaaaacg cccagaaagg tgaaatcatg 2520

ccgaacatcc cgcagatgtc cgctttctgg tatgccgtgc gtactgcggt gatcaacgcc 2580

gccagcggtc gtcagactgt cgatgaagcc ctgaaagacg cgcagactaa ttcgagctcc 2640

atgagagagt gcatatcgat ccacattggt caggccggta ttcaggtcgg aaatgcatgc 2700

tgggaacttt actgcctcga gcatggcatt cagcctgatg gccagatgcc aggtgacaag 2760

acagttggag gaggtgatga tgcattcaac accttcttca gtgaaactgg ggcaggaaaa 2820

cacgtccctc gtgctgtctt tgtggatctt gagcctactg tcattgacga agtcaggact 2880

ggaacataca ggcagctctt tcaccctgag cagcttatca gtggcaaaga agatgcagcc 2940

aacaactttg cccgcggaca ttatacaatt gggaaagaga tagttgatct ctgcttggat 3000

cgcatcagga agcttgcaga taactgtact ggtcttcaag gttttctggt tttcaatgct 3060

gttggtggtg gaactggttc aggtctaggg tcacttctgc tggagcgtct ctctgtggac 3120

tacggcaaga aatcaaaact tggtttcacc atttatccat caccacaggt ctcaacctct 3180

gtggtggaac cttacaacag tgtcctgtca acccactccc ttcttgagca cactgatgtt 3240

gcagttcttc ttgacaatga ggccatttat gacatttgca gacgctcatt ggacattgag 3300

cgacccacat acaccaatct gaaccgactt atttcacagg tcatttcttc gttgactgct 3360

tcgttgaggt ttgatggggc actgaatgtt gatgtgaatg aattccagac caaccttgtt 3420

ccctacccca ggattcattt tatgctttcc tcctatgctc ctgtcatttc agctgagaag 3480

gcctaccatg agcagctctc agttgcagag atcaccaaca gtgcttttga gccatcttcc 3540

atgatggtta agtgtgatcc tcgccatggc aagtacatgg cgtgctgcct tatgttccgt 3600

ggtgatgttg tgccaaagga tgtcaatgct gctgtggcta ccatcaagac taagcgcacc 3660

atccaatttg ttgactggtg ccctaccgga ttcaagtgtg gtatcaacta tcagccacca 3720

actgttgttc ctggaggtga tcttgccaag gtgcaaaggg ctgtatgtat gatatccaac 3780

tcaaccagtg ttgctgaggt cttctcacgc attgaccaca agttcgatct tatgtatgcc 3840

aaacgtgctt tcgtgcactg gtatgttggt gagggtatgg aggaaggtga gttcagtgaa 3900

gcgcgtgaag atctggctgc tctggaaaag gattacgagg aagttggtgc tgaattggag 3960

gaaggagaag aggatgatca tgaggaatac taaggtacct tgtcatgtgt atgttgggga 4020

gacggtcggg tccagatatt cgtatctgtc gagtagagtg tgggctcccc acatactttg 4080

ttgaccgaga cggtcgggtc cagatattcg tatctgtcga gtagagtgtg ggctcggtca 4140

atcatggcaa ggatccacta gtaacggccg ccagtgtgct ggaattcttg tcatgtgtat 4200

gttggggaga cggtcgggtc cagatattcg tatctgtcga gtagagtgtg ggctccccac 4260

atactttgtt gaccgagacg gtcgggtcca gatattcgta tctgtcgagt agagtgtggg 4320

ctcggtcaat catggcaaga tatccatcac actggcggcc gtctagagtc gacctgcagg 4380

caagcttggc actggccgtc gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc 4440

aacttaatcg ccttgcagca catccccctt tcgccagctg gcgtaatagc gaagaggccc 4500

gcaccgatcg cccttcccaa cagttgcgca gcctgaatgg cgaatggcag cttggctgtt 4560

ttggcggatg agataagatt ttcagcctga tacagattaa atcagaacgc agaagcggtc 4620

tgataaaaca gaatttgcct ggcggcagta gcgcggtggt cccacctgac cccatgccga 4680

actcagaagt gaaacgccgt agcgccgatg gtagtgtggg gtctccccat gcgagagtag 4740

ggaactgcca ggcatcaaat aaaacgaaag gctcagtcga aagactgggc ctttcgtttt 4800

atctgttgtt tgtcggtgaa cgctctcctg agtaggacaa atccgccggg agcggatttg 4860

aacgttgcga agcaacggcc cggagggtgg cgggcaggac gcccgccata aactgccagg 4920

catcaaatta agcagaaggc catcctgacg gatggccttt ttgcgtttct acaaactctt 4980

tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat 5040

aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc 5100

ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga 5160

aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca 5220

acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttctccaatg atgagcactt 5280

ttaaagttct gctatgtggc gcggtattat cccgtgttga cgccgggcaa gagcaactcg 5340

gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc 5400

atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata 5460

acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta accgcttttt 5520

tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag 5580

ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca acgttgcgca 5640

aactattaac tggcgaacta cttactctag cttcccggca acaattaata gactggatgg 5700

aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg 5760

ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca ctggggccag 5820

atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca actatggatg 5880

aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag 5940

accaagttta ctcatatata ctttagattg atttaccccg gttgataatc agaaaagccc 6000

caaaaacagg aagattgtat aagcaaatat ttaaattgta aacgttaata ttttgttaaa 6060

attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa 6120

aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa 6180

caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca 6240

gggcgatggc ccactacgtg aaccatcacc caaatcaagt tttttggggt cgaggtgccg 6300

taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc 6360

ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc 6420

aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca 6480

gggcgcgtaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt 6540

aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt 6600

gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 6660

cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca 6720

gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca 6780

agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg 6840

ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg 6900

cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 6960

acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga 7020

gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc 7080

ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg 7140

agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg 7200

cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt 7260

tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc 7320

gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcctgatgc 7380

ggtattttct ccttacgcat ctgtgcggta tttcacaccg catatatggt gcactctcag 7440

tacaatctgc tctgatgccg catagttaag ccagtataca ctccgctatc gctacgtgac 7500

tgggtcatgg ctgcgccccg acacccgcca acacccgctg acgcgccctg acgggcttgt 7560

ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag 7620

aggttttcac cgtcatcacc gaaacgcgcg aggcagctgc ggtaaagctc atcagcgtgg 7680

tcgtgcagcg attcacagat gtctgcctgt tcatccgcgt ccagctcgtt gagtttctcc 7740

agaagcgtta atgtctggct tctgataaag cgggccatgt taagggcggt tttttcctgt 7800

ttggtcactg atgcctccgt gtaaggggga tttctgttca tgggggtaat gataccgatg 7860

aaacgagaga ggatgctcac gatacgggtt actgatgatg aacatgcccg gttactggaa 7920

cgttgtgagg gtaaacaact ggcggtatgg atgcggcggg accagagaaa aatcactcag 7980

ggtcaatgcc agcgcttcgt taatacagat gtaggtgttc cacagggtag ccagcagcat 8040

cctgcgatgc agatccggaa cataatggtg cagggcgctg acttccgcgt ttccagactt 8100

tacgaaacac ggaaaccgaa gaccattcat gttgttgctc aggtcgcaga cgttttgcag 8160

cagcagtcgc ttcacgttcg ctcgcgtatc ggtgattcat tctgctaacc agtaaggcaa 8220

ccccgccagc ctagccgggt cctcaacgac aggagcacga tcatgcgcac ccgtggccag 8280

gacccaacgc tgcccgaaat t 8301

<210> 4

<211> 11739

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> gene

<222> (1)..(11739)

<400> 4

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga attaattcga gctcggatct gataatttat 120

ttgaaaattc ataagaaaag caaacgttac atgaattgat gaaacaatac aaagacagat 180

aaagccacgc acatttagga tattggccga gattactgaa tattgagtaa gatcacggaa 240

tttctgacag gagcatgtct tcaattcagc ccaaatggca gttgaaatac tcaaaccgcc 300

ccatatgcag gagcggatca ttcattgttt gtttggttgc ctttgccaac atgggagtcc 360

aagattctgc agttagatct cggtgacggg caggaccgga cggggcggta ccggcaggct 420

gaagtccagc tgccagaaac ccacgtcatg ccagttcccg tgcttgaagc cggccgcccg 480

cagcatgccg cggggggcat atccgagcgc ctcgtgcatg cgcacgctcg ggtcgttggg 540

cagcccgatg acagcgacca cgctcttgaa gccctgtgcc tccagggact tcagcaggtg 600

ggtgtagagc gtggagccca gtcccgtccg ctggtggcgg ggggagacgt acacggtcga 660

ctcggccgtc cagtcgtagg cgttgcgtgc cttccagggg cccgcgtagg cgatgccggc 720

gacctcgccg tccacctcgg cgacgagcca gggatagcgc tcccgcagac ggacgaggtc 780

gtccgtccac tcctgcggtt cctgcggctc ggtacggaag ttgaccgtgc ttgtctcgat 840

gtagtggttg acgatggtgc agaccgccgg catgtccgcc tcggtggcac ggcggatgtc 900

ggccgggcgt cgttctgggc tcatcgattc gatttggtgt atcgagattg gttatgaaat 960

tcagatgcta gtgtaatgta ttggtaattt gggaagatat aataggaagc aaggctattt 1020

atccatttct gaaaaggcga aatggcgtca ccgcgagcgt cacgcgcatt ccgttcttgc 1080

tgtaaagcgt tgtttggtac acttttgact agcgaggctt ggcgtgtcag cgtatctatt 1140

caaaagtcgt taatggctgc ggatcaagaa aaagttggaa tagaaacaga atacccgcga 1200

aattcaggcc cggttgccat gtcctacacg ccgaaataaa cgaccaaatt agtagaaaaa 1260

taaaaactag ctcagatact tacgtcacgt cttgcgcact gatttgaaaa atctcagaat 1320

tccaatccca caaaaatctg agcttaacag cacagttgct cctctcagag cagaatcggg 1380

tattcaacac cctcatatca actactacgt tgtgtataac ggtccacatg ccggtatata 1440

cgatgactgg ggttgtacaa aggcggcaac aaacggcgtt cccggagttg cacacaagaa 1500

atttgccact attacagagg caagagcagc agctgacgcg tacacaacaa gtcagcaaac 1560

agacaggttg aacttcatcc ccaaaggaga agctcaactc aagcccaaga gctttgctaa 1620

ggccctaaca agcccaccaa agcaaaaagc ccactggctc acgctaggaa ccaaaaggcc 1680

cagcagtgat ccagccccaa aagagactcc tttgccccgg agattacaat ggacgatttc 1740

ctctatcttt acgatctagg aaggaagttc gaaggtgaag gtgacgacac tatgttcacc 1800

actgataatg agaaggttag cctcttcaat ttcagaaaga atgctgaccc acagatggtt 1860

agagaggcct acgcagcagg tctcatcaag acgatctacc cgagtaacaa tctccaggag 1920

atcaaatacc ttcccaagaa ggttaaagat gcagtcaaaa gattcaggac taattgcatc 1980

aagaacacag agaaagacat atttctcaag atcagaagta ctattccagt atggacgatt 2040

caaggcttgc ttcataaacc aaggcaagta atagagattg gagtctctaa aaaggtagtt 2100

cctactgaat ctaaggccat gcatggagtc taagattcaa atcgaggatc taacagaact 2160

cgccgtgaag actggcgaac agttcataca gagtctttta cgactcaatg acaagaagaa 2220

aatcttcgtc aacatggtgg agcacgacac tctggtctac tccaaaaatg tcaaagatac 2280

agtctcagaa gaccaaaggg ctattgagac ttttcaacaa aggataattt cgggaaacct 2340

cctcggattc cattgcccag ctatctgtca cttcatcgaa aggacagtag aaaaggaagg 2400

tggctcctac aaatgccatc attgcgataa aggaaaggct atcattcaag atctctctgc 2460

cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa aagaagacgt 2520

tccaaccacg tcttcaaagc aagtggattg atgtgacatc tccactgacg taagggatga 2580

cgcacaatcc cactatcctt cgcaagaccc ttcctctata taaggaagtt catttcattt 2640

ggagaggaca cgctcgagta taagagctct atttttacaa caattaccaa caacaacaaa 2700

caacaaacaa cattacaatt acatttacaa ttaccatggg gcgcgccatg agagagtgca 2760

tatcgatcca cattggtcag gccggtattc aggtcggaaa tgcatgctgg gaactttact 2820

gcctcgagca tggcattcag cctgatggcc agatgccagg tgacaagaca gttggaggag 2880

gtgatgatgc attcaacacc ttcttcagtg aaactggggc aggaaaacac gtccctcgtg 2940

ctgtctttgt ggatcttgag cctactgtca ttgacgaagt caggactgga acatacaggc 3000

agctctttca ccctgagcag cttatcagtg gcaaagaaga tgcagccaac aactttgccc 3060

gcggacatta tacaattggg aaagagatag ttgatctctg cttggatcgc atcaggaagc 3120

ttgcagataa ctgtactggt cttcaaggtt ttctggtttt caatgctgtt ggtggtggaa 3180

ctggttcagg tctagggtca cttctgctgg agcgtctctc tgtggactac ggcaagaaat 3240

caaaacttgg tttcaccatt tatccatcac cacaggtctc aacctctgtg gtggaacctt 3300

acaacagtgt cctgtcaacc cactcccttc ttgagcacac tgatgttgca gttcttcttg 3360

acaatgaggc catttatgac atttgcagac gctcattgga cattgagcga cccacataca 3420

ccaatctgaa ccgacttatt tcacaggtca tttcttcgtt gactgcttcg ttgaggtttg 3480

atggggcact gaatgttgat gtgaatgaat tccagaccaa ccttgttccc taccccagga 3540

ttcattttat gctttcctcc tatgctcctg tcatttcagc tgagaaggcc taccatgagc 3600

agctctcagt tgcagagatc accaacagtg cttttgagcc atcttccatg atggttaagt 3660

gtgatcctcg ccatggcaag tacatggcgt gctgccttat gttccgtggt gatgttgtgc 3720

caaaggatgt caatgctgct gtggctacca tcaagactaa gcgcaccatc caatttgttg 3780

actggtgccc taccggattc aagtgtggta tcaactatca gccaccaact gttgttcctg 3840

gaggtgatct tgccaaggtg caaagggctg tatgtatgat atccaactca accagtgttg 3900

ctgaggtctt ctcacgcatt gaccacaagt tcgatcttat gtatgccaaa cgtgctttcg 3960

tgcactggta tgttggtgag ggtatggagg aaggtgagtt cagtgaagcg cgtgaagatc 4020

tggctgctct ggaaaaggat tacgaggaag ttggtgctga attggaggaa ggagaagagg 4080

atgatcatga ggaatactaa ggtaccttgt catgtgtatg ttggggagac ggtcgggtcc 4140

agatattcgt atctgtcgag tagagtgtgg gctccccaca tactttgttg accgagacgg 4200

tcgggtccag atattcgtat ctgtcgagta gagtgtgggc tcggtcaatc atggcaagga 4260

tccactagta acggccgcca gtgtgctgga attcttgtca tgtgtatgtt ggggagacgg 4320

tcgggtccag atattcgtat ctgtcgagta gagtgtgggc tccccacata ctttgttgac 4380

cgagacggtc gggtccagat attcgtatct gtcgagtaga gtgtgggctc ggtcaatcat 4440

ggcaagatat ccatcacact ggcggccgtc tagagagtta attaagaccc gggactagtc 4500

cctagagtcc tgctttaatg agatatgcga gacgcctatg atcgcatgat atttgctttc 4560

aattctgttg tgcacgttgt aaaaaacctg agcatgtgta gctcagatcc ttaccgccgg 4620

tttcggttca ttctaatgaa tatatcaccc gttactatcg tatttttatg aataatattc 4680

tccgttcaat ttactgattg taccctacta cttatatgta caatattaaa atgaaaacaa 4740

tatattgtgc tgaataggtt tatagcgaca tctatgatag agcgccacaa taacaaacaa 4800

ttgcgtttta ttattacaaa tccaatttta aaaaaagcgg cagaaccggt caaacctaaa 4860

agactgatta cataaatctt attcaaattt caaaagtgcc ccaggggcta gtatctacga 4920

cacaccgagc ggcgaactaa taacgctcac tgaagggaac tccggttccc cgccggcgcg 4980

catgggtgag attccttgaa gttgagtatt ggccgtccgc tctaccgaaa gttacgggca 5040

ccattcaacc cggtccagca cggcggccgg gtaaccgact tgctgccccg agaattatgc 5100

agcatttttt tggtgtatgt gggccccaaa tgaagtgcag gtcaaacctt gacagtgacg 5160

acaaatcgtt gggcgggtcc agggcgaatt ttgcgacaac atgtcgaggc tcagcaggac 5220

ctgcaggcat gcaagcttgg cactggccgt cgttttacaa cgtcgtgact gggaaaaccc 5280

tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag 5340

cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctgaatg gcgaatgcta 5400

gagcagcttg agcttggatc agattgtcgt ttcccgcctt cagtttaaac tatcagtgtt 5460

tgacaggata tattggcggg taaacctaag agaaaagagc gtttattaga ataacggata 5520

tttaaaaggg cgtgaaaagg tttatccgtt cgtccatttg tatgtgcatg ccaaccacag 5580

ggttcccctc gggatcaaag tactttgatc caacccctcc gctgctatag tgcagtcggc 5640

ttctgacgtt cagtgcagcc gtcttctgaa aacgacatgt cgcacaagtc ctaagttacg 5700

cgacaggctg ccgccctgcc cttttcctgg cgttttcttg tcgcgtgttt tagtcgcata 5760

aagtagaata cttgcgacta gaaccggaga cattacgcca tgaacaagag cgccgccgct 5820

ggcctgctgg gctatgcccg cgtcagcacc gacgaccagg acttgaccaa ccaacgggcc 5880

gaactgcacg cggccggctg caccaagctg ttttccgaga agatcaccgg caccaggcgc 5940

gaccgcccgg agctggccag gatgcttgac cacctacgcc ctggcgacgt tgtgacagtg 6000

accaggctag accgcctggc ccgcagcacc cgcgacctac tggacattgc cgagcgcatc 6060

caggaggccg gcgcgggcct gcgtagcctg gcagagccgt gggccgacac caccacgccg 6120

gccggccgca tggtgttgac cgtgttcgcc ggcattgccg agttcgagcg ttccctaatc 6180

atcgaccgca cccggagcgg gcgcgaggcc gccaaggccc gaggcgtgaa gtttggcccc 6240

cgccctaccc tcaccccggc acagatcgcg cacgcccgcg agctgatcga ccaggaaggc 6300

cgcaccgtga aagaggcggc tgcactgctt ggcgtgcatc gctcgaccct gtaccgcgca 6360

cttgagcgca gcgaggaagt gacgcccacc gaggccaggc ggcgcggtgc cttccgtgag 6420

gacgcattga ccgaggccga cgccctggcg gccgccgaga atgaacgcca agaggaacaa 6480

gcatgaaacc gcaccaggac ggccaggacg aaccgttttt cattaccgaa gagatcgagg 6540

cggagatgat cgcggccggg tacgtgttcg agccgcccgc gcacgtctca accgtgcggc 6600

tgcatgaaat cctggccggt ttgtctgatg ccaagctggc ggcctggccg gccagcttgg 6660

ccgctgaaga aaccgagcgc cgccgtctaa aaaggtgatg tgtatttgag taaaacagct 6720

tgcgtcatgc ggtcgctgcg tatatgatgc gatgagtaaa taaacaaata cgcaagggga 6780

acgcatgaag gttatcgctg tacttaacca gaaaggcggg tcaggcaaga cgaccatcgc 6840

aacccatcta gcccgcgccc tgcaactcgc cggggccgat gttctgttag tcgattccga 6900

tccccagggc agtgcccgcg attgggcggc cgtgcgggaa gatcaaccgc taaccgttgt 6960

cggcatcgac cgcccgacga ttgaccgcga cgtgaaggcc atcggccggc gcgacttcgt 7020

agtgatcgac ggagcgcccc aggcggcgga cttggctgtg tccgcgatca aggcagccga 7080

cttcgtgctg attccggtgc agccaagccc ttacgacata tgggccaccg ccgacctggt 7140

ggagctggtt aagcagcgca ttgaggtcac ggatggaagg ctacaagcgg cctttgtcgt 7200

gtcgcgggcg atcaaaggca cgcgcatcgg cggtgaggtt gccgaggcgc tggccgggta 7260

cgagctgccc attcttgagt cccgtatcac gcagcgcgtg agctacccag gcactgccgc 7320

cgccggcaca accgttcttg aatcagaacc cgagggcgac gctgcccgcg aggtccaggc 7380

gctggccgct gaaattaaat caaaactcat ttgagttaat gaggtaaaga gaaaatgagc 7440

aaaagcacaa acacgctaag tgccggccgt ccgagcgcac gcagcagcaa ggctgcaacg 7500

ttggccagcc tggcagacac gccagccatg aagcgggtca actttcagtt gccggcggag 7560

gatcacacca agctgaagat gtacgcggta cgccaaggca agaccattac cgagctgcta 7620

tctgaataca tcgcgcagct accagagtaa atgagcaaat gaataaatga gtagatgaat 7680

tttagcggct aaaggaggcg gcatggaaaa tcaagaacaa ccaggcaccg acgccgtgga 7740

atgccccatg tgtggaggaa cgggcggttg gccaggcgta agcggctggg ttgtctgccg 7800

gccctgcaat ggcactggaa cccccaagcc cgaggaatcg gcgtgagcgg tcgcaaacca 7860

tccggcccgg tacaaatcgg cgcggcgctg ggtgatgacc tggtggagaa gttgaaggcc 7920

gcgcaggccg cccagcggca acgcatcgag gcagaagcac gccccggtga atcgtggcaa 7980

gcggccgctg atcgaatccg caaagaatcc cggcaaccgc cggcagccgg tgcgccgtcg 8040

attaggaagc cgcccaaggg cgacgagcaa ccagattttt tcgttccgat gctctatgac 8100

gtgggcaccc gcgatagtcg cagcatcatg gacgtggccg ttttccgtct gtcgaagcgt 8160

gaccgacgag ctggcgaggt gatccgctac gagcttccag acgggcacgt agaggtttcc 8220

gcagggccgg ccggcatggc cagtgtgtgg gattacgacc tggtactgat ggcggtttcc 8280

catctaaccg aatccatgaa ccgataccgg gaagggaagg gagacaagcc cggccgcgtg 8340

ttccgtccac acgttgcgga cgtactcaag ttctgccggc gagccgatgg cggaaagcag 8400

aaagacgacc tggtagaaac ctgcattcgg ttaaacacca cgcacgttgc catgcagcgt 8460

acgaagaagg ccaagaacgg ccgcctggtg acggtatccg agggtgaagc cttgattagc 8520

cgctacaaga tcgtaaagag cgaaaccggg cggccggagt acatcgagat cgagctagct 8580

gattggatgt accgcgagat cacagaaggc aagaacccgg acgtgctgac ggttcacccc 8640

gattactttt tgatcgatcc cggcatcggc cgttttctct accgcctggc acgccgcgcc 8700

gcaggcaagg cagaagccag atggttgttc aagacgatct acgaacgcag tggcagcgcc 8760

ggagagttca agaagttctg tttcaccgtg cgcaagctga tcgggtcaaa tgacctgccg 8820

gagtacgatt tgaaggagga ggcggggcag gctggcccga tcctagtcat gcgctaccgc 8880

aacctgatcg agggcgaagc atccgccggt tcctaatgta cggagcagat gctagggcaa 8940

attgccctag caggggaaaa aggtcgaaaa ggtctctttc ctgtggatag cacgtacatt 9000

gggaacccaa agccgtacat tgggaaccgg aacccgtaca ttgggaaccc aaagccgtac 9060

attgggaacc ggtcacacat gtaagtgact gatataaaag agaaaaaagg cgatttttcc 9120

gcctaaaact ctttaaaact tattaaaact cttaaaaccc gcctggcctg tgcataactg 9180

tctggccagc gcacagccga agagctgcaa aaagcgccta cccttcggtc gctgcgctcc 9240

ctacgccccg ccgcttcgcg tcggcctatc gcggccgctg gccgctcaaa aatggctggc 9300

ctacggccag gcaatctacc agggcgcgga caagccgcgc cgtcgccact cgaccgccgg 9360

cgcccacatc aaggcaccct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca 9420

catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc 9480

ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg 9540

tagcgatagc ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga 9600

gtgcaccata tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg 9660

cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg 9720

gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga 9780

aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 9840

gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 9900

aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 9960

gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 10020

ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 10080

cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 10140

ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 10200

actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 10260

tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca 10320

gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 10380

ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat 10440

cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt 10500

ttggtcatgc attctaggta ctaaaacaat tcatccagta aaatataata ttttattttc 10560

tcccaatcag gcttgatccc cagtaagtca aaaaatagct cgacatactg ttcttccccg 10620

atatcctccc tgatcgaccg gacgcagaag gcaatgtcat accacttgtc cgccctgccg 10680

cttctcccaa gatcaataaa gccacttact ttgccatctt tcacaaagat gttgctgtct 10740

cccaggtcgc cgtgggaaaa gacaagttcc tcttcgggct tttccgtctt taaaaaatca 10800

tacagctcgc gcggatcttt aaatggagtg tcttcttccc agttttcgca atccacatcg 10860

gccagatcgt tattcagtaa gtaatccaat tcggctaagc ggctgtctaa gctattcgta 10920

tagggacaat ccgatatgtc gatggagtga aagagcctga tgcactccgc atacagctcg 10980

ataatctttt cagggctttg ttcatcttca tactcttccg agcaaaggac gccatcggcc 11040

tcactcatga gcagattgct ccagccatca tgccgttcaa agtgcaggac ctttggaaca 11100

ggcagctttc cttccagcca tagcatcatg tccttttccc gttccacatc ataggtggtc 11160

cctttatacc ggctgtccgt catttttaaa tataggtttt cattttctcc caccagctta 11220

tataccttag caggagacat tccttccgta tcttttacgc agcggtattt ttcgatcagt 11280

tttttcaatt ccggtgatat tctcatttta gccatttatt atttccttcc tcttttctac 11340

agtatttaaa gataccccaa gaagctaatt ataacaagac gaactccaat tcactgttcc 11400

ttgcattcta aaaccttaaa taccagaaaa cagctttttc aaagttgttt tcaaagttgg 11460

cgtataacat agtatcgacg gagccgattt tgaaaccgcg gtgatcacag gcagcaacgc 11520

tctgtcatcg ttacaatcaa catgctaccc tccgcgagat catccgtgtt tcaaacccgg 11580

cagcttagtt gccgttcttc cgaatagcat cggtaacatg agcaaagtct gccgccttac 11640

aacggctctc ccgctgacgc cgtcccggac tgatgggctg cctgtatcga gtggtgattt 11700

tgtgccgagc tgccggtcgg ggagctgttg gctggctgg 11739

<210> 5

<211> 25

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> primer_bind

<222> (1)..(25)

<400> 5

gctctagaat gagagagtgc atatc 25

<210> 6

<211> 26

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> primer_bind

<222> (1)..(26)

<400> 6

cggagctccc ggccgccagt gtgatg 26

Claims (5)

1. A method for constructing a plant transformation report identification of RNA level by using RNA aptamer is characterized by comprising the following steps: the method for identifying the plant transformation report line is characterized in that a sequence table SEQ ID NO:1 as the genetic marker of RNA aptamer 3WJ-4 xBro, wherein the genetic marker optimizes the core locus of original broccoli by utilizing an RNAfold online service system, and is connected to a new trifurcate scaffold structure 3WJ in four copies to form a sequence shown as SEQ ID NO:1, linking the 3WJ-4 xBro tag with the 3' end of a target gene to obtain a fusion gene, and introducing the fusion gene into a plant expression vector NtTub alpha-3 WJ-4 xBro, wherein the nucleotide sequence of the plant expression vector is shown as SEQ ID NO:2, forming a recombinant plant expression vector pFGC5941-NtTub alpha-3 WJ-4 xBro, the nucleotide sequence of which is shown as SEQ ID NO: and 4, further transforming the receptor plant, permeating fluorescent micromolecule DFHBI-1T into leaves of the transformed receptor plant, processing for 10 hours in the dark, collecting the leaves of the receptor plant, and placing the leaves under a fluorescent microscope to observe a green fluorescent signal, so that the report identification of the positive transformed plant is realized.

2. The method of claim 1, wherein said recipient plant is selected from the group consisting of arabidopsis thaliana.

3. Use of the method of claim 1 for the identification of a transgene in a plant.

4. The use of claim 3, wherein said use comprises identifying the expression level of a target gene in a transgenic plant.

5. Use of the method of plant transformation report identification of claim 1 in the construction of plant expression vectors.

Images