CN105315356A - Hucho taimen antimicrobial peptide HEPCIDIN as well as preparation method and application thereof - Google Patents

Hucho taimen antimicrobial peptide HEPCIDIN as well as preparation method and application thereof Download PDF

Info

Publication number
CN105315356A
CN105315356A CN201510903377.2A CN201510903377A CN105315356A CN 105315356 A CN105315356 A CN 105315356A CN 201510903377 A CN201510903377 A CN 201510903377A CN 105315356 A CN105315356 A CN 105315356A
Authority
CN
China
Prior art keywords
antibacterial peptide
hthepmt
peptide hepcidin
sieve salmon
hepcidin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510903377.2A
Other languages
Chinese (zh)
Inventor
王荻
李绍戊
赵景壮
刘红柏
卢彤岩
匡友谊
尹家胜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Heilongjiang River Fisheries Research Institute of Chinese Academy of Fishery Sciences
Original Assignee
Heilongjiang River Fisheries Research Institute of Chinese Academy of Fishery Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Heilongjiang River Fisheries Research Institute of Chinese Academy of Fishery Sciences filed Critical Heilongjiang River Fisheries Research Institute of Chinese Academy of Fishery Sciences
Priority to CN201510903377.2A priority Critical patent/CN105315356A/en
Publication of CN105315356A publication Critical patent/CN105315356A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/70—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in livestock or poultry

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention relates to a hucho taimen antimicrobial peptide HEPCIDIN as well as a preparation method and an application thereof. An amino acid sequence of the hucho taimen antimicrobial peptide HEPCIDIN is SEQ ID No.1 and 2, and a nucleotide sequence for coding the hucho taimen antimicrobial peptide HEPCIDIN is SEQ ID NO.3. The hucho taimen antimicrobial peptide HEPCIDIN has antimicrobial activity and can be applied to the field of drugs and feed.

Description

A kind of wise sieve salmon antibacterial peptide HEPCIDIN and its production and use
Technical field
The present invention relates to the genetically engineered of biological technical field Mesichthyes, be specifically related to that there is anti-microbial activity wise man sieve salmon antibacterial peptide HEPCIDIN.
Background technology
The class produced through induction in the former finger insect body of antibacterial peptide (antimicrobialpeptides, AMPs) has the basic polypeptide material of anti-microbial activity, and molecular weight, at about 2000 ~ 7000Da, is made up of 20 ~ 60 amino-acid residues.This kind of active polypeptide majority has the features such as strong basicity, thermostability and broad-spectrum antimicrobial.First antibacterial peptide be found is induced the polypeptide with anti-microbial activity cherished guppy sky silkworm chrysalis and produce through injection enterobacter cloacae and intestinal bacteria by people such as Sweden scientist G.Boman in 1980 in the world, names as Cecropins.Afterwards, from other insects and amphibian animal, Mammals, be also separated to the antimicrobial polypeptide of structural similitude, the structure of existing more than 70 kind of antimicrobial polypeptide is determined at present.
Fish are as the animal occurring immunoglobulin (Ig) the earliest, and its non-specific immune systems is the first defensive barrier resisting all kinds of pathogenic agent.Fish live in water, frequently contact with a large amount of pathogenic agent, by secreting a kind of nonspecific defense approach of miscellaneous antibacterial peptide as opposing pathogen invasion.When fish body sustains damage or pathogenic micro-organism is attacked, antibacterial peptide can be produced rapidly to prevent and to kill and wound pathogenic micro-organism, its resultant velocity is fast, and diffusion is rapid, flexible in vivo, has other macro-molecular proteins (as antibody etc.) and the advantage not available for immunocyte.AMPs is also referred to as host defense peptide, usually many secretions are in the region of saliva, mucus, the recycle system and some other cause of disease primary challenge, be the important component part of non-specific immune systems, destroyed by " solvability " or the infection of various bacteria, fungi, virus and other causal organisms is defendd in " ion " pore-creating.
Wise man sieve salmon, Huchotaimen (pallas), belonging to salmon shape order Samoniformes, salmon section Salmonidea, taimen belongs to Hucho, is cold aqueous violent predacious fish, is also the fish that in salmon fishes, individuality is maximum, the speed of growth is the fastest.The wild resource of current taimen is substantially exhausted, within 1998, is listed in Chinese animals on the brink of extinction Red Data Book, belong to species of easily endangering by China, within 2004, be put into Chinese species Red List, receive global concern.
Along with the fast development of China's intensive aquaculture, various bacillary and virus disease frequently occurs.And prevent and treat microbiotic and the other drug of a large amount of use in process, not only destroy the microecological balance of water surrounding, more make some pathogenic agent create serious resistance.Therefore, accelerating the fundamental research to main aquaculture species immune defense, transfer, develop the defence potentiality of himself, is one of Critical policies carried out healthy aquaculture, realize aquaculture Sustainable development.Along with the separation of aquatic animal antibacterial peptide, the research of structure and fuction, transformation, synthesis not only have stability and high efficiency anti-microbial activity but also have special antimicrobial spectrum, the antibacterial peptide gene harmless to host, expressed in prokaryotic cell prokaryocyte, eukaryotic cell or some algae by genetically engineered, to realize batch production, the newtype drug of antagonism aquaculture object main pathogens particularly resistant organism will be promised to be.
Summary of the invention
In order to overcome the problems referred to above, this research is cloned into a kind of antibacterial peptide HEPCIDIN gene by RT-PCR and RACE technology from wise sieve salmon, called after HtHep, and its structure, homology, evolution, proteins encoded characteristic and recombinant protein bacteriostatic activity are analyzed.The critical function of this gene in non-specific immunity defence, by for wise sieve salmon disease control, gene assist-breeding and be developed as pharmaceutical prod further and lay the foundation, have broad application prospects.
One aspect of the present invention provides a kind of HtHep, and its overall amino acid sequence is SEQIDNo.1.
SEQIDNo.1 sequence is:
MKAFSVAVAGVVVLACMFILESTAVPFSEVRKEEVGSIDSPVGEHYQPGSESMRPAEHFRFKRQSHLSLCRWCCNCCHNKGCGFCCKF
The mature peptide section aminoacid sequence with anti-microbial activity is SEQIDNo.2:
QSHLSLCRWCCNCCHNKGCGFCCKFSEQIDNo.2
Another aspect of the present invention provides a kind of HtHep's of coding or the foregoing HtHep's that encodes gene, and its nucleotides sequence is classified as SEQIDNo.3.
SEQIDNo.3 sequence is:
ATGAAGGCCTTCAGTGTTGCAGTTGCAGGGGTGGTCGTCCTCGCATGTATGTTCATCCTTGAAAGCACCGCTGTTCCTTTCTCCGAGGTGCGAAAGGAGGAGGTTGGAAGCATTGACAGTCCAGTTGGGGAACATTATCAGCCTGGCAGCGAGTCCATGCGTCCGGCGGAGCATTTCAGGTTCAAGCGTCAGAGCCACCTCTCCCTGTGCCGTTGGTGCTGCAACTGCTGTCACAACAAGGGCTGTGGCTTCTGCTGCAAATTCTGA
Another aspect of the invention provides a kind of expression vector comprising forementioned gene.
Another aspect of the invention provides the preparation method of a kind of foregoing HtHep, and it comprises the following steps:
Step 1) RT-PCR method acquisition HtHep gene order,
RT-PCR method primer sequence used is:
Hep-F:5’-ATGAAGGCCTTCAGTGTTGCA-3’SEQIDNo.4；
Hep-R:5’-TCAGAATTTGCAGCAGAAGCCACAG-3’SEQIDNo.5；
Step 2) RACE method acquisition HtHep full length gene cDNA.
RACE method primer sequence used is:
UPM-CTAATACGACTCACTATAGGGCSEQIDNo.6；
5’RACE-GSP1-GGACTCGCTGCCAGGCTGTTGATGSEQIDNo.7；
3’RACE-GSP1-TGCAGCACCAACGGCACAGGGAGASEQIDNo.8；
Step 3) build HtHep mature peptide section (being called for short HtHepmt) recombinant plasmid pET32a (+)-HtHepmt;
Build pMD18T-hep plasmid, with pMD18T-hep plasmid for template, take Hepmt-F/Hepmt-R as the pcr amplification that primer carries out HtHepmt fragment, amplified production is built restructuring pMD18T-HtHepmt carrier, HtHepmt fragment is connected with pET32a (+) carrier after cutting by enzyme
Hepmt-F/Hepmt-R primer sequence is respectively:
Hepmt-F:5’-GAATTCATGCAGAGCCACC-3’SEQIDNo.9；
Hepmt-R:5’-GTCGACTCAATGATGATGATGATGATGGAATTTGCAG-3’SEQIDNo.10；
Step 4) pET32a (+)-HtHepmt recombinant plasmid transformed expression strain E.coliRossetta (DE3) competent cell;
Step 5) abduction delivering of HtHepmt recombinant protein.
Another aspect of the invention provides a kind of HtHep prepared with aforementioned preparation process, and described HtHep has 25 amino acid whose mature peptides, and containing 8 conserved structure Cys residues, mature peptide molecular formula is C 118h 178n 38O 31s 8, molecular weight is 2.88kDa, and theoretical iso-electric point is 8.53.
Another aspect of the invention provides the purposes of a kind of foregoing HtHep in preparation treatment antibacterial medicines, and preferably, described antibacterial finger suppresses micrococcus lysodeikticus, streptococcus aureus or E. coli Activity.
Another aspect of the invention provides a kind of foregoing HtHep and is preparing the purposes in the hydrobiont or cultivation animal and fowl fodder with disease control function.
Accompanying drawing explanation
Fig. 1 is the systematic evolution tree of the different biological antibacterial peptide HEPCIDIN gene orders based on NJ method structure.
Fig. 2 is the amino acid sequence analysis of HtHep gene order and translation thereof.Note: initiator codon ATG and terminator codon TGA italic are indicated, terminator TGA represents with No. *.
Fig. 3 is HtHep signal peptide prediction.
Fig. 4 is HtHep amino acid alignment result.Note: * represents 8 conservative Cys residues.Wherein, * represents 8 conservative Cys residues.
Fig. 5 is that albumen HtHepmt detects the bacteriostatic activity of micrococcus lysodeikticus.A: positive control (Amp); 7: albumen HtHepmt (50 μ L); 8: albumen HtHepmt (200 μ L); C: negative control (PBS).
Embodiment
Test with wise sieve salmon as cold water fish testing station, the Bohai Sea of Heilongjiang Inst. of Aquatic Products, Chinese Academy of Aquatic Products Scie provides.
Embodiment 1, RT-PCR method obtain HtHep gene order
Get wise sieve salmon liver and extract total serum IgE with Trizol (Invitrogen) reagent, reverse transcription synthesis cDNA.
According to the antibacterial peptide HEPCIDIN DNA homolog comparison result of the cold water fish such as rainbow trout (rainbowtrout), Atlantic salmon (salmonsalar), design and synthesis pair of primers is used for HtHep gene clone.Primer sequence: Hep-F:5 '-ATGAAGGCCTTCAGTGTTGCA-3 '; Hep-R:5 '-TCAGAATTTGCAGCAGAAGCCACAG-3 '.PCR reaction conditions is: 95 DEG C of 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 30cycles; 72 DEG C of 10min; 4 DEG C.After agarose gel electrophoresis detected result, PCR primer is reclaimed, and be connected on pMD18-T carrier (TAKARA), transformation of E. coli competent cell (DH5 α), after PCR qualification, deliver to the raw work order-checking in Shanghai.
Embodiment 2, RACE method obtain HtHep full length gene cDNA
According to the cDNA sequence obtained, design 5 ' RACE and 3 ' RACEPCR primer.According to clontechRACE test kit specification sheets, increase cDNA5 ' end and 3 ' end respectively.Primer information is as follows:
Primer sequence (5 '-3 ')
UPMCTAATACGACTCACTATAGGGC
5’RACE-GSP1GGACTCGCTGCCAGGCTGTTGATG
3’RACE-GSP1TGCAGCACCAACGGCACAGGGAGA
Embodiment 3, sequential analysis
The full-length cDNA ORFFinder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) of the HtHep obtained is determined correct open reading frame, and translates into aminoacid sequence; Compare with blast program (http://www.ncbi.nlm.nih.gov/BLAST) and the sequence in GenBank, EMBL, DDBJ and PDB database; HtHep structural domain is analyzed with CDD software (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi); Signal peptide and the cleavage site of HtHep is analyzed with SignalP4.0 (http://www.cbs.dtu.dk/services/SignalP); The molecular formula of forecasting sequence, molecular weight and theoretical iso-electric point is come with ProtParam (http://web.expasy.org/protparam); The HtHep nucleotide sequence of acquisition and other antibacterial peptide HEPCIDIN gene order are carried out Clustal-W comparison, builds different plant species with MEGA5.0 and set based on the Molecular Phylogeny of antibacterial peptide HEPCIDIN sequence.
The structure of embodiment 4, recombinant plasmid pET32a (+)-HtHepmt
According to the restriction endonuclease recognition sequence of cloning HtHep mature peptide sequence and expression vector pET32a (+) the cloning site two ends obtained, design a pair Auele Specific Primer Hepmt-F and Hepmt-R for prokaryotic expression, primer two ends add EcoR I and Sal I restriction enzyme site respectively, primer sequence is respectively: Hepmt-F:5 '-GAATTCATGCAGAGCCACC-3 ', Hepmt-R:5 '-GTCGACTCAATGATGATGATGATGATGGAATTTGCAG-3 '.With the pMD18T-hep plasmid through sequence verification for template, take Hepmt-F/Hepmt-R as the pcr amplification that primer carries out HtHepmt fragment.Amplified production is detected, for connecting conversion after glue reclaims through 1% agarose gel electrophoresis.Glue is reclaimed product and connect pMD18T carrier, build restructuring pMD18T-HtHepmt carrier, after order-checking and sequence alignment, verify accuracy.Cut pMD18T-HtHepmt and pET32a (+) carrier with EcoR I and Sal I enzyme and reclaim object fragment respectively, utilize T4DNA ligase enzyme to be connected by 16 DEG C, HtHepmt fragment and pET32a (+) carrier to spend the night, build pET32a (+)-HtHepmt recombinant plasmid.
Embodiment 5, recombinant plasmid pET32a (+)-HtHepmt transform expression strain E.coliRossetta (DE3)
By pET32a (+)-HtHepmt recombinant plasmid transformed E.coliDH5 α, utilize PCR and double digestion screening positive strain.With the direct Transformed E .coliRossetta of recombinant plasmid 2uL (DE3) competent cell that checking is correct, coat LB+Amp flat board, be inverted incubated overnight for 37 DEG C.
Abduction delivering and the SDS-PAGE of embodiment 6, recombinant plasmid pET32a (+)-HtHepmt identify
Spend the night streak culture on LB+Amp substratum for the E.coliRossetta (DE3) containing pET32a (+)-HtHepmt, then picking list bacterium colony 37 DEG C of shaking culture in 5mLLB+Amp liquid nutrient medium are spent the night.Press 1:100 enlarged culturing next day, 37 DEG C are cultured to OD600 value for adding isopropylthio-β-D-galactoside (IPTG) to final concentration after 0.4-0.5 is 0.5mM, continue 37 DEG C of shaking culture and induce 4 hours, got 1mL bacterium liquid every one hour before induction and after induction, detect for sample preparation and SDS-PAGE.
The extensive abduction delivering of embodiment 7, HtHepmt recombinant protein
Picking expression strain positive monoclonal is cultivated in 37 DEG C of overnight shakings in LB+Amp liquid nutrient medium, next day joins in 500mLLB+Amp liquid nutrient medium by 1:100 volume ratio and cultivates, 37 DEG C of about shaking culture 3h to OD600 values reach 0.4-0.5, add IPTG again and continue inducing culture 4h after final concentration is 0.5mM, take out 1mL bacterium liquid before induction in contrast.
After inducing culture terminates, bacterium liquid is collected thalline in the centrifugal 15min of 5000rpm, and be resuspended in the PBS of 50mL precooling, sonicated cells, by the centrifugal 15min of bacterium liquid 11000rpm after fragmentation, collect supernatant liquor and precipitation respectively, carry out SDS-PAGE detection.
The Activity determination of embodiment 8, HtHepmt recombinant protein
The bacteriostatic activity of recombinant protein detects and adopts agarose hole diffusion inhibition zone method, be inoculated in 5mLTSB substratum respectively by test bacteria micrococcus lysodeikticus (Micrococcuslysodeikticus), streptococcus aureus (Staphylococcusaureus) and intestinal bacteria (Escherichiacoli), 28 DEG C are cultured to logarithmic phase.To add in TSA substratum and a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices in 1:100 ratio, preparation is containing germy bacterium plate.After culture medium solidifying, with the recombinant protein adding 200uL dialysis purifying after the punching of Oxford cup, positive control adds penbritin (Ampicillin) 200uL of 5mg/mL, negative control adds the PBS solution of filtration sterilization, observe inhibition zone size after 28 DEG C of cultivation 24h, calculate bacterial restrain area.
experimental result
The Cloning and sequence analysis of 1 gene HtHep
Show according to the phylogenetic tree that gene nucleotide series is set up, gained sequence and rainbow trout and Atlantic salmon antibacterial peptide HEPCIDIN gene are polymerized to separately one (Fig. 1).
RT-PCR and RACE technology is utilized to increase from wise sieve salmon the full length cDNA sequence 456bp of HtHep gene, wherein entire open reading frame 267bp, 5 ' non-coding region 170bp, 3 ' non-coding region 19bp (Fig. 2).Its proteins encoded contains 88 amino acid, through SignalP software analysis, speculating acid sequence N end has 24 amino acid whose signal peptides (see Fig. 3), through the known aminoacid sequence of compare of analysis also containing 39 amino acid whose functional zone, the thus active small peptide that is made up of 25 amino acid of HtHepmt.
Comprise 25 amino acid whose mature peptides and contain 8 conserved structure Cys residues.Mature peptide molecular formula is C 118h 178n 38o 31s 8, molecular weight is 2.88kDa, and theoretical iso-electric point is 8.53.
ClustalW compare of analysis shows that the similarity of the overall amino acid sequence of HtHep and the species such as Atlantic salmon, rainbow trout related amino acid sequence is as Fig. 4.
The structure of 2 recombinant plasmid pET32a (+)-HtHepmt and screening
With the pMD18T-hep plasmid through sequence verification for template, utilize Auele Specific Primer Hep-F and Hep-R of HtHepmt gene to carry out pcr amplification, obtaining expection size is the band of 144bp.Object fragment connected pMD18T carrier and send survey, after sequence alignment checking, successfully building pMD18T-HtHepmt carrier.Cut pMD18T-HtHepmt and pET32a (+) carrier with EcoR I and Sal I enzyme and reclaim object fragment respectively, utilize T4DNA ligase enzyme enzyme to be cut gained object fragment to be connected with 16 DEG C, pET32a (+) carrier and to spend the night, build pET32a (+)-HtHepmt recombinant plasmid, and by this recombinant plasmid transformed E.coliDH5 α, PCR and double digestion screening positive clone, result shows the DH5 α bacterial strain successfully obtained containing recombinant plasmid pET32a (+)-HtHepmt.
The abduction delivering of 3HtHepmt recombinant protein
By pET32a (+)-HtHepmt recombinant plasmid transformed E.coliRossetta (DE3), first carry out small-scale abduction delivering, through SDS-PAGE detection display, the sample after induction has obvious expression product band at about 25kDa.According to pET32a (+) carrier proteins label aminoacid sequence and HtHepmt aminoacid sequence, infer through bioinformatics software, fusion rotein is about 23kDa, wherein enzyme cut after carrier tag be 183 amino acid, known as calculated, induction expression protein conforms to expection size, target protein successful expression.
4 protein purifications
Because the C end at target protein is containing 6 × His label, therefore this experiment uses HisTrapTMFFcrude to carry out purifying to target protein.
After Rosetta expression bacterium after induction is utilized the abundant fragmentation of Ultrasonic Cell Disruptor ice, 12000r/min, 4 DEG C of centrifugal 15min, supernatant liquor is undertaken filtering rear injection HisTrapTMFFcrude affinity column by 0.45 μm of filter membrane, after sample is combined completely with pillar, (NaCl29.25g is taken, Na with the BindingBuffer of about 3 column volumes 3pO 47.6g, imidazoles 2.72g is dissolved in the distilled water of about 800mL, after stirring evenly, pH value is adjusted to 7.4, and adding distil water is settled to 1000mL, room temperature preservation) rinse pillar to remove foreigh protein removing; With ElutionBuffer (NaCl29.25g, Na3PO47.6g, imidazoles 34g is dissolved in the distilled water of about 800mL, after stirring evenly, pH value is adjusted to 7.4, adding distil water is settled to 1000mL, room temperature preservation) wash-out fusion rotein, and collect elutriant according to ultraviolet absorption peak.
Add enteropeptidase (NewEnglandBioLabs) after utilizing desalting column HiPrepTM26/10Desalting (filler is SephadexTMG-25Fine) to carry out desalination to the fusion rotein obtained after wash-out to carry out enzyme to albumen and cut.
Enzyme cut after HtHepmt PROTEIN C end contain 6 × His label, digestion products can obtain after wash-out removing the target protein of label with HisTrapTMFFcrude affinity chromatography column purification again, again can carry out protein-active mensuration after desalting column desalination.
5 bacteriostatic activities detect
Agar hole diffusion inhibition zone method is adopted to detect the bacteriostatic activity of albumen HtHepmt.Result shows, this albumen has excellent bacteriostatic activity to micrococcus lysodeikticus (Fig. 5), streptococcus aureus and intestinal bacteria, and PBS in contrast does not then have bacteriostatic activity.
Table 1 wise sieve salmon antibacterial peptide HEPCIDIN bacteriostatic activity
experiment conclusion
The wise sieve salmon antibacterial peptide HEPCIDIN gene of this research successful clone also obtains the prokaryotic expression product of its mature peptide, and the expression product that obtains has good anti-microbial activity, can be used for disease control of aquatic animal, reduces the use of chemicals; And can be used for fodder additives use.

Claims (7)

1. wise sieve salmon antibacterial peptide HEPCIDIN, its overall amino acid sequence is SEQIDNo.1, and preferably, wise sieve salmon antibacterial peptide HEPCIDIN mature peptide aminoacid sequence is SEQIDNo.2.
2. encode wise sieve salmon antibacterial peptide HEPCIDIN's or the wise sieve salmon antibacterial peptide HEPCIDIN's as claimed in claim 1 that encodes gene, its nucleotides sequence is classified as SEQIDNo.3.
3. one kind comprises the expression vector of gene according to claim 2.
4. a preparation method of wise sieve salmon antibacterial peptide HEPCIDIN as claimed in claim 1, it comprises the following steps:
Step 1) RT-PCR method obtains wise sieve salmon antibacterial peptide HEPCIDIN gene order,
RT-PCR method primer sequence used is:
Hep-F:5’-ATGAAGGCCTTCAGTGTTGCA-3’；
Hep-R:5’-TCAGAATTTGCAGCAGAAGCCACAG-3’；
Step 2) RACE method acquisition HtHep full length gene cDNA.
RACE method primer sequence used is:
UPM-CTAATACGACTCACTATAGGGC；
5’RACE-GSP1-GGACTCGCTGCCAGGCTGTTGATG；
3’RACE-GSP1-TGCAGCACCAACGGCACAGGGAGA；
Step 3) build wise sieve salmon antibacterial peptide HEPCIDIN mature peptide section recombinant plasmid pET32a (+)-HtHepmt;
Build pMD18T-hep plasmid, and with pMD18T-hep plasmid with template, take Hepmt-F/Hepmt-R as the pcr amplification that primer carries out HtHepmt fragment, amplified production is built restructuring pMD18T-HtHepmt carrier, HtHepmt fragment is connected with pET32a (+) carrier after cutting by enzyme
Hepmt-F/Hepmt-R primer sequence is respectively:
Hepmt-F:5’-GAATTCATGCAGAGCCACC-3’；
Hepmt-R:5’-GTCGACTCAATGATGATGATGATGATGGAATTTGCAG-3’；
Step 4) pET32a (+)-HtHepmt recombinant plasmid transformed expression strain E.coliRossetta (DE3) competent cell;
Step 5) abduction delivering of wise sieve salmon antibacterial peptide HEPCIDIN mature peptide section recombinant protein.
5., with wise sieve salmon antibacterial peptide HEPCIDIN that preparation method described in claim 4 prepares, described wise sieve salmon antibacterial peptide HEPCIDIN has 25 amino acid whose mature peptides, and containing 8 conserved structure Cys residues, mature peptide molecular formula is C 118h 178n 38o 31s 8, molecular weight is 2.88kDa, and theoretical iso-electric point is 8.53.
6. the wise sieve salmon antibacterial peptide HEPCIDIN as described in claim 1 or 5 is preparing the purposes in antibacterial medicines, and preferably, described antibacterial finger suppresses micrococcus lysodeikticus, streptococcus aureus or colibacillary activity.
7. the purposes of the wise sieve salmon antibacterial peptide HEPCIDIN as described in claim 1 or 5 in the hydrobiont of preparing there is disease control function or cultivation animal and fowl fodder.
CN201510903377.2A 2015-12-09 2015-12-09 Hucho taimen antimicrobial peptide HEPCIDIN as well as preparation method and application thereof Pending CN105315356A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510903377.2A CN105315356A (en) 2015-12-09 2015-12-09 Hucho taimen antimicrobial peptide HEPCIDIN as well as preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510903377.2A CN105315356A (en) 2015-12-09 2015-12-09 Hucho taimen antimicrobial peptide HEPCIDIN as well as preparation method and application thereof

Publications (1)

Publication Number Publication Date
CN105315356A true CN105315356A (en) 2016-02-10

Family

ID=55243745

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510903377.2A Pending CN105315356A (en) 2015-12-09 2015-12-09 Hucho taimen antimicrobial peptide HEPCIDIN as well as preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN105315356A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111662370A (en) * 2020-07-03 2020-09-15 上海海洋大学 Antarctic fish hepcidin antibacterial peptide and preparation method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1641025A (en) * 2004-11-29 2005-07-20 中国水产科学研究院黄海水产研究所 Pagrosomus major antibacterial peptide gene, and recombinant yeast expression vector and its preparing method

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1641025A (en) * 2004-11-29 2005-07-20 中国水产科学研究院黄海水产研究所 Pagrosomus major antibacterial peptide gene, and recombinant yeast expression vector and its preparing method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SUSAN E. DOUGLAS等: "Identification and expression analysis of hepcidin-like antimicrobial peptides in bony fish", 《DEVELOPMENTAL AND COMPARATIVE IMMUNOLOGY》 *
李冰冰等: "《生化与分子生物学实验指导》", 31 August 2014, 中国矿业大学出版社 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111662370A (en) * 2020-07-03 2020-09-15 上海海洋大学 Antarctic fish hepcidin antibacterial peptide and preparation method and application thereof
CN111662370B (en) * 2020-07-03 2022-07-26 上海海洋大学 Antarctic fish hepcidin antibacterial peptide and preparation method and application thereof

Similar Documents

Publication Publication Date Title
CN102559695A (en) Pseudosciaena crocea interferon (IFN) gene and cloning method thereof
CN103755795B (en) Epinephelus coioides antimicrobial petide LEAP-2 gene, carrier, recombinant bacterial strain and albumen and application thereof
CN101525617B (en) Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression
CN103320446B (en) Procambarus clarkia inhibin 1 gene as well as coded inhibin1 protein and application thereof
Shanthi et al. cDNA cloning, characterization and expression analysis of a novel antimicrobial peptide gene penaeidin-3 (Fi-Pen3) from the haemocytes of Indian white shrimp Fenneropenaeus indicus
CN102392042A (en) Method for preparing Metapenaeus ensis arginine kinase by pichia yeast
CN105315356A (en) Hucho taimen antimicrobial peptide HEPCIDIN as well as preparation method and application thereof
CN103724412A (en) Fenneropenaeus chinensiss anti-lipopolysaccharide factor as well as preparation and application thereof
CN101942473B (en) Procambrus clarkii type i lysozyme gene, lysozyme coded by lysozyme gene and application of lysozyme
CN101565703B (en) Eriocheir sinensis Crustin-2 gene and application of recombinant protein thereof
CN102604906B (en) Bombyx mori glutathione-S-transferase BmGSTD4 and genes thereof
CN103215274A (en) Epinephelus coioides interferon IFNgamma2 and preparation method and application thereof
CN108707195A (en) 3 gene of Mandarin fish IFN-α, recombinant protein, preparation method and application
CN109021088A (en) A kind of Penaeus monodon cecropin A LFpm10 and preparation method thereof
CN115572325A (en) Preparation method and application of exopalaemon carinicauda antibacterial peptide and recombinant protein thereof
CN104004765B (en) A kind of gene with immune effect
CN102337271A (en) Portunus trituberculatus anti-lipopolysaccharide factor PtALF-2 gene and encoding proteins and application thereof
CN102586261A (en) Portunus trituberculatus PtCrustin-2 gene, and coded protein and application thereof
CN103243106B (en) Epinephelus coioides interferon IFNgamma1 and preparation method and application thereof
CN102337273A (en) Portunus trituberculatus anti-lipopolysaccharide factor PtALF-5 gene and encoding proteins and application thereof
CN108048475B (en) Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria
CN101565462B (en) Large yellow croaker BPI-BN protein, primer and applications thereof in preparing antibiotic drugs
CN105399808A (en) Sebastes schlegeli immunological enhancing protein (HNGB1) gene as well as coded protein and application
Ren et al. Cloning and expression of two anti‐lipopolysaccharide factors in Eriocheir hepuensis under Vibrio alginolyticus‐induced stress
CN111690636A (en) Trypsin-like serine protease gene, encoded protein and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20160210