CN111690651A - Truncated miRNA for blocking ecdysone synthesis pathway of chilo suppressalis in rice and application thereof - Google Patents

Abstract

The invention provides a truncated miRNA for blocking a striped rice borer ecdysone synthesis pathway in rice and application thereof, belonging to the technical field of genetic engineering. The truncated miRNA for blocking the ecdysone synthesis pathway of chilo suppressalis in the rice is formed by deleting a nucleotide sequence of 6-7 nt at the 3' end on the basis of csu-novel-miR 260. The application of the truncated miRNA in rice chilo suppressalis resistance or construction of transgenic rice. According to the nucleotide sequence of the truncated miRNA, the invention also provides the miRNA agonist for blocking the ecdysone synthesis pathway of chilo suppressalis in rice. Experiments prove that the truncated miRNA can inhibit the expression of Dib gene in the ecdysone synthesis pathway of chilo suppressalis in vivo through the expression of transgenic rice cells or direct in-vitro feeding, so that the aim of killing the chilo suppressalis is fulfilled by inhibiting the synthesis of ecdysone. Therefore, the truncated miRNA can retain the insect-resistant activity, and a new means is provided for killing chilo suppressalis.

Description

Truncated miRNA for blocking ecdysone synthesis pathway of chilo suppressalis in rice and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a truncated miRNA for blocking a striped rice borer ecdysone synthesis pathway in rice and application thereof.

Background

Rice is one of the most important staple food crops of human beings, and about half of the global population takes the rice as staple food. At present, rice is the second crop in China, and the planting area of the rice all year round is about 3000 million hectares. Chilo suppersalis Walker is a lepidoptera borer family, and is one of the most serious borers in rice production in China. Chilo suppressalis larvae damage rice in a tillering stage to cause withered sheaths and withered heart seedlings; withered booting and white ears are caused for rice in the booting stage and the heading stage; damaging the rice in the filling and milk stage to cause semi-withered ears and insect-damaged plants. The harm of chilo suppressalis larvae can cause serious yield reduction of rice and even death, thereby threatening the food safety of China.

At present, the production mainly depends on a chemically synthesized pesticide to control the harm of chilo suppressalis, and the prevention and treatment mode has various defects. Firstly, pests can quickly generate drug resistance, so that the effect of the chemical insecticide is poor or even ineffective; secondly, the residue of chemical pesticide can harm human health and destroy ecological environment. In addition, spraying the insecticide requires manpower and increases the production cost. Therefore, the utilization of genetic engineering strategies to improve the insect resistance of rice is a relatively economic and environment-friendly pest control strategy.

MicroRNA (miRNA) is a non-coding single-stranded RNA molecule which is coded by endogenous genes and has the length of about 22 nucleotides (nt), generally plays a role in post-transcriptional or post-translational regulation in animals and plants, and is widely involved in regulating and controlling physiological activities of organisms such as growth, development, metabolism and the like. He et al (2007) found that 7 Chilo suppressalis endogenous miRNAs were involved in regulating ecdysone synthesis. Wherein, a newly identified chilo suppressalis miRNA (csu-novel-miR260) with 27nt can inhibit the function of a dib (distorted) gene in an ecdysone synthesis pathway, Dib encodes a cytochrome P450 protein, and catalyzes 2, 22-dideoxy-3-dehydroecdysone to form 2-deoxy-3-dehydroecdysone by adding oxygen at the C22 position, so that the synthesis of ecdysone is regulated. The ecdysone is important for the development of chilo suppressalis larvae, and the injection of the csu-novel-260 simulant into the chilo suppressalis larvae can inhibit the synthesis of the ecdysone, so that the lethality rate of the chilo suppressalis larvae is remarkably improved, and the miRNA is proved to have the potential of being applied to the control of chilo suppressalis damage. At present, no report about applying the miRNA to plants to construct transgenic insect-resistant plants exists.

Disclosure of Invention

In view of the above, the invention aims to provide a truncated miRNA for blocking the ecdysone synthesis pathway of Chilo suppressalis in rice, so as to effectively control the harm of the Chilo suppressalis.

The invention provides a truncated miRNA for blocking a striped rice borer ecdysone synthesis pathway in rice, wherein the miRNA is formed by deleting a nucleotide sequence of 6-7 nt at the 3' end on the basis of csu-novel-miR 260;

the nucleotide sequence of the csu-novel-miR260 is shown in SEQ ID No. 1.

Preferably, 20nt and/or 21nt truncated mirnas are included;

the nucleotide sequence of the 20nt truncated miRNA is shown in SEQ ID No. 2;

the nucleotide sequence of the 21nt truncated miRNA is shown in SEQ ID No. 3.

The invention provides application of the truncated miRNA in rice chilo suppressalis resistance or construction of transgenic rice.

Preferably, the method for resisting chilo suppressalis is to express a truncated miRNA in rice, and Dib gene expression in an ecdysone synthesis pathway in chilo suppressalis eating the rice is inhibited, so that ecdysone synthesis is inhibited, and the purpose of killing chilo suppressalis is achieved.

The invention provides a miRNA agonist for blocking a striped rice borer ecdysone synthesis pathway in rice, wherein the miRNA of the miRNA agonist is the truncated miRNA.

Preferably, each ribose in the miRNA agonist has a 2'-O methylation modification, and the miRNA agonist has a phosphorothioate and cholesterol modification at its 3' end.

The invention provides application of the miRNA agonist in rice chilo suppressalis resistance.

The invention provides an application of the miRNA agonist in the preparation of a Chilo suppressalis biopesticide.

The invention provides a chilo suppressalis biological insecticide, and the active pharmaceutical ingredient comprises the miRNA agonist.

The truncated miRNA for blocking the ecdysone synthesis pathway of chilo suppressalis in the rice provided by the invention comprises the following truncation scheme: deleting a nucleotide sequence of 6-7 nt at the 3' end on the basis of the csu-novel-miR260 to form miRNA; the nucleotide sequence of the csu-novel-miR260 is shown in SEQ ID No. 1. In order to verify the insect resistance of the truncated miRNA expressed in the transgenic rice, the transgenic representative families csu260-16 and csu260-18 and the stock control ZH11 are subjected to field chilo suppressalis resistant identification, and the result shows that the csu260-16 and csu260-18 transgenic rice show obvious insect resistance effect under the condition of artificial inoculation in the field environment. Meanwhile, the insect resistance identification result of the heading stage shows that the insect damage suffered by the transgenic csu260 rice is obviously lower than that of a control ZH11, the experimental result further proves that the transgenic csu260-16 and csu260-18 rice has reliable and good insect resistance effect in the field environment, and meanwhile, the truncated miRNA retains higher insect resistance activity.

The miRNA of the miRNA agonist is the truncated miRNA. The miRNA agonist is used for feeding chilo suppressalis larvae in vitro, and results show that the death rate of the chilo suppressalis larvae of two experimental groups of the agomir-20 and the agomir-21 is remarkably higher than that of the agomir-NC group, and the mean larva weight of the chilo suppressalis larvae of the two experimental groups of the agomir-20 and the agomir-21 is remarkably lower than that of the agomir-NC group. Therefore, the 5' sequence of the chilo suppressalis miRNA Csu-novel-260 with the truncated 20nt and the truncated 21nt still has remarkable anti-insect activity, and the anti-insect activity of the 20nt sequence is better than that of the 21nt sequence.

Drawings

FIG. 1 is a schematic structural diagram of recombinant vector pUbi-ami-csu260 constructed in the present invention;

FIG. 2 shows the results of the identification of transgenic rice by indoor stalk feeding and inoculation, wherein FIG. 2a shows the results of mortality; FIG. 2b is the mean worm weight results;

FIG. 3 is the Agomir feeding results, wherein FIG. 3a is mortality results; FIG. 3b is the mean worm weight results;

FIG. 4 shows the results of evaluation of field pest resistance of transgenic rice; FIG. 4a is a plot of heart-rate results; FIG. 4b shows the spike rate results; FIG. 4c is the field performance after heading inoculation, with transgenic rice shown in the left part; the right part of the figure shows the original seed control.

Detailed Description

The invention provides a truncated miRNA for blocking a striped rice borer ecdysone synthesis pathway in rice,

deleting a nucleotide sequence of 6-7 nt at the 3' end on the basis of the csu-novel-miR260 to form miRNA; the nucleotide sequence of the csu-novel-miR260 is shown in SEQ ID No. 1.

In the present invention, the truncated miRNA preferably includes a 20nt truncated miRNA and/or a 21nt truncated miRNA, wherein the 21nt truncated miRNA is a nucleotide sequence truncated near the 3 'end by 6nt based on SEQ ID No.1, and only the 5' end sequence is retained, and the nucleotide sequence of the 21nt truncated miRNA is shown in SEQ ID No. 3. The 20nt truncated miRNA is obtained by cutting a 7nt nucleotide sequence close to the 3 'end on the basis of SEQ ID No.1 and then reserving a 5' end sequence, wherein the 20nt truncated miRNA nucleotide sequence is shown as SEQ ID No. 2.

The invention provides application of the truncated miRNA in rice chilo suppressalis resistance or construction of transgenic rice. In the method for resisting chilo suppressalis, the truncated miRNA is preferably expressed in rice, the expression of Dib gene is inhibited in the in-vivo ecdysone synthesis pathway of the chilo suppressalis eating the rice, the synthesis of ecdysone is inhibited, and the purpose of killing the chilo suppressalis is achieved. In the embodiment of the invention, the csu260-16 and csu260-18 transgenic rice is taken as an experimental object, and the transgenic rice shows a remarkable effect of preventing chilo suppressalis under the condition of artificial inoculation in a field environment.

In the present invention, the method for constructing transgenic rice preferably comprises the steps of:

1) PCR was carried out in sequence using plasmid pNW55 (Warthhmann et al.2008) as a template and primer combinations G-4368/csu260-II, csu260-I/csu260-IV and csu260-III/G-4369, respectively;

2) mixing the three groups of PCR products obtained in the step 1) to be used as a template of a second round of PCR reaction, and carrying out second round PCR amplification by using G-4368/G-4369;

3) TA cloning is carried out on the second round of PCR amplification product, enzyme digestion is carried out on the product by Kpn I and BamHI, and the enzyme digestion fragment is connected with the vector pC1300-Ubi-Nos enzyme digested by Kpn I and BamHI to form a recombinant vector pUbi-ami-csu 260;

4) the obtained recombinant vector pUbi-ami-csu260 is transformed into rice by agrobacterium mediated genetic transformation method, and positive plants obtained by detection are transgenic rice.

In the invention, the sequence of the original 21nt miRNA-5p and miRNA-3p on the pre-miRNA gene of natural rice osa-miR528 is correspondingly replaced by the 27nt target miRNA-5p and miRNA-3p sequence by an overlap extension PCR method to obtain a new pre-miRNA gene csu 260. The sequence of the Csu260 gene is shown in SEQ ID No.4 (the artificial replacement part is underlined): GCTGCTGATGCTGATGCCATGGACGATTAAACCCATAATATAAACTCTGCAAACTTCCACAGAACAGCCTAGCAGCAGGAATTTTGGATGACTGGCCCTTGTGGGCGTAGAGAGGCAAAAGTGAAGTCCAGCTTCAAACTGAATCTCCTGACGCCGACATGGGCCAGTCATCCAAAACTGCTGCTGCTACAGCCAAAAAACCAGACCTAACATAACACCTACCTATCCCAAACCAAATTTTGCTGTGGCTGCTGCTG。

In the present invention, the sequences of G-4368/csu260-II, csu260-I/csu260-IV and csu260-III/G-4369 are shown in Table 1, and the PCR conditions are preferably: 2min at 95 ℃; 30cycles of 95 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 30 s; 7min at 72 ℃.

In the invention, the positive plant detection method is preferably a PCR amplification method; the primers for PCR amplification are Hpt-F and Hpt-R. The PCR reaction conditions are preferably: 2min at 95 ℃; 30cycles of 95 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 30 s; 7min at 72 ℃.

Based on the biological function of the truncated miRNA, the miRNA agonist for blocking the ecdysone synthesis pathway of chilo suppressalis in rice is provided for the convenience of in-vitro use, and the miRNA of the miRNA agonist is the truncated miRNA. In the invention, the miRNA agonist is specially chemically modified, so that the miRNA agonist has higher chemical stability and miRNA activity; the specific chemical modification preferably has a 2'-O methylation modification per ribose, preferably has a phosphorothioate and cholesterol modification at the 3' end of the miRNA agonist, and specifically the phosphorothioate is a backbone modification, one of the oxygens of the phosphate group on the phosphodiester linkage is substituted with a sulfur, and the cholesterol is linked to the nucleic acid strand through the phosphodiester linkage. The preparation method of the miRNA agonist is not particularly limited in the present invention, and a preparation method of a miRNA agonist known in the art may be used. In the present example, the miRNA agonist entrusts the sharp bo company (guangzhou, china) to synthesize the corresponding miRNA analog, agomir, in vitro.

The invention provides application of the miRNA agonist in rice chilo suppressalis resistance. In the invention, the miRNA agonist is applied to rice plants or the environment, and after the chilo suppressalis ingests the miRNA agonist, the function of Dib gene in the in-vivo ecdysone synthesis pathway is disordered, so that the synthesis of ecdysone is inhibited, and the purpose of chilo suppressalis disinsection is achieved.

The invention provides an application of the miRNA agonist in the preparation of a Chilo suppressalis biopesticide.

The invention provides a chilo suppressalis biological insecticide, and the active pharmaceutical ingredient comprises the miRNA agonist. The working concentration of the miRNA stimulant in the biological insecticide is 100 nmol/L. The method for preparing the biopesticide is not particularly limited, and the biopesticide can be prepared by a method well known in the art. The biological pesticide has high insecticidal effect on chilo suppressalis larvae and chilo suppressalis adults.

The following examples are provided to illustrate the truncated miRNA for blocking the ecdysone synthesis pathway of chilo suppressalis in rice and the application thereof in detail, but they should not be construed as limiting the scope of the present invention.

Example 1

1 construction of plant amiRNA expression vectors

The sequence 5'-UUUUGGAUGACUGGCCCAUGUCGGC GU-3' (SEQ ID No.1) of csu-novel-miR260 is used for designing primers required for constructing a plant amiRNA expression vector on a WMD3 website (http:// WMD3.weigelworld. org/cgi-bin/webapp. cgi. Inputting a sequence of csu-novel-miR260 in a text box of 'MircoRNA sequence' under an Oligo column of the website, then selecting an expression Vector 'NW 55' in rice in a 'Vector' option, and obtaining four primer sequences named csu260-I, csu260-II, csu260-III and csu260-IV after clicking determination (see Table 1).

Information on 4 primers designed in Table 1

For a specific construction method of a plant amiRNA expression vector, reference is made to the literature published by Warthmann et al (2008). The basic process of construction is as follows: the original 21nt miRNA-5p and miRNA-3p sequences on the pre-miRNA gene of natural rice osa-miR528 are correspondingly replaced by 27nt target miRNA-5p and miRNA-3p sequences by an overlap extension PCR method to obtain a new pre-miRNA gene csu 260. Specifically, in the first round of PCR, plasmid pNW55(Warthmann et al.2008) is used as a template, and PCR amplification reactions are respectively carried out by using primer combinations G-4368+ csu260-II, csu260-I + csu260-IV and csu260-III + G-4369, wherein the reaction system is as follows:

the PCR reaction conditions are as follows: 2min at 95 ℃; 30cycles at 95 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 30 s; 7min at 72 ℃. And (3) carrying out agarose gel electrophoresis detection on the amplified PCR product, and carrying out gel cutting recovery on DNA fragments with corresponding sizes, wherein the steps are as follows:

1) cutting the EB-dyed agarose gel under an ultraviolet lamp to recover gel containing a PCR product, adding a Binding buffer with the volume of 3 times that of the agarose gel, and placing the agarose gel in a water bath at 50 ℃ until the agarose gel is fully dissolved;

2) adding the dissolved liquid into a DNA recovery column, and centrifuging at 8000rpm for 30 s;

3) add 500. mu.l washing buffer and centrifuge at 8000rpm for 30s, repeat the procedure twice;

4) airing at room temperature for 10 min;

5) adding 10-20 mul ddH₂Dissolving O for 5 min;

6) the liquid was collected by centrifugation at 12000rpm for 2 min.

Respectively recovering and mixing products of 3 PCR reactions to be used as a template of a second round of PCR reaction, and carrying out a second PCR reaction by using a G-4368/G-4369 primer pair, wherein the reaction system is as follows:

the reaction conditions are as follows: 2min at 95 ℃; 30cycles of 95 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 30 s; 7min at 72 ℃.

After agarose gel electrophoresis detection of the PCR product obtained by amplification, TA Cloning was performed on the PCR product using pEASY-T3Cloning Kit (TransGen, Beijing, China) by the following method:

1) mu.l of the PCR product was mixed with 1. mu.l of pEASY-T3Cloning Vector, reacted at room temperature for 5min, and placed on ice;

2) mixing the ligation product obtained in the above step with 50 μ l T1 competent cells, and standing on ice for 30 min;

3) heat shock at 42 deg.c for 30 sec and setting on ice immediately;

4) adding 250ml LB culture medium, and resuscitating for 1h on a shaker (rotating speed) at 37 ℃;

5) the recovered bacterial solution was spread on Amp + resistant LB plates and grown overnight at 37 ℃.

The plasmid of the resistant colony is extracted, and is cut by two endonucleases of Kpn I and BamHI to detect whether the target fragment is inserted, and then DNA sequencing verification is carried out.

The plasmid with the correct sequencing verification is cut by Kpn I and BamH I, and after the target fragment is recovered by agarose gel electrophoresis, the plasmid is connected with a Kpn I and BamHI cut vector pC1300-Ubi-Nos to form a recombinant vector pUbi-ami-csu260 (FIG. 1).

2. Genetic transformation of miRNA expression vectors

The recombinant vector pUbi-ami-csu260 was transformed into rice variety Zhonghua 11(ZH11, Oryza sativa ssp. Geng) by Agrobacterium-mediated genetic transformation to obtain transgenic rice plants.

The specific agrobacterium-mediated genetic transformation method comprises the following steps:

1) callus induction:

mature ZH11 rice seeds were dehulled, then treated sequentially with 75% aqueous ethanol for 1 minute, and surface sterilized with 0.15% aqueous mercuric chloride for 20 minutes. And (4) washing the seeds for 4-5 times by using sterilized single-steaming water, and uniformly placing the seeds on an induction culture medium. And placing the inoculated culture medium in a dark room for culturing for 4-6 weeks at the culture temperature of 28 +/-1 ℃.

2) Callus subculture

The bright yellow, compact and relatively dry embryogenic calli were picked and placed on subculture medium for 3 weeks in the dark at 28. + -. 1 ℃.

3) Preculture

The compact and relatively dry embryogenic callus is picked and placed on a pre-culture medium for culture for 4 days under the dark condition, and the culture temperature is 28 +/-1 ℃.

4) Agrobacterium culture

Agrobacterium was pre-cultured for 2 days at 28. + -. 1 ℃ in LA medium with corresponding resistance selection. And (3) transferring the agrobacterium to a suspension culture medium, and performing shake cultivation for 2-3 h at the temperature of 28 ℃ and the speed of 200 rpm.

5) Infection with Agrobacterium

The pre-cultured calli were transferred to sterilized bottles. Adjusting the suspension of Agrobacterium to OD₆₀₀About 0.3. The callus was soaked in Agrobacterium suspension for 10 min. Transferring the callus to sterilized filter paper, sucking to dry, and then placing on a co-culture medium for culturing for 3d at the temperature of 19-20 ℃.

6) Callus wash and selection culture

And washing the infected calluses with sterilized water for 7-8 times, and then soaking the calluses in sterilized water containing 400mg/L carbenicillin for 30 min. Transferring the callus to sterilized filter paper, and after drying, transferring the callus to a selection medium for selection and culture for 3 times, each time for 2 weeks.

7) Differentiation

The resistant calli were transferred to pre-differentiation medium and cultured for 7 days in the dark at 26 + -1 deg.C. Transferring the pre-differentiation cultured callus to a differentiation culture medium, and culturing under illumination at the culture temperature of 26 +/-1 ℃.

8) Rooting

Cutting off roots generated during differentiation; then transferring the strain to a rooting culture medium, and culturing for 2-3 weeks under illumination, wherein the culture temperature is 26 +/-1 ℃.

9) Transplanting

Residual medium on the roots was washed clean and seedlings with good root systems were transferred to a greenhouse while keeping moisture moist for the first few days (see patent No. 2011100832269 for medium and its formulation in this example).

After 3 weeks of transplanting the transgenic regenerated seedlings, the leaves are respectively taken and DNA is extracted (see the detailed method). PCR positive detection was performed using hygromycin primer Hpt-F/Hpt-R (see Table 1) as follows:

1) extraction of small amount of DNA from rice leaves

Taking 3-5 cm tender leaves, grinding the leaves on a sample grinder into homogenate, adding 800 mu l of 15 × CTAB buffer solution, carrying out water bath in a water bath kettle at 65 ℃ for 30min, shaking up every 5min during the process, adding equal volume ratio of 24:1 (chloroform/isoamylol), slowly reversing and uniformly mixing for 5-10 min, centrifuging at 12000rpm for 10min, absorbing 300 mu l of supernatant, transferring the supernatant into another clean centrifugal tube, adding 2 times of volume of-20 ℃ precooled absolute ethyl alcohol, standing at 20 ℃ for 30min, 12000rpm and centrifuging for 15min, discarding the supernatant, adding 500 mu l of 75% ethanol water solution, mixing up and down and washing, centrifuging at 2000rpm for 5min, discarding the supernatant, drying on a clean bench, adding 100 mu l of sterilized ddH₂O is dissolved at room temperature.

2) PCR detection

The PCR reaction system is as follows:

the PCR reaction conditions are as follows: 5min at 95 ℃, 5s at 95 ℃, 30s at 59 ℃ and 1min at 72 ℃ for 30 cycles; 7min at 72 ℃. Detecting the PCR product through agarose gel electrophoresis, and picking out positive plants.

Example 2

Indoor inoculation identification of transgenic plants

Taking mixed stalks of positive T0 generation transgenic plants to carry out inoculation identification of chilo suppressalis larvae, and the specific method comprises the following steps:

1) taking stalks of the transgenic plant after jointing and the non-transgenic original variety ZH11 rice plant;

2) cutting the stem into stem segments of about 8cm, placing every 5 stem segments into a clean root-growing tube, inoculating 15 first instar chilo suppressalis larvae with the same size, sealing the mouth of the root-growing tube with a sealing film, and arranging 3 tubes for 3 times for each material;

3) feeding in light incubator for 5 days under 28 deg.C, 75% humidity, and light/dark cycle ratio of 16h/8 h;

4) and (5) stripping the stem to take out chilo suppressalis larvae after 5 days, and counting the death rate and insect weight of the chilo suppressalis larvae.

Two groups of independent mixed T0-generation plant stalks (csu260-A and csu260-B) are taken as transgenic materials, and the result of the inoculation identification shows that the average death rate of chilo suppressalis larvae in the two groups of transgenic rice stalks after 5 days of feeding is 52.70 +/-28.42 and 57.30 +/-27.19 percent, which is obviously higher than the average death rate of chilo suppressalis larvae in the control stalks by 25.6 +/-3.7 percent (figure 2 a); the average weight of the chilo suppressalis larvae surviving in the transgenic rice stalks is 1.37 +/-0.54 mg and 1.29 +/-0.31 mg respectively, which is significantly lower than the average weight of the chilo suppressalis larvae surviving in the control stalks, which is 2.24 +/-0.13 mg (fig. 2 b). The mortality and the average insect weight are taken as reference indexes, and the transgenic rice shows obvious insect-resistant effect.

Example 3

Small RNA sequencing and miRNA agomir in-vitro feeding test of transgenic plants

In order to detect the expression condition of exogenous amiRNA in transgenic rice, two representative transgenic families named csu260-16 and csu260-18 were selected for small RNA sequencing. Trizol (all-type gold, Beijing, China) is used for extracting total RNA of leaves of su260-16 and csu260-18 rice plants, and the extracted total RNA is sent to a Nozao pathogen (Beijing, China) for preparation of a small RNA library and Illumina sequencing.

104271 small RNAs matched with the sequence of csu-novel-260 are detected in the csu260-16 transgenic rice, and 11 28651 small RNAs matched with the sequence of csu-novel-260 are detected in the csu260-18 transgenic rice. The small RNA matched with the csu-novel-260 sequence detected in the csu260-16 and csu260-18 transgenic rice is 18-24 nt in length, wherein the maximum content is 20nt of small RNA sequence 5'-UUUUGGAUGACUGGCCCAUG-3' (SEQ I ID NO.2), 55644 pieces (53.4 percent) are detected in the csu260-16, and 15512 pieces (54.1 percent) are detected in the csu 260-18; second most abundant was 21nt of small RNA sequence 5'-UUUUGGAUGACUGGCCCAUGU-3' (SEQ I ID NO.3), which detected 38382 total (36.8% in csu 260-16) and 10488 total (36.6% in csu 260-18). The sequences of two exogenous amiRNAs with the maximum content of 20nt and 21nt are completely matched with the first 20nt and 21nt bases at the 5' end of the csu-novel-260 sequence of 27nt respectively, and account for more than 90 percent of the total detected amiRNA sequences. Therefore, through small RNA sequencing, the artificially modified pre-miRNA gene expressed in the transgenic rice is mainly processed into 20-21 nt-sized amiRNA, the length of the amiRNA is similar to the length of 21nt of the natural osm-MIR528, and 27nt amiRNA consistent with the length of the natural csu-novel-260 is not detected. Therefore, it is assumed that the insect resistance of the transgenic rice is mainly derived from the amiRNA with the size of 20-21 nt.

Example 4

To examine whether the amiRNAs with the size of 20-21 nt found in the transgenic rice in example 3 have the anti-insect activity, the corresponding miRNA analogs, namely, agomir, were synthesized in vitro by Ruibo corporation (Guangzhou, China) and named as agomir-20 (corresponding to the small RNA sequence of 20nt in example 3) and agomir-21 (corresponding to the small RNA sequence of 21nt in example 3), respectively. Agomir is a miRNA agonist which is specially chemically modified, and can simulate endogenous miRNA to regulate the expression of mRNA to play a role. The Agomir has a complete complementary double-stranded structure, ribose of the Agomir has 2'-O methylation modification, and phosphorothioate and cholesterol modification are added at the 3' end of the Agomir, so that the Agomir has higher chemical stability and miRNA activity. Meanwhile, an agomir control agomir-NC without influence on chilo suppressalis larvae is synthesized in vitro, and the nucleotide sequence of the agomir control agomir-NC is UGGAAGGGGCAUGCAGAGGAG (SEQI ID NO. 13).

Example 5

1. The agomir-20, the agomir-21 and the agomir-NC prepared in the example 4 are respectively fed to chilo suppressalis larvae in vitro, and the specific method is as follows:

1) preparing rice sprouts

Preparing a rooting culture medium, sterilizing, and subpackaging into sterile dishes on a super clean bench. The rice seeds are arranged on the surface of a culture medium in a shelling and disinfecting manner, and germinate for 5 days until small sprouts of 1-2 cm grow for later use.

The rooting medium comprises the following components:

2) inoculation of insects

Two pieces of filter paper were placed on the bottom of the insect-fed glass tube and slightly wetted with three groups of agomir solutions, respectively. 4 rice shoots sprouting for 5 days were placed in each tube and soaked in 100nM solution of agomir for 20min, and 9 replicates of each agomir set. Each pipe is connected with 15-head chilo suppressalis larvae, the larvae are sealed by black cloth and placed in a plant growth box (the temperature is 28 ℃, the humidity is 75 percent, and the illumination/darkness is 16h/8h) for feeding. During the feeding period, 100. mu.l of the agomir solution was added to each glass tube every 8 hours, and the rice shoots were replaced every 3 days. Feeding is continued for 5 days, and 3 tubes are taken as three replicates on each of day 2, day 3 and day 5, respectively.

In vitro agrir feeding test results showed that the average mortality of the chilo suppressalis larvae fed with agrir-20 at 2d, 3d and 5d was 8.89 + -3.85%, 22.22 + -7.70% and 44.44 + -10.18%, respectively, the average mortality of the agrir-21 group was 6.67 + -6.67%, 20.00 + -6.67% and 31.11 + -13.88%, respectively, while the average mortality of the control group agrir-NC was 0%, 2.22 + -3.85% and 4.45 + -3.85%, respectively (FIG. 3 a). The death rate of chilo suppressalis larvae in the two experimental groups of Agomir-20 and Agomir-21 is remarkably higher than that in the Agomir-NC group.

The average weight of the chilo suppressalis larvae eating the agromir-20 at 2d, 3d and 5d is 0.12 +/-0.02 mg, 0.17 +/-0.05 mg and 0.46 +/-0.12 mg respectively, the average weight of the experimental group agromir-21 at 0.16 +/-0.02 mg, 0.20 +/-0.06 mg and 0.60 +/-0.07 mg respectively, and the average weight of the chilo suppressalis larvae at 2d, 3d and 5d of the control group agromir-NC at 0.30 +/-0.00 mg, 0.42 +/-0.05 mg and 0.84 +/-0.04 mg respectively (figure 3 b). The average pest weight of the chilo suppressalis larvae of the two experimental groups of Agomir-20 and Agomir-21 is remarkably lower than that of the Agomir-NC group.

The results prove that the 5' sequence of the chilo suppressalis miRNA Csu-novel-260 with the truncated 20nt and 21nt still has remarkable anti-insect activity, and the anti-insect activity of the 20nt sequence is better than that of the 21nt sequence.

Example 6

csu260 transgenic rice field insect resistance identification

In order to further verify the field resistance of the csu260 rice, the transgenic representative families csu260-16 and csu260-18 and the stock control ZH11 are subjected to field chilo suppressalis resistance identification.

1. Tillering stage insect resistance identification

Firstly, the insect-resistant effect of csu260-16 and csu260-18 at the tillering stage is identified, and the identification method comprises the following steps:

1) field planting of rice material

By using a completely random block design (randomizedblock design), 3 repeated cells are planted in each material, 3 multiplied by 3 rice plants are planted in each cell, and the distance between the plants is 20cm multiplied by 20 cm. During the test, all the rice materials were sprayed with no insecticide, and the entire test area was covered with a net with a mesh density of 80 mesh to avoid interference from other pests.

2) Preparation of Chilo suppressalis larvae

Placing the chilo suppressalis egg blocks in an insect rearing room with the temperature of 28 ℃ and the humidity suitable for the chilo suppressalis egg blocks, hatching with the zizania latifolia, and feeding the larvae to the second instar, wherein the zizania latifolia is replaced every 2 days.

3) Insects in field

After the rice material in the field grows to the tillering stage, counting 30 second instar larvae into 4ml centrifuge tubes (which are pricked by needles and are ventilated), and filling the centrifuge tubes with self-sealing bags, wherein the tube openings of the centrifuge tubes face to the sealing strips. Cut the mouth about 5cm near the bottom position in the middle of valve bag one side, stretch into the blade of rice stem from the seal opening to the cut mouth department, sealed the sealing strip (because accompany the blade seal department can leave the gap about 1 cm), see through the sealing bag and open the centrifuging tube cap, let the worm climb out by oneself. And after 2h, removing the sealing bag and the centrifuge tube after all chilo suppressalis larvae climb into the rice plants.

4) Statistics of results

Inoculating 35d of insects, then counting the total tillering number and the withered heart number of the rice in each cell, and calculating the withered heart rate according to the formula I;

the withered heart rate (%) ═ number of dead heart/number of total tillers × 100% formula I.

The results of field experiments show that the average withering rate of csu260-16, csu260-18 and ZH11 rice is 23.24 + -1.51%, 31.08 + -3.25% and 62.63 + -3.70% under the condition of artificially inoculating 30 second-instar chilo suppressalis per single plant (figure 4 a). The experimental result shows that the csu260-16 and csu260-18 transgenic rice shows obvious insect-resistant effect under the condition of artificial inoculation in a field environment.

2. Identification of pest resistance in heading stage

And (3) identifying the insect-resistant effect of the csu260-16 and the csu260-18 in the heading stage by the following identification method:

1) planting of rice material

By using a completely random block design, 3 repeated cells are planted in each material, 4 multiplied by 8 rice plants are planted in each cell, the plant spacing is 20cm multiplied by 20cm, and the whole experimental area is covered by a mesh enclosure with the mesh density of 80 meshes so as to avoid the interference of other insect pests. No insecticide was sprayed on all rice material during the test.

2) Preparation of Chilo suppressalis adults

The field lamp lures chilo suppressalis moths and is captured by a test tube.

3) Insects in field

When the rice material grows to the heading, 400 Chilo suppressalis moths are connected into the net cover of the whole experimental area (unselective).

4) Statistics of results

Inoculating insects for 40d, then counting the total spike number and the white spike number of the rice in each cell, and calculating the white spike rate according to a formula II;

the white spike ratio (%) — the number of white spikes/total spike number × 100% formula II.

The field test result shows that the average white ear rate of the csu260-16 and csu260-18 transgenic rice after being inoculated with the insects for 40d is 21.41 +/-10.89% and 37.86 +/-10.98%, and the white ear rate of the two transgenic families is obviously lower than 82.30 +/-16.16% of that of the control ZH11 (figure 4 b). The insect pest suffered by the transgenic csu260 rice is obviously lower than that of a control ZH11 (figure 4c), and the experimental result further proves that the transgenic csu260-16 and csu260-18 rice has reliable and good insect-resistant effect in the field environment.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> truncated miRNA for blocking ecdysone synthesis pathway of chilo suppressalis in rice and application thereof

<160>13

<170>SIPOSequenceListing 1.0

<210>1

<211>27

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

uuuuggauga cuggcccaug ucggcgu 27

<210>2

<211>20

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

uuuuggauga cuggcccaug 20

<210>3

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

uuuuggauga cuggcccaug u 21

<210>4

<211>257

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gctgctgatg ctgatgccat ggacgattaa acccataata taaactctgc aaacttccac 60

agaacagcct agcagcagga attttggatg actggccctt gtgggcgtag agaggcaaaa 120

gtgaagtcca gcttcaaact gaatctcctg acgccgacat gggccagtca tccaaaactg 180

ctgctgctac agccaaaaaa ccagacctaa cataacacct acctatccca aaccaaattt 240

tgctgtggct gctgctg 257

<210>5

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

agttttggat gactggccca tgtcggcgtc aggagattca gtttga 46

<210>6

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tgacgccgac atgggccagt catccaaaac tgctgctgct acagcc 46

<210>7

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ctacgcccac aagggccagt catccaaaat tcctgctgct aggctg 46

<210>8

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aattttggat gactggccct tgtgggcgta gagaggcaaa agtgaa 46

<210>9

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ctgcaaggcg attaagttgg gtaac 25

<210>10

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gcggataaca atttcacaca ggaaacag 28

<210>11

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

agaatctcgt gctttcagct tcga 24

<210>12

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

tcaagaccaa tgcggagcat atac 24

<210>13

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

uggaaggggc augcagagga g 21

Claims (9)

1. A truncated miRNA for blocking the ecdysone synthesis pathway of Chilo suppressalis in rice is characterized in that,

deleting a nucleotide sequence of 6-7 nt at the 3' end on the basis of the csu-novel-miR260 to form miRNA;

the nucleotide sequence of the csu-novel-miR260 is shown in SEQ ID No. 1.

2. The truncated miRNA according to claim 1, comprising 20nt of the truncated miRNA and/or 21nt of the truncated miRNA;

the nucleotide sequence of the 20nt truncated miRNA is shown in SEQ ID No. 2;

the nucleotide sequence of the 21nt truncated miRNA is shown in SEQ ID No. 3.

3. The use of the truncated miRNA of claim 1 or 2 in rice chilo suppressalis resistance or in the construction of transgenic rice.

4. The application of claim 3, wherein the method for resisting chilo suppressalis is to express a truncated miRNA in rice, the expression of Dib gene in the ecdysone synthesis pathway of chilo suppressalis eating the rice is inhibited, and the purpose of chilo suppressalis disinsection is achieved by inhibiting the synthesis of ecdysone.

5. An miRNA agonist for blocking the ecdysone synthesis pathway of Chilo suppressalis in rice, wherein the miRNA of the miRNA agonist is the truncated miRNA of claim 1 or 2.

6. The miRNA agonist of claim 5, wherein each ribose of the miRNA agonist has a 2'-O methylation modification, and wherein the miRNA agonist has a phosphorothioate and a cholesterol modification at the 3' end of the miRNA agonist.

7. The miRNA agonist of claim 5 or 6 for use in rice chilo suppressalis resistance.

8. The use of the miRNA agonists of claims 5 or 6 in the preparation of striped rice borer biopesticides.

9. A Chilo suppressalis biopesticide, characterized in that a pharmaceutically active ingredient comprises the miRNA agonist of claim 5 or 6.

Images