CN111647667A - DNA barcode standard detection fragment for identifying wasp hornet and application thereof - Google Patents
DNA barcode standard detection fragment for identifying wasp hornet and application thereof Download PDFInfo
- Publication number
- CN111647667A CN111647667A CN202010632909.4A CN202010632909A CN111647667A CN 111647667 A CN111647667 A CN 111647667A CN 202010632909 A CN202010632909 A CN 202010632909A CN 111647667 A CN111647667 A CN 111647667A
- Authority
- CN
- China
- Prior art keywords
- dna
- standard detection
- hornet
- sample
- dna barcode
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a DNA bar code standard detection fragment for identifying hornet and application thereof, belonging to the field of biological species identification, and discloses a DNA bar code standard detection gene sequence SEQ ID NO.1 and a key technology for carrying out molecular identification on insect medicinal material hornet by utilizing the CO II gene sequence and a PCR amplification technology; the PCR product is verified by agarose gel electrophoresis and then sequenced, the sequencing result is manually collated and sequence spliced, and is compared with the CO II gene sequence disclosed by the invention, and if the homology is 98 percent or more, the insect medicinal material to be identified can be judged to be the source of the hornet; the DNA molecular identification technology of the invention realizes the rapid, accurate and reliable identification of fresh or dry medicinal materials, whole or partial insect bodies, pupae or larvae or imagoes, and ensures the safety of the hornet used as the medicinal material for entering the medicine.
Description
Technical Field
The invention relates to the field of biological species identification, in particular to a DNA barcode standard detection fragment for identifying wasps auraria and application thereof.
Background
The Vespa mandarinia Smith is a predatory carnivorous insect with the largest body type and fierce sexual behavior in Vespa of Vespidae of Hymenoptera (Hymenoptera), commonly known as the tiger head bee, also known as the Chinese damnacanthus chinensis, the spotted wasp, the peach wasp, the homalocephalus, and the like. The larvae, all bodies and bee nest can be used as medicine, the medicinal materials are bumblebee (all bodies), bumblebee larva and nidus Vespae (bee nest), and are mainly used for treating rheumatalgia. Wasp is sweet and pungent in flavor and warm in nature, is mainly used for treating rheumatic arthralgia, and has the effects of dispelling wind and removing dampness for adults and larvae, and can be used for treating acute and chronic rheumatalgia and rheumatic arthritis; the wasp's nest has the functions of relieving pain, dispelling wind, expelling parasites, eliminating swelling, etc. and is used mainly for treating convulsion, arthralgia due to wind evil, tooth poison, mastalgia, etc.; bee venom is mainly used for treating bee sting anaphylaxis, cardiovascular system diseases, rheumatic arthritis, pyocutaneous disease and other diseases. According to the records of the national medical record, the wasp is a Yi medicine and has the functions of treating rheumatism, general pain and numbness. In addition, the wasps with golden ring are used as raw materials to prepare the wine for people to drink, and the wasp with golden ring and the wasp seed wine has the effects of promoting blood circulation, removing obstruction in channels, dispelling wind, removing dampness and improving blood circulation. It is expected that Vespa mandarinia will play a significant role in the health care industry of humans. Therefore, accurate species identification is a prerequisite for species distribution investigation and population occurrence dynamic research, and is also a basis for deep research and drug development of the wasps. In recent years, in the development and utilization process of biological medicines of insects, wasps become hot points of research, pharmacological effects of the wasps are more and more researched, medicinal preparations of the wasps are more and more widely applied in clinic, and species identification of the wasps is a precondition and basis for development and utilization of medicines.
However, due to the lack of professional techniques required for species identification by medicinal material collectors, sellers and wasp farmers, the counterfeit products of the wasps kumquat are brought into the medicinal material market. The species of the wasps used as the medicine are different, and the contained effective components, medicinal efficacy and toxic and side effects of the wasps are possibly different; the mixed counterfeit medicine may not achieve the due curative effect of the medicine, and even cause adverse reaction of the user. Therefore, in order to ensure the efficacy and safety of the drug, the wasps horneri and the adulterants thereof cannot be confused and replaced with each other, and accurate identification and careful division need to be given. At present, the identification method aiming at the wasps aurantiaca comprises methods such as character identification, microscopic identification, physicochemical identification and the like, but the traditional species identification mainly depends on professional insect classificators which spend a lot of time and energy to accumulate and arrange the described morphological characteristics, so that the time and the energy are wasted, the interference of subjective factors is frequently caused, and the confusion and the error are easy to occur; secondly, as the distinguishing characteristics between the Vespa mandarinia and the kindred species of the Vespa mandarinia are few and unobvious, the traditional method is easy to cause error identification; (2) the identification of different biotypes of the same species of Vespa mandarinia can hardly be achieved by the traditional method; (3) the traditional identification method is difficult to provide identification aiming at the larvae, pupae or defective individuals of the hornet; therefore, the traditional identification method has larger limitation. In recent years, with the development of molecular biology techniques, DNA barcode techniques, which are based on DNA molecules representing the genetic nature of species, have become effective analytical means for species identification.
DNA Barcoding (DNA Barcoding) is a new method of species identification that has been developed in recent years. In 2003, the Canadian taxonomist Paul Hebert proposed the concept of DNA barcodes, which are standard, sufficiently variable, easily amplifiable, relatively short DNA fragments that represent the species in vivo. By carrying out sequence analysis on a section of recognized and relatively short DNA fragment in a genome, the method can effectively make up the defects of the traditional species identification method, thereby becoming a research hotspot and direction of biological classification and identification. Ball et al (2005) identified more than 70 aquatic mayflies using DNA barcodes; the mitochondrion CO I gene is used for identifying the invasion pest Frankliniella occidentalis and other common 8 kinds of thrips in Yonghua et al (2007); yueyuoyun and the like (2010) directly apply the DNA barcode technology to the identification of unknown insect larva species, and the expected effect is achieved. However, the prior literature has no related report of DNA barcode technology for identifying the wasps horneri.
Disclosure of Invention
The invention aims to provide a DNA barcode standard detection fragment for identifying wasps auraria and application thereof, which are used for solving the problems in the prior art and realizing quick, accurate and efficient identification of the wasps auraria.
In order to achieve the purpose, the invention provides the following scheme:
the invention provides a DNA barcode standard detection fragment for identifying wasps auraria, wherein the nucleotide sequence of the DNA barcode standard detection fragment is shown as SEQ ID No. 1.
Further, the DNA barcode standard detection fragment is a Vespa mandarinia CO II (cytochrome coxidase subunit II) gene fragment.
The invention also provides a primer pair for identifying the decursia virginiana peak, wherein the primer pair is used for amplifying the DNA barcode standard detection fragment; in the primer pair, the nucleotide sequence of the forward primer is shown as SEQ ID No.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 3.
The invention also provides a method for identifying the wasp hornet by using the DNA barcode standard detection fragment, which comprises the following steps:
(1) extracting DNA of a sample to be detected, taking the DNA of the sample to be detected as template DNA, and carrying out PCR amplification by using the primer pair of claim 3 to obtain a CO II gene fragment;
(2) carrying out agarose gel electrophoresis analysis on the obtained CO II gene fragment, observing under an ultraviolet lamp after staining by ethidium bromide, judging a result according to the size of an amplification product, and sequencing a specific target band;
(3) and (3) after the sequencing result is subjected to proofreading and sequence splicing, removing the primer sequence, comparing with the DNA barcode standard detection fragment, and if the homology is 98% or more, judging that the sample to be detected is the source of the wasp ringgoldiana.
Further, in the step (1), a negative control and a positive control are set during PCR amplification, wherein the positive control is a PCR reaction product containing the DNA barcode standard detection fragment.
Further, in the step (2), the target band is sent to a sequencing company for DNA sequence determination, a DNA sequencer is used for bidirectional sequencing of the PCR amplification product, and the primer is used as a sequencing primer; and manually proofreading and splicing the sequencing result by adopting sequence splicing software SeqMen.
Furthermore, in the step (3), MEGA5.2 software is used for gene sequence alignment, and the primer sequences of the final sequences after being aligned and spliced in the step (3) are removed and then are subjected to sequencing alignment by alignment Clustalw.
Further, in step (1), the PCR amplification procedure is:
first, pre-denaturation at 94 ℃ for 3.5 minutes; then denaturation at 94 ℃ for 35 seconds, annealing at 49 ℃ for 35 seconds, and extension at 72 ℃ for 45 seconds for 33 cycles; finally, the extension was carried out at 72 ℃ for 5 minutes, and the resulting product was stored at 4 ℃.
Further, the PCR amplification reaction system is as follows:
19. mu.L of double distilled water, 25. mu.L of PCR reaction mixture, 2. mu.L of forward primer P1, 2. mu.L of reverse primer P2, and 2. mu.L of DNA template; wherein the concentration of the forward and reverse primers is 10. mu. mol/L, and the PCR reaction mixture contains 0.1U of Taq polymerase, 500. mu. mol/L of deoxyribonucleoside triphosphate, 20mmol/L of tris-hydrochloric acid having a pH of 8.3, 100mmol/L of potassium chloride, and 3mmol/L of magnesium chloride.
Further, the sample to be detected comprises a fresh or dry product, a processed product or a powder sample, a whole or partial insect body, a pupa or a larva or an adult of the insect medicinal material to be identified.
The invention also provides application of the DNA barcode standard detection fragment in identifying species of the Vespa mandarinia and identifying traditional Chinese medicine materials.
The invention discloses the following technical effects:
compared with the traditional morphological identification method, the method has extremely remarkable beneficial effects, including: (1) the DNA bar code standard detection gene sequence and the PCR amplification primer thereof for identifying the wasps aurantiaca are provided for the first time, so that the rapid identification of non-adult state, imago and counterfeit products of the insect medicinal material processed products, powdery samples, incomplete polypides, pupas or larvae and the like is realized; (2) overcomes the defects in the prior art as follows: the larvae of the hornet are required to be cultured into adults for identification, so that the time consumption is long; the incomplete processed insect medicinal material products and insect body powder can not be detected basically; identifying the hornet by the traditional taxonomy method requires a professional technician who grasps the morphological taxonomy of the hornet insects to identify the medicinal materials; (3) the DNA bar code for identifying the wasp hornet is a CO II gene fragment, has the characteristics of universality, easiness in amplification and easiness in comparison, and can realize quick and accurate identification of the wasp hornet; (4) the PCR amplification program and the reaction system provided by the invention have high repeatability, and the stability is good after multiple tests; the key technology is easy to master, the method is simple, convenient, reliable and fast, the identification efficiency is greatly improved, and enterprises can conveniently implement the quality control of crude drugs and raw material drugs in large-scale production; (5) the molecular identification method provided by the invention fundamentally solves the problem that the current hornet is difficult to quickly and accurately identify, and has important significance for the standard management of wasp wine and other wasp products.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a diagram showing the electrophoretic identification of the PCR amplification result of the CO II gene collected from Wasp. aureodacea of Delhong, Yunnan; wherein, lane 1 is a negative control, lane 2 is a PCR amplification product of the larvae of the hornet, lane 3 is a PCR amplification product of the imago of the hornet, lane 4 is a PCR amplification product lane of the processed products of the imago of the hornet, lane 5 is a PCR amplification product of the positive control, and lane M is a DNA standard molecular scalar D2000DNA Ladder band;
FIG. 2 is an agarose gel electrophoresis image of the results of the specificity detection; wherein, lane M is DNA standard molecule scalar D2000DNA Ladder strip, lane 1 is the negative control, lane 2 is the PCR amplification product of the whole hornet medicinal material, lane 3 is the PCR amplification product of the broken polypide body of the hornet medicinal material, lane 4 is the PCR amplification product of the whole periplaneta americana medicinal material, lane 5 is the PCR amplification product of the broken polypide body of the periplaneta americana medicinal material, lane 6 is the PCR amplification product of the positive control.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.
The Vespa mandarinia Smith in the invention refers to Insecta of Insecta, Hymenoptera, Vespiidea of Vespidae, Vespidae of Vespidae, and Vespa mandarinia Smith (Vespa mandarinia Smith).
According to the comparison result of a GenBank database, no sequence which is the same as the 260bp gene sequence is found in the Vespa mandarina and the related species thereof, and the CO II gene sequence can be found by comparing the CO II gene sequence with the research result of the predecessor searched in the GenBank by using a BLAST program, so that the Vespa mandarina sample to be detected can correspond to the corresponding species and sequence one by one. At the intraspecies level, the hornet CO II gene shows very high homologous similarity (similarity is 98% -100%); the CO II gene of the wasp hornet is obviously different from the CO II genes of other species. Therefore, the method for identifying DNA barcode molecules of the Vespa mandarinia is beneficial to realizing the rapid and accurate identification of the Vespa mandarinia and shortening the identification time. Thus, the present invention has been completed.
Example 1 acquisition of DNA barcode Standard Gene sequence for identifying Vespa mandarina
1. Collecting, identifying and storing sample to be tested
The wasp sample to be tested is collected in Delhong City, Yunnan province, and the sample is morphologically identified as Vespa mandaria Smith by professor of the board institute of Kunming animals, Chinese academy of sciences. After the identification, the sample is soaked in absolute ethyl alcohol and frozen in a freezer at-20 ℃.
2. Laboratory instruments and reagent preparation
2.1 laboratory instruments and reagents
HWS12 model constant temperature electric heating constant temperature water bath (shanghai-constant technology ltd., serial No. 131022035);
SIGMA1-14ED centrifuge (SIGMA, germany, serial No. 133828);
DYCP-31DN model electrophoresis apparatus (six instruments, manufactured in Beijing, under lot number 20130816);
DYY-7C type electrophoresis apparatus power supply (six instruments factories of Beijing, serial No. 107C/20-04);
a microwave oven (lotau electronics (tianjin) electric limited, serial No. 108TA 102133);
10 μ L sample application gun (dalong xing laboratory instruments (beijing) ltd., serial No. HU 03523);
20 μ L sample gun (dalong xing laboratory instruments (beijing) ltd., serial No. 9071135);
1000. mu.L of a sample application gun (Dalongxing laboratory instruments (Beijing) Co., Ltd., serial number DS 69142);
5mL of a sample application gun (Darongxing laboratory instruments (Beijing) Co., Ltd., serial No. YE4A 180788);
XW-80A type vortexer (hamin medical instruments factory, lot No. 201402, haimen);
MyCycler Thermal Cycler type PCR instrument (Berle (BIO-RAD) Life medicine products, Inc., serial number 580BR 12204);
tris (Beijing Solarbio Science & Technology co.ltd, analytical purity);
SDS (Beijing Solarbio Science & Technology co.ltd, analytical purity);
NaCl (Tianjin Kango chemical reagent science and technology Co., Ltd., lot No. 20130307);
EDTA (Tianjin Kanghami chemical reagent science and technology Co., Ltd., batch No. 0100927);
balance phenols (Tianjin tertiary biological products science and technology Limited liability company, lot number 20130913);
chloroform (Yunnan pharmaceutical Co., Ltd, lot number 20100604);
isoamyl alcohol (Shigaku chemical Co., Ltd., lot No. 1207312);
absolute ethanol (Renjin Chemicals, Inc., Tianjin, lot number 20130121);
glacial acetic acid (Tianjin Ruiki chemical Co., Ltd., lot No. 20110704);
rnase a (tiangen biochemical technology (beijing) ltd, lot No. M1806);
6 XDNA loading Buffer (Tiangen Biochemical technology (Beijing) Co., Ltd., batch No. M1315);
proteinase K (tiangen biochemistry technology (beijing) ltd., lot number M2011);
2 × Taq PCR MasterMix (Tiangen Biochemical technology, Beijing, Ltd., batch No. M1805);
d2000DNA Ladder (Beijing Soilebao Tech Co., Ltd.);
agarose (Agarose LE) (Tiangen Biochemical technology, Beijing, Ltd., batch No. K0108).
2.2 preparation of reagents
2.2.1 homogenization buffer
Consists of 8 parts of solution A, 1 part of solution B and 1 part of solution C.
Solution A: tris 0.05 mol/L (mol/L); NaCl 0.1 mol/L; EDTA 0.1 mol/L; pH is 7.0-8.0;
and B, liquid B: 5% SDS;
and C, liquid C: 2 mg/mL (mg/mL) proteinase K.
2.2.2 preparation of electrophoresis buffer 50 XTAE
The mixture was dissolved in 242 g of Tris, 57.1mL of glacial acetic acid, and 100mL of 0.5mol/L EDTA (pH 8.0).
3. Total DNA extraction and template preparation
Firstly, preprocessing a sample to be detected: to avoid contamination, the abdomen was left out and DNA was extracted only from the head or chest; the sample was soaked in 75% alcohol for 3 hours, then immersed in pure water for 3 hours, and then rinsed with pure water. After pretreatment, the sample is cut into small pieces by sterilized surgical scissors, 50 mg of the sample is digested by SDS-proteinase K, the total genomic DNA in the sample is extracted by a balanced phenol-chloroform method, and the sample is stored at the temperature of minus 20 ℃ for later use.
3.1 grinding
A proper amount of samples are quickly cut into pieces and placed in a mortar, liquid nitrogen is added, the materials are quickly ground into powder, the powder is weighed and respectively placed into centrifuge tubes, and generally, 20-200 mg of samples are added into each centrifuge tube.
3.2 digestion
Adding 480 microliters of the solution A, 60 microliters of the solution B and 60 microliters of the solution C into each centrifuge tube, uniformly mixing by vortex, and placing in a water bath at 56 ℃ for 1-3 hours until the mixed solution is digested clearly.
3.3 phenol extraction
Adding equivoluminal balance phenol into the mixed solution, slowly inverting for ten times, shaking vigorously, centrifuging at 6000r/min for 10 min in a desk-top high-speed centrifuge, and collecting supernatant. Repeating the above steps until no white protein layer is observed at the interface of the aqueous phase and the phenol phase, and collecting the supernatant.
3.4 chloroform isoamyl alcohol (24:1) extraction
Adding equal volume of chloroform and isoamyl alcohol (24:1) into the supernatant, slowly reversing the mixture for ten times, centrifuging the mixture for 10 minutes at 8000r/min on a desk-top high-speed centrifuge, and taking the supernatant.
3.5 precipitation of DNA
The DNA was precipitated by adding 2 Xvolume of cold absolute ethanol (previously placed in a refrigerator at-20 ℃ C.) to the supernatant, left in the refrigerator for 10 minutes, centrifuged at 12000r/min for 10 minutes, and the supernatant was discarded.
3.6 washing of DNA
The centrifuge tube with the precipitate left was added with 1ml of 70% cold ethanol to wash the DNA, centrifuged at 10000r/min for 5 minutes in a desk-top high-speed centrifuge, and the supernatant was decanted.
3.7 dissolving with ultrapure water or TE buffer
DNA was dissolved in 10. mu.l of TE buffer per 10 mg of sample.
3.8 preparation of 0.7% agarose gel
Weighing 0.14 g agarose in a triangular flask, adding 1 XTAE solution, heating and dissolving in a microwave oven, slightly cooling, adding 20 microliter ethidium bromide solution (1 mg/ml), pouring into a mold to prepare agarose gel, and cooling for 50-60 min. The shaped agarose gel was placed in an electrophoresis tank and electrophoresis buffer was injected slightly above the gel.
3.9 taking 5 microliter of DNA solution in each centrifuge tube on the preservative film, then taking 5 microliter of loading buffer solution to mix with the DNA solution, and adding the sample. Mu.l of DNA Marker (D2000DNA Ladder Marker) was applied.
4. Primer synthesis
Forward primer P1: 5'-ATT GGA CAT CAA TGA TAT TGA-3' and reverse primer P2: 5'-CCA CCAATT TCT GAA CAT TGA CCA-3' manufactured by Token's Biotechnology engineering (Shanghai) Inc. and verified by sequencing.
5. PCR amplification
5.1PCR reaction System
With double distilled water (ddH)2O) the extracted total DNA was diluted to 0.5 micrograms/microliter (μ g/μ L).
And performing PCR amplification on the CO II gene fragment by using the extracted total DNA of the insect medicinal material to be identified as a template and using DNA barcode primers P1 and P2. PCR amplification was performed in a 200. mu.L PCR reaction tube with a total reaction volume of 50. mu.L, containing the following reagents:
the PCR reaction mixture contained 0.1U of Taq polymerase, 500. mu. mol/L dNTP, 20mmol/L Tris-HCl (pH 8.3), 100mmol/L KCl, and 3mmol/L MgCl2。
5.2 amplification procedure
First, pre-denaturation is carried out for 3.5 minutes at 94 ℃; then denaturation at 94 ℃ for 35 seconds, annealing at 49 ℃ for 35 seconds, extension at 72 ℃ for 45 seconds, and amplification for 33 cycles; finally, the extension was carried out at 72 ℃ for 5 minutes, and the resulting product was stored at 4 ℃.
6. PCR amplification product detection and gene sequence determination
Taking 2 μ L of PCR amplification product, using 1.2% agarose gel electrophoresis (90V voltage, electrophoresis for 40 minutes), ethidium bromide staining and placing in a gel imaging system for detection, and entrusting the PCR amplification product with the strip position of 250-500bp for sequencing. BLAST test is carried out on the sequence obtained by sequencing in NCBI, the obtained CO II gene segment is determined, and the specific sequence of SEQ ID NO.1 with the primer sequences at two ends removed is as follows:
AAAAAAATACCAGGACGAATTATTTGAATAAATGTTTGATTTATTCGTCCTGGAGTAGCATCAATTTTAATTCCTAAAGCAGGGACAGCTCAGGAATGAATTACATCTGTGGATGTAGTTAATACTCGAATAGGGATATCAAATGGAAGAATTAATCGATTATCTACATCTAGGAGTCGAAATTGGGATTGATTTAGTTTTTTATATGGGATTATATAAGAGTCGAATCTGATATTTTTATAATCTGATAATTCATATCT, respectively; the sequence length of the CO II gene fragment SEQ ID NO.1 is 260 bp.
7. Conclusion of the experiment
BLAST comparison of the DNA sequence SEQ ID NO.1 in GenBank shows that no species with sequence similarity of 90% or more are found, and the gene sequence with sequence similarity of 84% or less is not from wasp hornet. This can result in: the DNA bar code COII gene sequence SEQ ID NO.1 is a gene fragment sequence specific to the Vespa mandarinia and can be used for accurately identifying an insect medicinal material Vespa mandarinia.
Example 2 identification of samples of different forms and processed products of Vespa mandarinia
1. Collecting and storing a sample to be detected: taking the pupae and imagoes of the hornet wasps purchased in Dehong City of Yunnan province as samples to be detected, taking part of imagoes to be quickly dried by an oven to be processed into imagoes, and taking the imagoes of the hornet wasps acquired in the field of Dehong City of Yunnan province as positive control samples. All samples were morphologically identified as Vespa mandaria Smith (Vespa mandaria Smith) by professor Dthimnaum, the institute of Kunming animals, academy of sciences, China. After the identification, the sample is soaked in absolute ethyl alcohol and frozen in a freezer at-20 ℃.
2. Preparing experimental instruments and reagents: the same as in example 1.
3. DNA extraction and template preparation: firstly, a positive control sample and a sample to be detected are pretreated. The sample was subjected to pretreatment, DNA extraction and DNA template preparation in the same manner as in example 1.
4. Primer synthesis: the same as in example 1.
5. And (3) PCR amplification: the same as example 1, and a negative control (the reaction system does not contain a DNA template and water is used instead) and a positive control are set.
6. And (3) detecting a PCR amplification product: mu.L of the PCR amplification product was subjected to electrophoresis on a 1.2% agarose gel (90V for 40 minutes) and stained with ethidium bromide. Gel imaging system detection, electropherogram see figure 1: wherein, lane 1 is a negative control, lane 5 is a PCR amplification product of a positive control, lanes 2 to 4 are PCR amplification products of a sample to be detected (lane 2 is a PCR amplification product of a hornet larva, lane 3 is a PCR amplification product of a hornet imago, lane 4 is a PCR amplification product of a hornet imago blast product), a band with the size of 250bp to 500bp is detected, and the band and the positive control are positioned at the same position.
7. Gene sequence determination: trusting the Huada gene to sequence the PCR amplification product, and the sequencing result shows that: the homology of the larva, the adult, the processed product of the adult and the positive control sample with the CO II gene sequence shown as SEQ ID NO.1 is 99 percent, so that the sample to be detected can be judged to be the hornet, and the result is the same as the traditional morphological identification result.
8. The results show that: the DNA barcode standard gene sequence SEQ ID NO.1 can quickly and effectively identify species of the hornet wasps in different forms and processed products, and makes up for the defects of the traditional morphological method.
Example 3 specific detection of DNA barcode molecular identification method of Vespa mandarinia
1. Collecting and storing sample to be tested
The samples to be tested are the hornet medicinal material purchased in Dehong City of Yunnan province and the periplaneta americana medicinal material purchased in Baoshan city of Yunnan province. The samples were morphologically identified by professor yang zionaire university, professor kunming, and were identified as wasps aurantiaca (Vespa mandarinia smith) and Periplaneta americana (Periplaneta americana linn.), and morphologically identified adult wasps aurantiaca collected in the field of deuteron city, Yunnan province was taken as a positive control sample. Wiping a sample to be tested with 75% alcohol for sterilization, taking a part of the sterilized head or chest muscle tissue of the sample to be tested into a centrifuge tube of 1.5mL, soaking the muscle tissue with absolute ethyl alcohol, and storing in a refrigerator of-20 ℃.
2. Preparing experimental instruments and reagents: the same as in example 1.
3. DNA extraction: the genomic DNA of the sample to be tested was extracted with a blood/cell/tissue genomic DNA extraction kit (centrifugal column type) (manufactured by Tiangen Biochemical technology, Inc., Beijing, version number DP121109, catalog number DP304) and stored in a freezer at-20 ℃ for future use.
4. Primer synthesis: the same as in example 1.
5. And (3) PCR amplification: the same as example 1, and a negative control (the reaction system does not contain the template, and water is used instead of the template) and a positive control are set.
6. And (3) detecting a PCR amplification product: mu.L of the PCR amplification product was separated by electrophoresis (90V for 45 minutes) on an ethidium bromide-stained agarose gel at a concentration of 1.0%. Then detecting with ultraviolet gel imaging system, and obtaining electrophoresis pattern with reference to the attached figure 2: wherein, the lane 1 is a negative control, the lane 6 is a PCR amplification product of a positive control, the lanes 2 to 5 are PCR amplification products of a sample to be detected (the lane 2 is a PCR amplification product of a hornet's whole worm medicinal material, the lane 3 is a PCR amplification product of a hornet's medicinal material broken worm body, the lane 4 is a PCR amplification product of a periplaneta americana's whole worm medicinal material, and the lane 5 is a PCR amplification product of a periplaneta americana's medicinal material broken worm body), a band with the size of 250bp to 500bp is detected, and the band and the positive control are positioned at the same position.
7. Trusting Huada gene to sequence the PCR amplification product, and comparing the sequencing result with the DNA barcode standard gene shown in SEQ ID NO.1 provided in the embodiment 1: the homologies of the whole hornet medicinal material and the broken polypide of the hornet and the SEQ ID NO.1 are respectively 99 percent, and the homologies of the whole hornet medicinal material and the broken polypide of the periplaneta americana medicinal material and the SEQ ID NO.1 are respectively 78 percent and 77 percent; and carrying out BLAST search on the sample to be detected of the periplaneta Americana medicinal material on NCBI, and finding that the detected sequences are all periplaneta Americana gene sequences.
8. The results show that: the DNA bar code standard gene sequence SEQ ID NO.1 is a unique gene sequence of the Vespa aurantiaca and can be used for accurately identifying the Vespa aurantiaca, and the defects of the traditional morphological method are overcome.
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> university of university
<120> DNA barcode standard detection fragment for identifying wasp hornet and application thereof
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>260
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
aaaaaaatac caggacgaat tatttgaata aatgtttgat ttattcgtcc tggagtagca 60
tcaattttaa ttcctaaagc agggacagct caggaatgaa ttacatctgt ggatgtagtt 120
aatactcgaa tagggatatc aaatggaaga attaatcgat tatctacatc taggagtcga 180
aattgggatt gatttagttt tttatatggg attatataag agtcgaatct gatattttta 240
taatctgata attcatatct 260
<210>2
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
attggacatc aatgatattg a 21
<210>3
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ccaccaattt ctgaacattg acca 24
Claims (9)
1. A DNA barcode standard detection fragment for identifying Vespa mandarinia is characterized in that the nucleotide sequence of the DNA barcode standard detection fragment is shown as SEQ ID No. 1.
2. The DNA barcode standard detection fragment of claim 1, wherein the DNA barcode standard detection fragment is a Vespa mandarinia CO II (cytochrome c oxidase subunit II) gene fragment.
3. A primer pair for identifying kumquat, wherein the primer pair is used for amplifying the DNA barcode standard detection fragment of claim 1 or 2; in the primer pair, the nucleotide sequence of the forward primer is shown as SEQ ID No.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID No. 3.
4. A method for identifying wasps by using the DNA barcode standard detection fragment of any one of claims 1 to 2, comprising the steps of:
(1) extracting DNA of a sample to be detected, taking the DNA of the sample to be detected as template DNA, and carrying out PCR amplification by using the primer pair of claim 3 to obtain a COI gene segment;
(2) carrying out agarose gel electrophoresis analysis on the obtained CO I gene fragment, observing under an ultraviolet lamp after staining by ethidium bromide, judging a result according to the size of an amplification product, and sequencing a specific target band;
(3) and (3) after the sequencing result is subjected to proofreading and sequence splicing, removing the primer sequence, comparing with the DNA barcode standard detection fragment, and if the homology is 98% or more, judging that the sample to be detected is the source of the wasp ringgoldiana.
5. The method according to claim 4, wherein in step (1), a negative control and a positive control are provided during PCR amplification, and the positive control is a PCR reaction product containing the DNA barcode standard detection fragment.
6. The method of claim 4, wherein in step (1), the PCR amplification procedure is:
first, pre-denaturation at 94 ℃ for 3.5 minutes; then denaturation at 94 ℃ for 35 seconds, annealing at 49 ℃ for 35 seconds, and extension at 72 ℃ for 45 seconds for 33 cycles; finally, the extension was carried out at 72 ℃ for 5 minutes, and the resulting product was stored at 4 ℃.
7. The method of claim 4, wherein the PCR amplification reaction system is:
19 mu.L of double distilled water, 25 mu.L of PCR reaction mixture, 2 mu.L of forward primer P1, 2 mu.L of reverse primer P2 and 2 mu.L of DNA template; wherein the concentration of the forward and reverse primers is 10. mu. mol/L, and the PCR reaction mixture contains 0.1U of Taq polymerase, 500. mu. mol/L of deoxyribonucleoside triphosphate, 20mmol/L of tris-hydrochloric acid having a pH of 8.3, 100mmol/L of potassium chloride, and 3mmol/L of magnesium chloride.
8. The method of claim 4, wherein the sample to be tested comprises a fresh or dried sample, a processed or powdered sample, whole or partial insect bodies, pupae or larvae or adults of the insect drug to be identified.
9. The use of the DNA barcode standard detection fragment of any one of claims 1 or 2 for species identification of Vespa mandarina and traditional Chinese medicine identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010632909.4A CN111647667A (en) | 2020-07-02 | 2020-07-02 | DNA barcode standard detection fragment for identifying wasp hornet and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010632909.4A CN111647667A (en) | 2020-07-02 | 2020-07-02 | DNA barcode standard detection fragment for identifying wasp hornet and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111647667A true CN111647667A (en) | 2020-09-11 |
Family
ID=72345832
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010632909.4A Pending CN111647667A (en) | 2020-07-02 | 2020-07-02 | DNA barcode standard detection fragment for identifying wasp hornet and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111647667A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008099644A (en) * | 2006-10-20 | 2008-05-01 | Suntory Ltd | Method for establishing merkmal for identifying insect in classification level |
| CN105525027A (en) * | 2016-02-22 | 2016-04-27 | 中国农业科学院蜜蜂研究所 | SNP marker as well as application and detection method thereof |
| CN109136389A (en) * | 2018-09-03 | 2019-01-04 | 大理大学 | A kind of DNA bar code standard detection segment CO II, kit and its application method identifying American cockroach |
-
2020
- 2020-07-02 CN CN202010632909.4A patent/CN111647667A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008099644A (en) * | 2006-10-20 | 2008-05-01 | Suntory Ltd | Method for establishing merkmal for identifying insect in classification level |
| CN105525027A (en) * | 2016-02-22 | 2016-04-27 | 中国农业科学院蜜蜂研究所 | SNP marker as well as application and detection method thereof |
| CN109136389A (en) * | 2018-09-03 | 2019-01-04 | 大理大学 | A kind of DNA bar code standard detection segment CO II, kit and its application method identifying American cockroach |
Non-Patent Citations (9)
| Title |
|---|
| CHEN,P.Y.等: "Vespa mandarinia mitochondrion, complete genome", 《GENBANK》 * |
| SAEED MOHAMADZADE NAMIN等: "Genetic diversity of genus Vespa including an invaded species of V. velutina", 《JOURNAL OF ASIA-PACIFIC ENTOMOLOGY》 * |
| 付海滨等: "mtDNA COⅡ基因序列应用于赤眼蜂分子鉴定的研究", 《中国农业科学》 * |
| 张中印等: "《中国实用养蜂学》", 31 October 2003, 河南科学技术出版社 * |
| 彩万志等: "《普通昆虫学 第2版》", 30 June 2011, 中国农业大学出版社 * |
| 范旭蕾: "长黄胡蜂属比较线粒体基因组学与系统发育研究", 《中国优秀博硕士学位论文全文数据库(硕士)基础科学辑》 * |
| 许凯歌等: "药用昆虫金环胡蜂及其混伪品DNA条形码鉴别研究", 《世界科学技术-中医药现代化》 * |
| 诸葛群主编: "《养蜂法 第7版》", 31 March 2002, 中国农业出版社 * |
| 谭垦等: "亚洲部分地区东方蜜蜂mtDNA多态性研究", 《云南农业大学学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111635949B (en) | DNA barcode standard detection fragment for identifying wasp with yellow veins and application thereof | |
| CN107828914B (en) | RAA constant temperature fluorescence detection method and reagent for Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) | |
| CN108192965B (en) | Method for detecting heterogeneity of mitochondrial genome A3243G locus | |
| CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| CN109136389A (en) | A kind of DNA bar code standard detection segment CO II, kit and its application method identifying American cockroach | |
| CN107365839B (en) | Primer for identifying deer animals and application thereof | |
| CN107365840B (en) | Cervidae animal rapid identification kit based on DNA bar code and application thereof | |
| CN104846082B (en) | A kind of Dermestidae insect genes barcode detection kit | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN111647667A (en) | DNA barcode standard detection fragment for identifying wasp hornet and application thereof | |
| CN107365766B (en) | Method for extracting RNA of mould spore by mechanical crushing method | |
| CN112813176B (en) | SNP locus for genetically improving chicken meat quality traits and application method thereof | |
| CN111534606A (en) | DNA barcode standard detection fragment CO II for identifying wasp with yellow veins and application thereof | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN112980979A (en) | Fusobacterium nucleatum fluorescent quantitative detection kit and preparation method and detection method thereof | |
| CN110734985B (en) | Method for identifying cotton aphidiidae and stipes equinus punctatus | |
| CN109385487B (en) | Recombinase-mediated amplification isothermal detection method and kit for American ginseng as Chinese medicinal herb | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| CN110894544A (en) | RAA constant temperature fluorescence detection method and reagent for Salmon Alphavirus (SAV) | |
| CN114672571B (en) | Specific primer pair for identifying processed auxiliary material turtle blood, kit and application | |
| CN110669769A (en) | Tridacna immunity-related SAA gene and application thereof in preparation of tridacna pathological detection reagent | |
| CN110592267A (en) | RAA constant-temperature fluorescence detection method and reagent for Spring Viremia of Carp Virus (SVCV) | |
| CN110184371B (en) | Specific primer for detecting acinetobacter cutaneus as well as method and application thereof | |
| CN108676862A (en) | The identification method of Chinese medicine peach kernel based on fragment length polymorphism PCR | |
| CN116769927B (en) | Introgression gene, primer, method and application for identifying silver carp in Changfeng |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200911 |
|
| RJ01 | Rejection of invention patent application after publication |