CN111676144A - Fusarium fungus, cultivation method and application thereof, and cultivation method of achyranthes bidentata - Google Patents
Fusarium fungus, cultivation method and application thereof, and cultivation method of achyranthes bidentata Download PDFInfo
- Publication number
- CN111676144A CN111676144A CN202010655267.XA CN202010655267A CN111676144A CN 111676144 A CN111676144 A CN 111676144A CN 202010655267 A CN202010655267 A CN 202010655267A CN 111676144 A CN111676144 A CN 111676144A
- Authority
- CN
- China
- Prior art keywords
- fusarium
- achyranthes bidentata
- fungus
- cultivation
- achyranthes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/77—Fusarium
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G22/00—Cultivation of specific crops or plants not otherwise provided for
- A01G22/25—Root crops, e.g. potatoes, yams, beet or wasabi
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Environmental Sciences (AREA)
- Biodiversity & Conservation Biology (AREA)
- Ecology (AREA)
- Forests & Forestry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention provides Fusarium fungus, which is classified and named as Fusarium sp, has a strain name of C53(Fusarium sp), is preserved in China general microbiological culture collection center (CGMCC) in 1-13 days in 2020, and has a preservation number of CGMCC No. 19364. The invention also provides application of the fusarium fungus in achyranthes cultivation. The cultivation method of achyranthes bidentata comprises the following steps: taking achyranthes bidentata seedlings 25-30 days after sowing, respectively applying 2.0-3.5g of fungus material cultivated by the cultivation method of fusarium fungus for improving achyranthes bidentata yield and polysaccharide content to the root of each achyranthes bidentata seedling, covering with soil, and planting in a greenhouse or a field for 3-5 months to harvest. After 3-5 months of symbiotic cultivation with achyranthes bidentata seedlings, compared with the achyranthes bidentata which is not inoculated under the same cultivation conditions, the yield of achyranthes bidentata medicinal materials and the content of polysaccharide components can be improved.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to fusarium fungi, a cultivation method and application thereof, and a cultivation method of achyranthes bidentata.
Background
Achyranthes bidentata (Achyranththesbident Blume.) is a deep-root herbaceous plant of Achyranthes of Amaranthaceae (Achyranthes), grows in a hillside forest with an altitude of 200 and 1750 meters, is mainly produced in Wu \38495inthe scorched area of Henan province, Qinyang, Mengzhou, Boei, Xiu and Wen county (the district of ancient Huai Ming Fu), and has a root which is one of famous local medicinal materials 'four great Huai' in China and is famous because the stem is in a section and similar to Achyranthes bidentata in shape. Achyranthes bidentata has a long history of use, and the earliest pharmaceutical works in China, Shen nong's herbal Jing, ranks achyranthes bidentata as the top grade, so that people can lose weight and prolong life after taking the achyranthes bidentata for a long time. The Chinese pharmacopoeia records that the characters are bitter, sweet, sour and neutral; the functions of 'removing blood stasis and stimulating the menstrual flow, nourishing liver and kidney, strengthening bones and muscles, inducing diuresis and treating stranguria, and leading blood to descend'; can be used for treating amenorrhea, dysmenorrhea, soreness of waist and knees, weakness of tendons and bones, stranguria, edema, headache, and vertigo. Radix Achyranthis bidentatae contains various components such as sterone, saponin, polysaccharide, flavone, alkaloid, etc., wherein the polysaccharide has the effects of resisting aging, resisting tumor, improving immunity, etc.
The yield of achyranthes bidentata and the content of polysaccharide components in achyranthes bidentata are important value indexes for measuring achyranthes bidentata, but the yield of achyranthes bidentata and the content of polysaccharide components in achyranthes bidentata are low by adopting the prior art.
Disclosure of Invention
The invention aims to provide fusarium fungi, a cultivation method and application thereof, and a cultivation method of achyranthes bidentata.
The technical scheme adopted by the invention is as follows:
on one hand, the disclosure provides Fusarium fungus, which is classified and named as Fusarium sp, has a strain name of C53(Fusarium sp), is stored in China general microbiological culture collection center of China general microbiological culture collection and management committee in 1 month and 13 days in 2020, has an address of No. 3 Siro No.1 of Beijing, Chaoyang district, and has a collection number of CGMCC No. 19364; .
A cultivation method of the fusarium fungus is characterized in that the fusarium fungus is added into a solid culture medium for cultivation; the components of the solid culture medium comprise 1 part of wheat bran, 4 parts of buckwheat hull and 0.05-0.1 part of corn flour by volume part, and the solution A is added and stirred uniformly until water can seep out by holding with hands, so as to obtain the fungus material; the preparation method of the solution A comprises the following steps: adding water into 10 parts by mass of sucrose and 10 parts by mass of gypsum to a constant volume of 1 part by volume to obtain a solution A, wherein 1 part by mass to 1 part by volume is 1g to 1L.
The invention also provides application of the fusarium fungus in achyranthes cultivation.
On the other hand, the invention also provides a cultivation method of achyranthes bidentata, which comprises the following steps: taking Achyranthis radix seedling 25-30 days after sowing, applying 2.0-3.5g of fungus material cultured by the above Fusarium fungus culture method to the root of each Achyranthis radix seedling, covering with soil, and planting in greenhouse or field for 3-5 months.
The invention has the beneficial effects that:
the strain C53 of fusarium fungus is a wild achyranthes bidentata endophytic fungus, and can improve the yield of achyranthes bidentata medicinal materials and the content of polysaccharide components compared with the achyranthes bidentata which is not inoculated with bacteria under the same cultivation conditions after 3-5 months of symbiotic cultivation with seedlings of achyranthes bidentata.
Detailed Description
The present invention is further illustrated below with reference to specific examples.
The first embodiment is as follows:
the embodiment provides Fusarium fungus, which is classified and named Fusarium sp, has a strain name of C53, is preserved in China general microbiological culture collection center (CGMCC) at 1 month and 13 months in 2020, and has a preservation number of CGMCC No. 19364.
The separation method of the strain C53 is as follows:
adopting a tissue mass separation method: randomly selecting 80 tissue blocks from the root of wild Huai cattle knee collected from Qinyang in Henan, washing the tissue blocks clean under running water, respectively cutting the tissue blocks into tissue blocks with the size of 0.5cm after drying, respectively washing the tissue blocks by soaking the tissue blocks into 75% ethanol for 30-60 s under aseptic condition, then soaking the tissue blocks into 3% hypochlorous acid solution for 8-12 min, washing the tissue blocks by using the aseptic water for 4 times, and then sucking the water by using aseptic filter paper. The surface sterilized samples were then cut into tissue pieces 0.2cm x 0.2cm in size under sterile conditions for isolation of wild achyranthes bidentata endophytic fungi. Tissue blocks were placed on PDA medium and menglar red medium, and 4 tissue blocks were inoculated per plate. Culturing the sample at a constant temperature of 25 ℃ for two months, regularly observing the colony formation condition of endophytic fungi, when the diameter of a filamentous fungi colony is about 1cm, selecting the edge part of the colony, inoculating the colony to a new PDA plate, and repeatedly inoculating to form a single colony; according to the colony characteristics of the strains, merging the strains to obtain fungal strains with different colony characteristics, numbering, counting and describing the fungal strains, and identifying the fungal strains by using morphological and molecular biological methods. The bacterial strain is preserved in a PDA test tube inclined plane and properly preserved in a 10% glycerol tube; wherein the PDA test tube is stored in a refrigerator at 4 deg.C, and 10% glycerol tube is stored in an ultra-low temperature refrigerator at-80 deg.C.
Wherein, the separation culture medium is as follows:
potato medium (PDA) formula (1L): 200g of peeled potatoes, 20g of glucose, 12g of agar and 1000mL of deionized water with natural pH. Sterilizing at 122 deg.C for 22 min.
Bengal culture medium formula (1L): 35g of Bengal red, and the volume of deionized water is up to 1000mL, and the pH is natural. Sterilizing at 122 deg.C for 22 min.
The result of the conserved sequence sequencing of strain C53 (SEQ ID No.1) is as follows:
ttggcctgcggagggatcattaccgagtttacaactcccaaacccctgtgaacataccaattgttgcctcggcggatcagcccgctcccggtaaaacgggacggcccgccagaggacccctaaactctgtttctatatgtaacttctgagtaaaaccataaataaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcaaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgcccgccagtattctggcgggcatgcctgttcgagcgtcatttcaaccctcaagcccagcttggtgttgggactcgcgagtcaaatcgcgttccccaaattgattggcggtcacgtcgagcttccatagcgtagtagtaaaaccctcgttactggtaatcgtcgcggccacgccgttaaaccccaacttctgaatgttgacctcggatcaggtaggaatacccgctgaacttaagcatatcaaaagcccggaggaaaa
example two:
a method for culturing fusarium fungus comprises adding the fusarium fungus of the embodiment I to a solid culture medium for culturing; the components of the solid culture medium comprise 1 part of wheat bran, 4 parts of buckwheat hull and 0.05-0.1 part of corn flour by volume part, and the solution A is added and stirred uniformly until water can seep out by holding with hands, so as to obtain the fungus material; the preparation method of the solution A comprises the following steps: adding 10 parts by mass of sucrose and 10 parts by mass of raw stoneAdding water into the paste to a constant volume of 1 part by volume to obtain a solution A, wherein 1 part by mass is 1 part by volume to 1 part by volume is 1g to 1L. As one of the specific modes, the components of the culture medium of the solid culture are calculated by the volume: wheat bran-buckwheat husk culture medium: wheat bran: the buckwheat husk is 1: 4 (V: V), fine corn flour is added in 0.05V-0.1V, the solution A is used for stirring evenly, and the most suitable water can just seep out when holding by hand. Solution a formulation (1L): sucrose 10g, Gypsum Fibrosum (CaSO)4·2H2O)10g, adding water to a constant volume of 1L. Weighing the above materials, stirring, packaging, sterilizing at 122 deg.C for 180min, and cooling. A C53(Fusarium sp.) fungal plate cultured on PDA medium was taken out with a 0.8cm diameter punch, placed in the middle of the solid medium, and cultured in the dark at 25 ℃ until the C53(Fusarium sp.) fungal grows to 2/3 of the medium in the flask for use.
Example three:
the invention also provides an embodiment of application of the fusarium fungus in achyranthes cultivation.
Example four:
the invention also provides a cultivation method of achyranthes bidentata, which comprises the following steps: taking achyranthes bidentata seedlings 25-30 days after sowing, respectively applying 2.0-3.5g of bacterial material cultivated by the cultivation method of the fusarium fungus in the embodiment to the roots of each achyranthes bidentata seedling, covering the seedlings with soil, and planting the seedlings in a greenhouse or a field for 3-5 months and then harvesting. The method comprises the following specific steps:
(1) solid culture of C5(Fusarium sp.)3 fungus: the components of the culture medium for solid culture are as follows by volume: wheat bran-buckwheat husk culture medium: wheat bran: the buckwheat husk is 1: 4 (V: V), fine corn flour is added in 0.05V-0.1V, the solution A is used for stirring evenly, and the most suitable water can just seep out when holding by hand. Solution a formulation (1L): sucrose 10g, Gypsum Fibrosum (CaSO)4·2H2O)10g, adding water to a constant volume of 1L. Weighing the above materials, stirring, packaging, sterilizing at 122 deg.C for 180min, and cooling. A C53(Fusarium sp.) fungal plate cultured on PDA medium was taken out with a 0.8cm diameter punch, placed in the middle of the solid medium, and cultured in the dark at 25 ℃ until the C53(Fusarium sp.) fungal grows to 2/3 of the medium in the flask for use.
(2) And (3) symbiotic cultivation of the bacterins: sowing seeds of achyranthes bidentata in 6 months, taking achyranthes bidentata seedlings 25-30 days after germination, respectively applying 2.5-3.0g of C53(Fusarium sp) fungus material cultured in a solid state to the roots of each achyranthes bidentata seedling, covering with soil, planting in a greenhouse or a field, and performing planting management by a conventional method.
(3) After 3-4 months of symbiotic cultivation of the strain C53(Fusarium sp) and the achyranthes bidentata seedlings, the dry weight and polysaccharide content of the achyranthes bidentata are improved to different degrees compared with those of the achyranthes bidentata which are not inoculated under the same cultivation conditions.
The disclosure is further illustrated below with specific tests:
test one:
the cultivation method of achyranthes bidentata comprises the following steps:
solid culture of C53(Fusarium sp.) fungus: wheat bran-buckwheat husk culture medium: wheat bran: adding fine corn flour 0.05V into buckwheat husk at ratio of 1: 4 (V: V), stirring with solution A, and holding with hand to allow water to seep out. Solution a formulation (1L): sucrose 10g, Gypsum Fibrosum (CaSO)4·2H2O)10g, adding water to a constant volume of 1L. Weighing the above materials, stirring, packaging, sterilizing at 122 deg.C for 180min, and cooling. A C53(Fusarium sp.) fungal plate cultured on PDA medium was taken out with a 0.8cm diameter punch, placed in the middle of the solid medium, and cultured in the dark at 25 deg.C until the C53 fungus grows to 2/3 of the medium in the bottle.
And (3) symbiotic cultivation of the bacterins: sowing achyranthes bidentata seeds in 6 months by using a greenhouse potting method, and taking achyranthes bidentata seedlings 25-30 days after germination; achyranthes bidentata seedlings are divided into two groups, one group is respectively applied with 2.5g of C53(Fusarium sp.) bacterial material subjected to solid culture at the root of each achyranthes bidentata seedling, the other group is respectively applied with C53(Fusarium sp.) bacterial material not subjected to solid culture, 1 plant is applied to each pot, 6 pots are arranged for each group, the operation is repeated for 6 times, the seedlings are planted in a greenhouse after being covered by soil, the cultivation management is carried out by a conventional method, and the seedlings are harvested after 3 months.
The dry weight was weighed and the polysaccharide content was determined. Achyranthes bidentata cultivated symbiotically with C53(Fusarium sp.) fungus, the average dry weight of each root was 12.6g, and the average polysaccharide content in the root was 11.00%. The average dry weight of each root of the non-inoculated achyranthes bidentata is 8.2g, and the average polysaccharide content of the roots is 8.60%.
And (2) test II:
the cultivation method of achyranthes bidentata comprises the following steps:
c53(Fusarium sp.) solid culture of fungus, testa Tritici-testa Fagopyri Esculenti culture medium, testa Tritici: testa Fagopyri Esculenti at ratio of 1: 4 (V: V), adding fine corn flour 0.75V, stirring with solution A, and holding with hand to allow water to permeate out. Solution a formulation (1L): sucrose 10g, Gypsum Fibrosum (CaSO)4·2H2O)10g, adding water to a constant volume of 1L. Weighing the above materials, stirring, packaging, sterilizing at 122 deg.C for 180min, and cooling. A C53(Fusarium sp.) fungal plate cultured on PDA medium was taken out with a 0.8cm diameter punch, placed in the middle of the solid medium, and cultured in the dark at 25 ℃ until the C53(Fusarium sp.) fungal grows to 2/3 of the medium in the flask for use.
And (3) symbiotic cultivation of the bacterins: the method comprises the steps of planting achyranthes bidentata seeds in a greenhouse in 6 months, taking achyranthes bidentata seedlings 25-30 days after germination, dividing the achyranthes bidentata seedlings into two groups, applying C53(Fusarium sp.) fungus material for solid culture to the roots of the achyranthes bidentata seedlings in one group for 2.75g, applying no C53(Fusarium sp.) fungus material in the other group for 1 plant in each pot, setting 6 pots in each group, repeating the steps for 6 times, covering the pots with soil, planting the pots in the greenhouse, performing cultivation management by a conventional method, and harvesting the achyranthes bidentata seedlings after 4 months.
The dry weight was weighed and the polysaccharide content was determined. Achyranthes bidentata cultivated symbiotically with C53(Fusarium sp.) fungus, the average dry weight of each root was 15.2g, and the average polysaccharide content in the root was 13.00%. The average dry weight of each root of the non-inoculated achyranthes bidentata is 10.0g, and the average polysaccharide content of the roots is 9.00%.
And (3) test III:
the cultivation method of achyranthes bidentata comprises the following steps:
c53(Fusarium sp.) solid culture of fungus, testa Tritici-testa Fagopyri Esculenti culture medium, testa Tritici: testa Fagopyri Esculenti at ratio of 1: 4 (V: V), adding fine corn flour 0.1V, stirring with solution A, and holding with hand to allow water to permeate out. Solution a formulation (1L): sucrose 10g, Gypsum Fibrosum (CaSO)4·2H2O)10g, adding water to a constant volume of 1L. Weighing the above materials, stirring, packaging, sterilizing at 122 deg.C for 180min, and cooling. Perforating with a diameter of 0.8cmThe device takes a C53(Fusarium sp.) fungus slice cultured on PDA culture medium, and places the fungus slice in the middle of the solid culture medium, and the fungus is cultured in dark at 25 ℃ until the C53(Fusarium sp.) fungus grows to 2/3 of the culture medium in a bottle for use.
And (3) symbiotic cultivation of the bacterins: the method comprises the steps of planting achyranthes bidentata seeds in a greenhouse in 6 months, taking achyranthes bidentata seedlings 25-30 days after germination, dividing the achyranthes bidentata seedlings into two groups, applying C53(Fusarium sp.) fungus material for solid culture to the roots of the achyranthes bidentata seedlings in one group for 3.0g, applying no C53(Fusarium sp.) fungus material in the other group for 1 plant in each pot, setting 6 pots in each group, repeating the steps for 6 times, covering the pots with soil, planting the pots in the greenhouse, performing cultivation management by a conventional method, and harvesting the achyranthes bidentata seedlings after 5 months.
The dry weight was weighed and the polysaccharide content was determined. Achyranthes bidentata cultivated symbiotically with C53(Fusarium sp.) fungus, the average dry weight of each root was 16.8g, and the average polysaccharide content in the root was 15.00%. The average dry weight of each root of the non-inoculated achyranthes bidentata is 11.0g, and the average polysaccharide content of the roots is 10.00%.
In conclusion, after the cultivation for 3-5 months with the seedlings of the achyranthes bidentata, the yield of the achyranthes bidentata medicine and the content of polysaccharide components can be obviously improved compared with the achyranthes bidentata which is not inoculated with bacteria under the same cultivation condition.
The present invention is not limited to the above-described alternative embodiments, and various other forms of products can be obtained by anyone in light of the present invention. The above detailed description should not be taken as limiting the scope of the invention, which is defined in the claims, and which the description is intended to be interpreted accordingly.
Sequence listing
<110> school of schchang
<120> fusarium fungus, cultivation method, application and cultivation method of achyranthes bidentata
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>542
<212>DNA
<213> Fusarium sp (Fusarium sp.)
<400>1
ttggcctgcg gagggatcat taccgagttt acaactccca aacccctgtg aacataccaa 60
ttgttgcctc ggcggatcag cccgctcccg gtaaaacggg acggcccgcc agaggacccc 120
taaactctgt ttctatatgt aacttctgag taaaaccata aataaatcaa aactttcaac 180
aacggatctc ttggttctgg catcgatgaa gaacgcagca aaatgcgata agtaatgtga 240
attgcagaat tcagtgaatc atcgaatctt tgaacgcaca ttgcgcccgc cagtattctg 300
gcgggcatgc ctgttcgagc gtcatttcaa ccctcaagcc cagcttggtg ttgggactcg 360
cgagtcaaat cgcgttcccc aaattgattg gcggtcacgt cgagcttcca tagcgtagta 420
gtaaaaccct cgttactggt aatcgtcgcg gccacgccgt taaaccccaa cttctgaatg 480
ttgacctcgg atcaggtagg aatacccgct gaacttaagc atatcaaaag cccggaggaa 540
aa 542
Claims (4)
1. A fusarium fungus characterized by: the strain is classified and named as Fusarium sp, has the strain name of C53(Fusarium sp), is preserved in China general microbiological culture collection center (CGMCC) in 1 month and 13 months in 2020, and has the preservation number of CGMCC No. 19364.
2. A method of cultivating the fungus of the genus Fusarium of claim 1, wherein the fungus of the genus Fusarium is cultured by adding it to a solid medium; the components of the solid culture medium comprise 1 part of wheat bran, 4 parts of buckwheat hull and 0.05-0.1 part of corn flour by volume part, and the solution A is added and stirred uniformly until water can seep out by holding with hands, so as to obtain the fungus material; the preparation method of the solution A comprises the following steps: adding water into 10 parts by mass of sucrose and 10 parts by mass of gypsum to a constant volume of 1 part by volume to obtain a solution A, wherein 1 part by mass to 1 part by volume is 1g to 1L.
3. Use of the fusarium fungus of claim 1 in achyranthes bidentata cultivation.
4. A cultivation method of achyranthes bidentata is characterized by comprising the following steps: taking achyranthes bidentata seedlings 25-30 days after sowing, respectively applying 2.0-3.5g of fungus material cultivated by the cultivation method containing the fusarium fungus in claim 2 to the roots of each achyranthes bidentata seedling, covering with soil, and planting in a greenhouse or a field for 3-5 months and then harvesting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010655267.XA CN111676144B (en) | 2020-07-09 | 2020-07-09 | Fusarium fungus, cultivation method and application thereof, and cultivation method of achyranthes bidentata |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010655267.XA CN111676144B (en) | 2020-07-09 | 2020-07-09 | Fusarium fungus, cultivation method and application thereof, and cultivation method of achyranthes bidentata |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111676144A true CN111676144A (en) | 2020-09-18 |
| CN111676144B CN111676144B (en) | 2022-11-25 |
Family
ID=72438588
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010655267.XA Active CN111676144B (en) | 2020-07-09 | 2020-07-09 | Fusarium fungus, cultivation method and application thereof, and cultivation method of achyranthes bidentata |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111676144B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003903909A0 (en) * | 2003-07-25 | 2003-08-07 | Albright & Wilson (Australia) Limited | Production methods |
| KR101293107B1 (en) * | 2012-11-01 | 2013-08-12 | 성찬기 | A composite for a prevention and a removal of disease of plants and a soil conditioning, and manufacturing method of the same |
| CN104163730A (en) * | 2014-09-03 | 2014-11-26 | 镇江瑞繁农艺有限公司 | Nutrition fertilizer for ornamental small sunflower and preparation method thereof |
| WO2015100431A2 (en) * | 2013-12-24 | 2015-07-02 | Symbiota, Inc. | Plants containing beneficial endophytes |
| CN105638761A (en) * | 2014-11-14 | 2016-06-08 | 天津市天绿海蔬菜种植专业合作社 | Cowpea root rot control medicament and preparation method |
-
2020
- 2020-07-09 CN CN202010655267.XA patent/CN111676144B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003903909A0 (en) * | 2003-07-25 | 2003-08-07 | Albright & Wilson (Australia) Limited | Production methods |
| KR101293107B1 (en) * | 2012-11-01 | 2013-08-12 | 성찬기 | A composite for a prevention and a removal of disease of plants and a soil conditioning, and manufacturing method of the same |
| WO2015100431A2 (en) * | 2013-12-24 | 2015-07-02 | Symbiota, Inc. | Plants containing beneficial endophytes |
| CN104163730A (en) * | 2014-09-03 | 2014-11-26 | 镇江瑞繁农艺有限公司 | Nutrition fertilizer for ornamental small sunflower and preparation method thereof |
| CN105638761A (en) * | 2014-11-14 | 2016-06-08 | 天津市天绿海蔬菜种植专业合作社 | Cowpea root rot control medicament and preparation method |
Non-Patent Citations (2)
| Title |
|---|
| 李萍等: "不同诱导子对怀牛膝细胞生长及多糖含量的影响", 《植物学报》 * |
| 王娟英等: "不同连作年限怀牛膝根际土壤理化性质及微生物多样性", 《生态学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111676144B (en) | 2022-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1994092A (en) | A biological weed killer and preparation process thereof | |
| CN104381009A (en) | Artificial bag cultivation process for Phellinus igniarius | |
| CN111109009B (en) | Armillaria mellea SWFU-09 and application thereof | |
| CN112725191B (en) | Inonotus tumefaciens strain for promoting germination of orchidaceae seeds and application thereof | |
| CN106801014A (en) | A kind of endogenetic fungus and its application for improving red sage root yield and its active constituent content | |
| CN104322273A (en) | Manual bag cultivation process for phellinus igniarius | |
| CN105219655A (en) | Flavus biocontrol strain and the application thereof of aflatoxin do not produced to sterilant resistance | |
| CN101558766B (en) | Trichoderma solid granules for preventing and controlling tobacco soil-borne fungus diseases and preparation method thereof | |
| Dong et al. | Field inoculation and classification of maize ear rot caused by Fusarium verticillioides | |
| CN114766285B (en) | Ganoderma lucidum strain L4495 and cultivation method and application thereof | |
| CN111676144B (en) | Fusarium fungus, cultivation method and application thereof, and cultivation method of achyranthes bidentata | |
| CN114540205B (en) | Armillariella mellea strain and application thereof | |
| CN115927016A (en) | Dahurian rhodophyllum boletus strain and application thereof | |
| CN112931058B (en) | Separation and purification method of Moganshan wild Dictyophora rubrovalvata strain | |
| CN108611279B (en) | Domestication method of sorangium cellulosum, domesticated sorangium cellulosum and application | |
| CN113999788A (en) | Actinomycetes and application thereof | |
| CN112760235A (en) | Application of Acanthus ilicifolius endophytic fungus Diaporthe goulteri and metabolite thereof | |
| CN114456951B (en) | Horizontalium fungus strain for promoting growth of ginseng, and method and application thereof | |
| CN116590154B (en) | Biocontrol bacterium for preventing and controlling plant root rot caused by soil-borne pathogenic bacteria and application thereof | |
| CN101519645A (en) | Preparation method of alternaria alternate spore inoculum | |
| CN107821023B (en) | Method for improving content and yield of total flavonoids in clematis plants by using arbuscular mycorrhizal fungi | |
| Ikechi-Nwogu et al. | Screening of selected plant products as alternatives to agar in mycological studies | |
| CN116716192A (en) | Trichoderma pseudokoningii and application thereof | |
| CN117721026A (en) | Trichoderma aureoviride and application thereof | |
| Arena et al. | Antibacterial Activities of Endophytic Fungi from Capsicum annuum L.(Siling labuyo) leaves and fruits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |