CN111662370B

CN111662370B - Antarctic fish hepcidin antibacterial peptide and preparation method and application thereof

Info

Publication number: CN111662370B
Application number: CN202010631720.3A
Authority: CN
Inventors: 陈良标; 刘明丽; 许强华; 胡瑞芹; 卢玉平; 翟万营
Original assignee: Shanghai Ocean University
Current assignee: Shanghai Ocean University
Priority date: 2020-07-03
Filing date: 2020-07-03
Publication date: 2022-07-26
Anticipated expiration: 2040-07-03
Also published as: CN111662370A

Abstract

The invention discloses an Antarctic fish hepcidin antibacterial peptide, and a preparation method and application thereof, and belongs to the technical field of biological engineering. The hepcidin antibacterial peptide comprises antibacterial peptides Dmhep _8cysV1 and Dmhep _8cysV2 derived from Antarctic fish D.mahsoni, wherein the Dmhep _8cysV1 contains a tag sequence of 6 histidines, a TEV enzyme cutting site sequence of 7 amino acids and an antibacterial peptide sequence of 26 amino acids, and the Dmhep _8cysV2 contains a tag sequence of 6 histidines, a TEV enzyme cutting site sequence of 7 amino acids and an antibacterial peptide sequence of 24 amino acids, can resist gram-negative bacteria and gram-positive bacteria, has the function of inhibiting the growth of the bacteria and remarkable antibacterial effect, can be used as a substitute product of antibiotics in aquaculture, cannot cause damage to a host, and cannot cause the bacteria to generate drug resistance.

Description

Antarctic fish hepcidin antibacterial peptide and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to an antarctic fish hepcidin antibacterial peptide containing two antibacterial peptides Dhep _8cysV1 and Dhep _8cysV2 from antarctic fish D.mawsoni, and a preparation method and application thereof.

Background

At present, 20 antibiotics are frequently used in the aquaculture industry of China, wherein the antibiotics come from 8 categories respectively, and 2/3 of the antibiotics belong to broad-spectrum antibiotics which can resist gram-positive bacteria and gram-negative bacteria. However, only a small portion of these antibiotics is bioabsorbed and the vast majority of the remainder enters the aqueous environment. These antibiotics, which enter the aqueous environment, affect ecosystem balance and aquatic organism immunity, including antibiotic resistance, by inhibiting primary productivity. Especially bacteria resistant to multiple drugs, present a serious public health challenge, while the food safety and human health are threatened by the entry of excess antibiotics into the food chain in aqueous environments. It is urgent to find an antibacterial agent which can replace antibiotic antibacterial function, does not cause drug resistance of bacteria, and has no harm to host.

Various antibacterial peptides naturally exist in organisms, and cannot cause bacteria to generate drug resistance, and if the antibacterial peptides can be proved to generate the same antibacterial effect as antibiotics, the high dependence of aquaculture on the antibiotics can be changed, and the antibacterial peptides become the first choice for replacing the antibiotics. Hepcidin is a micromolecular cationic antibacterial peptide containing rich cysteine, and plays an important role in the process of responding to pathogenic stimulation of a host immune system. It was found that the mature hepcidin in higher vertebrates consists of 20-25 amino acids, and contains 8 highly conserved cysteine residues in the molecule that are paired with each other to form four pairs of disulfide bonds forming a stable hairpin structure. Many in vivo experiments indirectly show that the hepcidin has an antibacterial effect, for example, within a few hours after the bacteria are injected into the abdominal cavity of a mouse, the expression of the hepcidin in the liver of the mouse is obviously increased, which indicates that the hepcidin is possibly related to the antibacterial occurrence; after the jewfish is infected with the streptococcus iniae, the hepcidin in the liver is increased by 4500 times, but the expression level of the hepcidin in other tissues is not induced by pathogenic bacteria; the researchers also examine the serum of zebra fish stimulated by Aeromonas hydrophila to find that the expression level of hepcidin polypeptide is increased, and the serum is used for carrying out bacteriostasis zone experiments to find that the zebra fish can kill Escherichia coli and Aeromonas hydrophila. In addition, there is direct evidence that hepcidins have antibacterial effects, and human hep20 and hep25 exhibit antibacterial activity at in vitro concentrations of up to 30 μ M; after the mature polypeptide of the zebra fish hepcidin is expressed and purified, the zebra fish hepcidin is incubated with various bacteria, and the fact that the zebra fish hepcidin has an inhibition effect on the growth of various pathogenic bacteria is found, and the fact that the hepcidin has antibacterial activity in vivo and in vitro of animals is proved.

With the continuous research on Antarctic fish resources, it is found that the Antarctic fish contains hepcidin genes with sequence diversity. 2 different 8cys hepcidin sequences, Dhep-8 cysV1 and Dhep-8 cysV2, were identified in D.mahsonia at two different sites in the D.mahsonia genome, respectively, where Dhep-8 cysV1 was located at a very old and conserved site in the genome, which was found in almost all fish species, but Dhep-8 cysV2 was located at a newly evolved site, and belongs to a novel hepcidin gene. Because the mature polypeptide sequences of Dphep-8 cysV1 and Dphep-8 cysV2 have great differences, whether the sequences have an influence on the antibacterial function is not reported.

Disclosure of Invention

In order to solve the problems that the natural antibacterial peptide is low in content and difficult to extract, the requirement of market application cannot be met, the secondary structure of the chemically synthesized antibacterial peptide is different from that of the natural antibacterial peptide, the complete activity of the chemically synthesized antibacterial peptide cannot be maintained, and the immature cost of the chemically synthesized antibacterial peptide technology is high, the invention provides an antarctic fish hepcidin antibacterial peptide, which comprises two antibacterial peptides Dhep _8cysV1 and Dhep _8cysV2 from antarctic fish D.mahsonia;

the antimicrobial peptide Dmhep _8cysV1 has any one of the following amino acid sequences:

(a) 1, or an amino acid sequence as shown in SEQ ID NO, or

(b) An amino acid sequence which hybridizes with the C-terminal sequence of the amino acid sequence shown in SEQ ID NO. 1 under a strict condition;

the amino acid sequence shown in SEQ ID NO. 1 is as follows:

the antimicrobial peptide Dmhep _8cysV2 has any one of the following amino acid sequences:

(c) an amino acid sequence as shown in SEQ ID NO. 2, or

(d) An amino acid sequence that hybridizes under stringent conditions to the C-terminal sequence of the amino acid sequence set forth in SEQ ID NO. 2;

the amino acid sequence shown in SEQ ID NO. 2 is as follows:

wherein, the single underline marks 6 His label sequences, the dashed underline marks target sequences cut by TEV protease, TEV can cut the site sequence, and the double underline marks antibacterial peptide sequences with antibacterial activity.

According to some embodiments of the present invention, the antimicrobial peptides Dmhep _8cysV1 and Dmhep _8cysV2, which have antimicrobial activity, are derived from Antarctic globus tridentatus (Dissothicumawsoni), and have amino acid sequences shown in SEQ ID No. 3 and SEQ ID No. 4, specifically:

the amino acid sequence shown in SEQ ID NO. 3 is as follows:

the amino acid sequence shown in SEQ ID NO. 4 is as follows:

further, the nucleotide sequence of the antibacterial peptide gene with the amino acid sequence shown as SEQ ID NO. 3 is as follows:

CAGAGCCACCTCTCCCTGTGCCGCTGGTGCTGCAACTGCTGCAAGGGCAACAAGGGCTGCGGCTTCTGCTGCAGGTTC (shown as SEQ ID NO: 5);

the nucleotide sequence of the antibacterial peptide gene with the coded amino acid sequence shown as SEQ ID NO. 4 is as follows:

CGCCGTCGCAAGTGTAAATTTTGCTGCAACTGCTGCAGCAACATCTGTCAAACGTGCTGCACAAGGAGATTC (shown in SEQ ID NO: 6).

According to some embodiments of the invention, the stringent conditions refer to hybridization in a solution of 1 × PBS (or 0.1 × TBS) and 2% skim milk at 37 ℃.

According to some embodiments of the invention, the N-terminus of the amino acid sequence of the antimicrobial peptide Dmhep _8cysV1 as shown in SEQ ID NO 1 may be linked

Or

The sequence serves as a tag.

According to some embodiments of the invention, the N-terminus of the amino acid sequence of the antimicrobial peptide Dmhep _8cysV2 as shown in SEQ ID NO 2 may be linked

Or

The sequence serves as a tag.

The invention also provides a preparation method of any one of the antarctic fish hepcidin antibacterial peptides, which comprises the following steps:

(1) obtaining the coding region sequence of Dissotrichus mawsoni liver tissue by an RT-PCR method, and respectively obtaining the antarctic hepcidin antibacterial peptide genes with the nucleotide sequences shown as SEQ ID NO. 5 and SEQ ID NO. 6;

(2) inserting the antibacterial peptide genes of the Antarctic fish hepcidin into prokaryotic expression vectors respectively to form recombinant plasmids;

(3) transferring the recombinant plasmid into a cloning escherichia coli strain to transform a host cell, and performing induction expression on the host cell to obtain an expression product;

(4) the expression products were isolated and purified and named antimicrobial peptide Dmhep _8cysV1 and antimicrobial peptide Dmhep _8cysV2, respectively.

The invention also provides a recombinant expression vector which comprises a Hepcidin antibacterial peptide gene with a nucleotide sequence shown as SEQ ID NO. 5 or SEQ ID NO. 6 and is constructed by the Hepcidin antibacterial peptide gene and plasmids.

The present invention also provides a genetically engineered host cell selected from the group consisting of:

A) host cells and progeny cells thereof transformed or transduced by the Hepcidin antibacterial peptide gene with the nucleotide sequence shown as SEQ ID NO. 5 or SEQ ID NO. 6; or

B) The host cell transformed or transduced by the recombinant expression vector and the progeny cell thereof.

The invention also provides application of the Antarctic fish hepcidin antibacterial peptide in inhibiting bacterial growth.

According to some embodiments of the present invention, the antimicrobial peptide Dmhep _8cysV1 may be used to inhibit the growth of escherichia coli (e.coli), streptococcus (s.streptococcus), aeromonas hydrophila (a.hydrophila), staphylococcus aureus (s.aureus); the antimicrobial peptide Dmhep _8cysV2 can be used for inhibiting the growth of escherichia coli, streptococcus, aeromonas hydrophila, Edwardsiella (E.tarda), and staphylococcus aureus.

In the invention, the antarctic hepcidin antibacterial peptide is derived from a special species of Lepidium canicola (Dissotichus mawsoni), and belongs to the hepcidin antibacterial peptide with 8 cysteine residues commonly existing in the antarctic fish body. The coding region sequence of Dissotrichus mawsoni is obtained from liver tissue by RT-PCR method and inserted into prokaryotic expression vector to form recombinant plasmid, which is transferred into Escherichia coli strain for cloning to obtain prokaryotic expression system capable of expressing Antarctic fish hepcidin antibacterial peptide, and antibacterial peptide Dhep _8cysV1 and antibacterial peptide Dhep _8cysV2 are obtained after separation, purification and identification.

The antimicrobial peptide Dmhep _8cysV1 has obvious growth inhibition effects on escherichia coli (E.coli), streptococcus (S.streptococcus), aeromonas hydrophila (A.hydrophila) and staphylococcus aureus (S.aureus), and the minimum inhibitory concentrations are respectively 25 mu M, 20 mu M, 25 mu M and 25 mu M; the antimicrobial peptide Dmhep _8cysV2 recombinant polypeptide also has obvious growth inhibition effect on escherichia coli, streptococcus, aeromonas hydrophila, Edwardsiella and staphylococcus aureus, the minimum inhibitory concentration is 15 mu M, 10 mu M, 20 mu M, 15 mu M and 15 mu M respectively, and both the antimicrobial peptides have the function of resisting gram-negative bacteria and gram-positive bacteria. Under the same inoculation condition, the time for the Edwardsiella to reach the exponential growth phase is longer, and the Dhep-8 cysV2 recombinant polypeptide has very good bactericidal effect on the Edwardsiella.

The Antarctic fish hepcidin antibacterial peptide can kill 100% of various bacteria within 1 hour at the minimum antibacterial concentration and above at 37 ℃, and shows that the Antarctic fish hepcidin antibacterial peptide has a very strong antibacterial function, and the antibacterial effect has obvious concentration and sterilization strength advantages compared with human antibacterial peptide, and can be used as a substitute product of antibiotics in aquaculture without causing damage to hosts and causing the bacteria to generate drug resistance.

Drawings

FIG. 1 is a schematic diagram of the structure of a pHis-TEV prokaryotic expression vector.

FIG. 2 shows Coomassie blue staining of antimicrobial peptides Dmhep _8cys V1 and Dmhep _8cyV2 after purification of their expression.

FIG. 3 shows the identification of specific western blots for the antimicrobial peptides Dmhep _8cysV1 and Dmhep _8cyV 2.

FIG. 4 is a graph of the growth inhibition of antimicrobial peptide Dmhep _8cyV1 against various bacteria.

FIG. 5 is a graph of the growth inhibition of antimicrobial peptide Dmhep _8cyV2 against various bacteria.

Detailed Description

The present invention is further illustrated by the following examples and comparative examples, which are intended to be illustrative only and are not to be construed as limiting the invention. The technical scheme of the invention is to be modified or replaced equivalently without departing from the scope of the technical scheme of the invention, and the technical scheme of the invention is covered by the protection scope of the invention.

EXAMPLE 1 preparation of antimicrobial peptides Dmhep _8cysV1 and Dmhep _8cyV2

(1) The steps of cloning the cDNA sequence of the antibacterial peptide gene and constructing the vector are as follows:

first Strand Synthesis of cDNA

Extracting total RNA of liver tissues of south China Dissotrichus mawsoni of Lepidotis canicola by using a TRIZOL reagent, and carrying out reverse transcription by using the RNA as a template and a cDNA first strand synthesis kit to obtain first strand cDNA, wherein the specific steps are as follows:

a. each EP tube was added sequentially on ice: oligo dT Primer 1. mu.l, dNTPmix 1. mu.l, total RNA 1. mu.g, supplemented with RNase Free dH ₂ O to the total volume of 10 mu l, slowly mixing uniformly, keeping the temperature at 65 ℃ for 5min to denature template RNA and improve the reverse transcription efficiency, and then taking out the EP tube and placing the EP tube on ice;

b. the above 10. mu.l system EP tube was charged in accordance with: 5XPrimeScript II buffer 4. mu.l, RNase Inhibitor 0.5. mu.l, PrimeScript II RTase 1. mu.l, supplementary RNase Free dH ₂ And (3) slowly and uniformly mixing until the total volume of the cDNA is 20 mu l, keeping the temperature at 42 ℃ for 30min, inactivating the enzyme at 95 ℃ for 5min, and then storing the obtained cDNA in a refrigerator at-20 ℃.

② antibacterial peptide DNA sequence PCR amplification

Selecting proper sequences at two ends of a mature peptide sequence of hepcidin to design primers, respectively adding 15bp at two ends of Nco I and Xho I of a vector pHis-TEV at the 5' end of an upstream primer and a downstream primer, and using the primers as overlapping regions at two ends of two linear fragments when the two linear fragments are connected by an infusion method, wherein the sequences are as follows:

dmhep-8 cysV1_ Nco I _ F1 (shown in SEQ ID NO: 7):

5’-TATTTTCAGGGCGCCCAGAGCCACCTCTCCCTGTG-3’；

dmhep _8cysV1_ XhoI _ R1 (shown in SEQ ID NO: 8):

5’-GTGGTGGTGCTCGAGTCAGAACCTGCAGCAGAAGC-3’；

dmhep-8 cysV2_ Nco I _ F1 (shown in SEQ ID NO: 9):

5’-TATTTTCAGGGCGCCCGCCGTCGCAAGTGTAAATTTTG-3’；

dmhep-8 cysV2_ Xho I _ R1 (shown in SEQ ID NO: 10):

5’-GTGGTGGTGCTCGAGTCAGAATCTCCTTGTGCAGC-3’；

in addition, primers were designed at both ends of Nco I and Xho I sequences of vector pHis-TEV for amplification of vector portion, the sequences being:

pHis-TEV-Xho I-F (shown in SEQ ID NO: 11): 5'-GGCGCCCTGAAAATACAGGTT-3', respectively;

pHis-TEV-Nco I-R (shown in SEQ ID NO: 12): 5'-CTCGAGCACCACCACCACCAC-3', respectively;

the vector skeleton pHis-TEV DNA sequence and the coding sequences of Dphep-8 cyV1 and Dphep-8 cyV2 are obtained by a PCR method, and the reaction system is as follows: primer 0.5ul each (10um), 2 xPHnat mix10ul, cDNA1ul, H ₂ O8 ul; the reaction procedure is as follows: pre-denaturation at 95 deg.C for 5 min; denaturation at 95 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 1-3min, and 34 cycles; 72 ℃ for 10 min; at 12 ℃. The obtained PCR product is subjected to nucleic acid gel electrophoresis, and bands which respectively accord with the expected 5315bp, 78bp and 72bp are subjected to gel cutting and recovery.

Seamless connection of vector and destination fragment

The recovered PCR product was seamlessly ligated using In-Fusion HD cloning Kit, the reaction system was: insert 50ng, vector backbone pHis-TEV100ng, 5 XIn-Fusion HD Enzyme Premix 2. mu.l, supplemented with H ₂ O to a total volume of 10. mu.l, and incubating at 50 ℃ for 15 min.

(iv) ligation product conversion

a. Adding 10 μ L of ligation product into 100 μ L of Top10 competent cell suspension, mixing gently, and standing on ice for 30 min;

b.42 ℃ water bath heat shock for 90s, standing, then quickly taking out and placing on ice for cooling for 2 min;

c. adding 800 μ L LB liquid culture medium (without antibiotic) preheated at 37 deg.C, mixing well, 37 deg.C,

culturing for 1h at 220rpm with a shaking table to restore the normal growth state of bacteria;

and d, centrifuging at 2000rpm for 5min, discarding 800 mu L of supernatant, taking appropriate bacterial liquid after the sediment is resuspended, uniformly coating the bacterial liquid on a solid plate containing kanamycin antibiotic, and performing inverted culture for 12-16 h.

Fifth colony PCR identification

5 single colonies with good growth state were picked from the transformation plate with sterile toothpick and identified by colony PCR. And respectively inoculating the single colonies with correct identification into 5mL LB liquid culture medium containing antibiotics, carrying out shaking culture at 37 ℃ and 220rpm for 4-6h, then carrying out sequencing, and selecting a bacterial liquid sample with a correct sequence for carrying out amplification culture for plasmid extraction.

(2) Purification and detection of prokaryotic expression of antimicrobial peptides Dmhep _8cysv1 and Dmhep _8cysv2

Firstly, the recombinant plasmid is transformed into BL21(DE3) escherichia coli expression type competent strain for induced expression

a. Taking 0.5 mu L of each recombinant plasmid, adding into 100 mu L of BL21(DE3) competence, mixing gently, and standing on ice for 30 min;

b.42 ℃ water bath heat shock for 90sec, standing, then quickly taking out and placing on ice for cooling for 2 min;

c. adding 800 μ L LB liquid culture medium (without antibiotic) preheated at 37 deg.C, mixing, culturing at 37 deg.C and 220rpm for 1h to restore normal growth state of bacteria;

d. and uniformly coating 50ul of bacterial liquid on a plate containing kanamycin antibiotics for inverted culture for 12-16 h.

e. Two single colonies were picked with a sterile toothpick, inoculated into 5mL LB liquid medium (containing 50ug/mL kanamycin), and shake-cultured at 37 ℃ until OD is 0.1.

f. No inducer is added to the control group, IPTG is added to the experimental group to the final concentration of 1mmol/l, and the culture is continued for 16h at 18 ℃.

② ultrasonic bacteria breaking

Centrifuging at a.5000rpm for 10min, respectively collecting thalli in the bacteria liquid after induction expression, resuspending the thalli by using 0.01M PBS (pH7.4) solution, repeatedly washing for 2 times, and finally, resuspending the thalli in the PBS solution;

b. performing ultrasonic treatment for 16min at 100W in ice-water bath;

c.4 ℃, centrifuging at 5000rpm for 10min, respectively collecting precipitates and supernatant, adding 4XSDS PAGE loading to 20 mu l of supernatant sample, heating and denaturing at 95-100 ℃ for 10min, and then storing at-20 ℃ for SDS-PAGE electrophoresis detection;

d. resuspending and dispersing the precipitate with an imidazole-free 8M urea solution;

e. performing 100W ultrasonic treatment in ice water bath for 10min, and performing electrophoresis detection on 20 μ l sample by loading and heating for denaturation;

③ SDS-PAGE gel protein electrophoresis and Coomassie brilliant blue staining

The sample and the Marker are respectively added into a sample hole of a 15% SDS-PAGE gel, and 60v electrophoresis is carried out for 3h until the Marker bands are separated. The gel block was taken out and washed in deionized water 3 times, each for 5min, and then placed in Coomassie Brilliant blue dye solution for dyeing overnight. And taking out the gel block, decoloring the gel block by using deionized water until the hollow white part of the gel is colorless, and then photographing and analyzing the gel block, wherein the result shows that the recombinant polypeptide expressed by the escherichia coli exists in the inclusion body precipitate.

Fourthly, prokaryotic expression and purification of hepcidin recombinant polypeptide

After the recombinant polypeptide expression is determined, a 200ml conical flask is used for carrying out mass amplification culture on the bacterial liquid so as to obtain a large amount of purified recombinant polypeptide. The sonicated pellet was resuspended in imidazole-free 8M urea solution to disperse the pellet, centrifuged to remove undissolved material, filtered through a 0.22 μ M filter and then purified on a nickel column, and to facilitate purification of the antimicrobial peptides Dmhep _8cysv1 and Dmhep _8cysv2, labels as shown in Table 1 were attached to their N-terminus.

Table 1: sequence of tags

Label (R)	Number of residues	Sequence of
			FLAG	8	DYKDDDDK
His-tag	6	HHHHHH

The method comprises the following specific steps:

a.5ml deionized water is used for washing the column for one time;

b.5ml denatured washing Buffer, balancing once;

c. loading, repeating the loading once, collecting the penetration liquid and reserving 20 mu l of sample for electrophoresis detection;

d.5ml of denatured washing Buffer washing column, collecting washing liquid and leaving 20 mul of sample for electrophoresis detection;

e.5ml denatured elution buffer solution elutes protein, collects the eluant and keeps 20 mul electrophoresis to detect;

f.5ml denatured elution buffer solution elutes protein, collects the eluent and keeps 20 mul electrophoresis detection;

washing the column with 5.5ml of deionized water for one time;

h.5ml of 0.5M NaOH column;

i.5ml deionized water is used for washing the column for three times;

j.20% ethanol equilibration column, and storage.

k. And (3) preserving the penetration solution, the washing solution and the eluent in a refrigerator at 4 ℃, and after the electrophoresis detection result is obtained, dialyzing, renaturing, ultrafiltering and concentrating the eluent containing the target protein. If the transudate solution also contains more target protein, it can be used as sample for secondary purification.

Fifthly, renaturation by protein dialysis

The recombinant polypeptide expressed in the precipitate is purified by a Ni column, put into a dialysis bag, and dialyzed for renaturation by (6M, 4M, 3M, 2M, 1M, 0M) gradient urea buffer solution for 2h in each gradient. The formula of the dialysis buffer solution is as follows: 5% glycerol, 1% L-arginine, 0.1M EDTA, urea, dissolved using 1x PBS.

Concentrating protein

Before use, the concentration tube is rinsed for three times by ultrapure water, then the ultrapure water is added into the concentration tube, and the centrifugation is carried out for 10min at 3000rpm, so that the filter membrane is thoroughly cleaned. Pouring out ultrapure water, adding the recombinant polypeptide sample to be concentrated, centrifuging at 3000rpm, stopping centrifuging until the required volume is reached, taking out the concentrated recombinant polypeptide sample, and performing electrophoresis detection and concentration determination. The tube was rinsed with ultrapure water three times before use, and then triple distilled water was added, centrifuged at 3000rpm for 10 min. Finally, 20% ethanol is added, the filter membrane is soaked in the ethanol, and the mixture is stored at 4 ℃.

And (3) dyeing the concentrated recombinant polypeptide with Coomassie brilliant blue to show that only one band exists in the purified recombinant polypeptide, which indicates that the purified recombinant polypeptide is the target protein containing the his tag.

Seventhly, detecting the specificity expression of the Hepcidin recombinant protein

In order to confirm that the purified single-band protein is the product of recombinant plasmid overexpression, a western blot experiment is used for verifying the protein specificity detection method. Since the His tag sequence is present at the N-terminus of the recombinant polypeptide sequence, specific detection of the expressed recombinant polypeptide can be performed using a 6XHis tag antibody. The Wetern blot experiment steps are as follows:

a. respectively adding a sample and a Marker into a sample hole of a 15% SDS-PAGE gel, carrying out electrophoresis for 3h at 60v until a Marker strip is separated from the lowermost strip of the Marker by a distance of 2-3cm from the bottom of a glass plate, taking out a gel block, cleaning, and cutting off blank and unnecessary part of gel;

b. cutting a PVDF membrane with the same size as the gel block and the pore diameter of 0.2 mu m, soaking in a methanol solution for 1min, taking out a membrane rotating clamp, placing a thin double-layer filter paper on the black side with the black side facing downwards and the white side facing upwards, placing a glue block, the PVDF membrane and the filter paper in turn, and clamping the clamp after confirming that no air bubble exists between the membrane and the glue block;

c. then the transfer membrane is clamped into a transfer membrane groove, the black surface of the transfer membrane clamp faces the red surface of the transfer membrane groove, the white surface of the transfer membrane clamp faces the white surface of the transfer membrane groove, a cover is covered, and a voltage of 80v40min is applied on ice or in a refrigerator at 4 ℃ to transfer the protein on the gel to the membrane;

d. taking out the membrane after the membrane is transferred, putting the membrane into 5% skimmed milk powder, sealing for 2h at room temperature, or sealing overnight at 4 ℃;

e. directly replacing the enclosed milk with 6xHis tag antibody solution prepared by 2% skimmed milk powder without washing the membrane, and incubating for 2h on a shaking table at room temperature;

f. washing the membrane with 1xTBST for 5min for 3 times;

g. applying a secondary antibody, and incubating for 1h at room temperature;

h. washing the membrane with 1xTBST for 5min for 3 times;

i. development was performed with ECL developer and then photography was performed with an imager.

The results showed that the size of the band hybridized with the 6 × His tag antibody was consistent with the size of the protein band observed by Coomassie blue staining of the purified protein, indicating that the purified recombinant polypeptide was produced by overexpression of the recombinant plasmid transformed into E.coli.

Example 2 recombinant polypeptide antimicrobial Activity assay

In order to avoid strain pollution, the experiment is carried out in a biological safety cabinet, all reagent consumables used in the operation process are strictly sterilized, and the operation behavior of pollution is avoided during operation.

Preparation of activated cells

a. Taking a strain frozen at minus 80 ℃, unfreezing the strain in water bath at 37 ℃, then inoculating the strain to a fresh sterile LB culture plate by using an inoculating loop, sealing a culture dish by using a sealing film, and placing the culture dish in an incubator at 37 ℃ for culture for 14-16 h;

b. then selecting a colony with the appearance consistent with the characteristics of the strain, inoculating the colony into a fresh LB liquid culture medium, and culturing for 14 hours by a shaker at 37 ℃ and at 200 rpm;

c. collecting the bacterial liquid in a 50ml centrifuge tube, then centrifuging for 5min at 4 ℃ and 2000rpm, and removing the culture medium;

d. adding fresh PBS (pH7.4) heavy suspension bacteria solution, centrifuging at 4 deg.C and 2000rpm for 5min, and removing supernatant;

e. repeatedly washing the bacterial liquid for 2 times, removing supernatant, adding precooled fresh LB liquid culture medium to resuspend the bacterial, and enabling the bacterial concentration to reach 6x10 ⁷ And/ml, and put on ice for standby (since the bacteria grow and reproduce faster at a slightly higher temperature, the bacteria solution needs to be stored at a lower temperature during the sample adding process).

② determination of antibacterial ability of recombinant polypeptide

In order to find out the minimum inhibitory concentration of various recombinant proteins, recombinant polypeptides with different concentrations and bacterial liquid are incubated together, the inhibitory effect is judged according to the growth curve of the bacteria, and four different concentrations of 10 mu M, 15 mu M, 20 mu M and 25 mu M are selected for minimum inhibitory concentration determination. The method comprises the following specific steps:

a. diluting the homogeneous recombinant polypeptide with PBS into 20. mu.M, 30. mu.M, 40. mu.M and 50. mu.M, respectively, and placing on ice for use;

b. taking an unsealed 96-hole transparent plate, adding 100ul of diluted certain bacterial liquid into each hole, reading the OD value of the bacterial liquid in each hole of the 96-hole plate at the wavelength of 630nm, and recording the OD value as the OD value at the position of-1 h;

c. then, 100ul of diluted recombinant polypeptide is added into each hole to serve as an experimental group, precooled PBS with the same volume is added into a control group, and after the sample addition is finished, the OD value of bacterial liquid in each hole of a 96-hole plate at the wavelength of 630nm is read and recorded as the OD value at the position of 0 h;

d. after reading, quickly putting the 96-well plate into a constant-temperature incubator at 37 ℃ for culture, and reading the OD value of bacterial liquid in each well of the 96-well plate at the wavelength of 630nm every 1 h;

e. collecting the data, and drawing a bacterial growth curve according to the read OD value.

The bacteriostatic results are shown in table 2, and the Dphep-8 cysV recombinant polypeptide has obvious growth inhibition effects on Escherichia coli (E.coli), Streptococcus (Streptococcus), Aeromonas hydrophila (A.hydrophila) and Staphylococcus aureus (S.aureus), and the minimum inhibitory concentrations are respectively 25. mu.M, 20. mu.M, 25. mu.M and 25. mu.M. Wherein Staphylococcus aureus and Streptococcus belong to gram-positive bacteria, and Escherichia coli and Aeromonas hydrophila belong to gram-negative bacteria. Thus, the Dphep-8 cysV1 recombinant polypeptide is resistant to both gram-negative and gram-positive bacteria. The Dmhep-8 cysV2 recombinant polypeptide has obvious growth inhibition effect on escherichia coli, streptococcus, aeromonas hydrophila, Edwardsiella and staphylococcus aureus, and the minimum inhibitory concentrations are respectively 15 mu M, 10 mu M, 20 mu M, less than or equal to 15 mu M and 15 mu M. Edwardsiella belongs to the gram-negative bacteria. Under the same inoculation condition, the time for the Edwardsiella to reach the exponential growth phase is longer, and the Dhep-8 cysV2 recombinant polypeptide has very good bactericidal effect on the Edwardsiella.

Table 2: minimum inhibitory concentrations of two variant hepcidin antimicrobial peptides

The obtained minimum inhibitory concentration is obviously lower than the minimum inhibitory concentration of 30 mu M of human hep25 antimicrobial peptide, which shows that the two recombinant polypeptides have good antibacterial effect and practical application value.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. It will be apparent to those skilled in the art that various modifications to these embodiments can be readily made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art, having the benefit of the teachings of this invention, will appreciate numerous modifications and variations there from without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> Shanghai ocean university

<120> Antarctic fish hepcidin antibacterial peptide, preparation method and application thereof

<141> 2020-07-03

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 51

<212> PRT

<213> Artificial Sequence

<400> 1

Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr

1 5 10 15

Thr Glu Asn Leu Tyr Phe Gln Gly Ala Gln Ser His Leu Ser Leu Cys

20 25 30

Arg Trp Cys Cys Asn Cys Cys Lys Gly Asn Lys Gly Cys Gly Phe Cys

35 40 45

Cys Arg Phe

50

<210> 2

<211> 49

<212> PRT

<213> Artificial Sequence

<400> 2

Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile Pro Thr

1 5 10 15

Thr Glu Asn Leu Tyr Phe Gln Gly Ala Arg Arg Arg Lys Cys Lys Phe

20 25 30

Cys Cys Asn Cys Cys Ser Asn Ile Cys Gln Thr Cys Cys Thr Arg Arg

35 40 45

Phe

<210> 3

<211> 26

<212> PRT

<213> Artificial Sequence

<400> 3

Gln Ser His Leu Ser Leu Cys Arg Trp Cys Cys Asn Cys Cys Lys Gly

1 5 10 15

Asn Lys Gly Cys Gly Phe Cys Cys Arg Phe

20 25

<210> 4

<211> 24

<212> PRT

<213> Artificial Sequence

<400> 4

Arg Arg Arg Lys Cys Lys Phe Cys Cys Asn Cys Cys Ser Asn Ile Cys

1 5 10 15

Gln Thr Cys Cys Thr Arg Arg Phe

20

<210> 5

<211> 78

<212> DNA

<213> Artificial Sequence

<400> 5

cagagccacc tctccctgtg ccgctggtgc tgcaactgct gcaagggcaa caagggctgc 60

ggcttctgct gcaggttc 78

<210> 6

<211> 72

<212> DNA

<213> Artificial Sequence

<400> 6

cgccgtcgca agtgtaaatt ttgctgcaac tgctgcagca acatctgtca aacgtgctgc 60

acaaggagat tc 72

<210> 7

<211> 35

<212> DNA

<213> Artificial Sequence

<400> 7

tattttcagg gcgcccagag ccacctctcc ctgtg 35

<210> 8

<211> 35

<212> DNA

<213> Artificial Sequence

<400> 8

gtggtggtgc tcgagtcaga acctgcagca gaagc 35

<210> 9

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 9

tattttcagg gcgcccgccg tcgcaagtgt aaattttg 38

<210> 10

<211> 35

<212> DNA

<213> Artificial Sequence

<400> 10

gtggtggtgc tcgagtcaga atctccttgt gcagc 35

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 11

ggcgccctga aaatacaggt t 21

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 12

ctcgagcacc accaccacca c 21

Claims

1. An antarctic fish hepcidin antibacterial peptide composition is characterized by comprising two kinds of antarctic fish (from Lepidium caninum (A))Dissostichus mawsoni) The antimicrobial peptide Dmhep _8cysV1 and the antimicrobial peptide Dmhep _8cysV 2; wherein:

the amino acid sequence of the antimicrobial peptide Dmhep _8cysV1 is shown as SEQ ID NO. 1;

the amino acid sequence of the antimicrobial peptide Dmhep _8cysV2 is shown as SEQ ID NO. 2.

2. The antarctic fish hepcidin antimicrobial peptide composition of claim 1, wherein the composition is characterized byIn the antibacterial peptide Dmhep _8cysV1 and the antibacterial peptide Dmhep _8cysV2, the antibacterial peptide with antibacterial activity is derived from Antarctic globigicus (Antarctic globigii) ((R))Dissostichus mawsoni) The amino acid sequences are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4.

3. The antarctic fish hepcidin antimicrobial peptide composition of claim 2, wherein the nucleotide sequence of the hepcidin antimicrobial peptide gene encoding the amino acid sequence shown in SEQ ID NO. 3 is shown in SEQ ID NO. 5; the nucleotide sequence of the hepcidin antibacterial peptide gene with the coding amino acid sequence shown as SEQ ID NO. 4 is shown as SEQ ID NO. 6.

4. The antarctic fish hepcidin antimicrobial peptide composition of claim 1, wherein,

the N end of the amino acid sequence of the antimicrobial peptide Dmhep _8cysV1 shown as SEQ ID NO. 1 can be connected

Or

The sequence is used as a label;

the N end of the amino acid sequence of the antimicrobial peptide Dmhep _8cysV2 shown as SEQ ID NO. 2 can be connected

Or

The sequence serves as a tag.

5. The method for preparing the antarctic fish hepcidin antibacterial peptide composition according to any one of claims 1 to 4, which is characterized by comprising the following steps:

(1) obtaining the coding region sequence of the liver tissue of the calamus caninum by using an RT-PCR method, and respectively obtaining the antarctic hepcidin antibacterial peptide genes of the antarctic fish with the nucleotide sequences shown as SEQ ID NO. 5 and SEQ ID NO. 6;

6. Use of the Antarctic fish hepcidin antimicrobial peptide composition of any one of claims 1 to 4 in the preparation of a formulation for inhibiting bacterial growth,

the antimicrobial peptide Dmhep _8cysV1 is used for inhibiting the growth of escherichia coli, streptococcus, aeromonas hydrophila and staphylococcus aureus;

the antimicrobial peptide Dmhep _8cysV2 is used for inhibiting the growth of escherichia coli, streptococcus, aeromonas hydrophila, Edwardsiella and staphylococcus aureus.