CN111607589A - System construction method for obtaining large amount of wax insect dsRNA in vitro - Google Patents

Abstract

The invention relates to a system construction method for obtaining a large amount of wax insect dsRNA in vitro, which comprises the steps of firstly extracting the total RNA of the wax insect and carrying out PCR amplification after the reverse transcription into cDNA, carrying out double enzyme digestion on an amplification product and an L4440 carrier plasmid respectively, connecting products after the double enzyme digestion, transforming the obtained recombinant plasmid into an escherichia coli competent cell HT115(DE3) strain, coating a solid culture medium to screen a single colony, and then carrying out shaking table culture on the single colony liquid to OD₆₀₀And (5) =0.38-0.42, adding IPTG (isopropyl thiogalactoside) for induction, and concentrating the bacterial liquid for RNA interference experiments. The invention clones the target containing the wax insect of the escherichia coli by single cellThe gene is also transferred to the escherichia coli through self metabolism and mass self-reproduction and replication to obtain a mass of bacterial liquid containing dsRNA of the fraxinus chinensis gene, and the bacterial liquid containing the dsRNA is sprayed to fraxinus chinensis larvae and enters the body from the surface of the fraxinus chinensis larva body to effectively interfere the expression quantity of the target gene.

Description

System construction method for obtaining large amount of wax insect dsRNA in vitro

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a system construction method for obtaining a large amount of wax insect dsRNA in vitro.

Background

Ericerus pela, also known as wax insect, belongs in its classification to the genus Ericerus (Channnes, 1819) of the superfamily Hemiptera (Hemipherera) coccoid (Coccoidea) Ericerus (Channnes). The wax insect is a scale insect with great economic value, the larva of the 2-instar male wax insect lives on the branches of a host plant and secretes a white waxy covering, and wax secreted by the insect becomes white wax (called Cerachennensis, also called insect white wax), namely the secretion of the wax insect, which is a special product in China. The white wax is a natural high molecular compound, has high melting point and is chemically stable. Has the characteristics of moisture resistance, lubrication, glazing and the like, is an important chemical raw material, and is widely applied to the industries of chemical industry, machinery, food, pharmaceutical industry, cosmetics, agriculture and the like.

RNA interference (RNAi) refers to the phenomenon in which double-stranded RNA (dsRNA) induces degradation of homologous mrnas in eukaryotes, thereby silencing the expression of a target gene. The dsRNA transfection mainly comprises methods such as injection, feeding, soaking, virus infection, gene gun and the like. However, if the study object is too small to move, the infection modes of feeding, soaking and body surface absorption are in a situation that the dosage of dsRNA prepared by the kit is insufficient.

The insects in the research are wax worms, small in size and piercing-sucking mouthparts, can not move in most of time by sucking the sap of host rhus chinensis, and can be infected by a body surface skin absorption mode. Because the body surface absorbs, the quantity is big, and dsRNA is unstable in the external world, easily degrades, needs to spray the body surface skin of the wax insect many times and absorbs, and the kit synthesizes that dsRNA output is lower (ul measurement), is not enough to be used for the transfection mode of spraying, and a large amount of kit synthesis makes the experiment cost high, consequently in some RNA interference experiments, how to prepare high output dsRNA is the problem that gene engineering needs to solve.

Disclosure of Invention

In the RNAi transfection process, due to objective reasons, research objects cannot use micro-dose transfection modes such as a gene gun and the like, but in vitro transfection, large doses of dsRNA are needed, so that the invention provides a system construction method for obtaining the cercidiphyllum japonicum dsRNA in vitro in large quantities, and the method can provide reference for obtaining a large amount of dsRNA at low cost.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

a system construction method for obtaining largehead wax worm dsRNA in vitro in large quantity comprises the following steps:

extracting fraxinus chinensis total RNA, carrying out reverse transcription on the fraxinus chinensis total RNA to obtain cDNA, carrying out PCR amplification, carrying out SacI and SalI double digestion on an amplification product and an L4440 carrier plasmid respectively, and carrying out overnight connection on the product after the double digestion at 4 ℃ by using T4 ligase to obtain a recombinant plasmid 302a1-L4440 containing a 302a1 gene fragment;

step (2), the 302a1-L4440 recombinant plasmid obtained in the step (1) is transformed into an escherichia coli competent cell HT115(DE3) strain, and a solid culture medium is coated to screen a single colony, so that 302a1-L4440-HT115 thalli are obtained;

step (3) of shaking-culturing the 302a1-L4440-HT115 bacterial cell liquid obtained in step (2) to OD₆₀₀Adding IPTG (isopropyl thiogalactoside) to induce 0.38-0.42 to obtain dsRNA bacteria containing fraxinus 302a1 gene fragmentLiquid;

and (4) concentrating the dsRNA bacterial liquid containing the fraxinus 302a1 gene fragment obtained in the step (3) for RNA interference experiments.

Further, it is preferable that the total RNA of Ceriporia chinensis (L.) Skeels comprises the total RNA of Ceriporia chinensis (L.) Skeels 302a1 gene.

Further, it is preferable that in the step (1), the primer 302a1 gene (primer name is ECEGT01) is designed to contain SacI and SalI double enzyme cutting sites by using a PCR amplification method, wherein

ECEGT01-F：5'-atgagctccgctctggtataaattcatttggac-3'(SEQ ID NO.6)；

ECEGT01-R：5'-atgtcgacgcctgttgaatcattatcactccta-3'(SEQ ID NO.7)。

Further, preferably, in step (1), the PCR amplification system is:

the PCR amplification procedure was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extending for 5min at 72 ℃, and storing at 4 ℃.

Further, it is preferable that in the step (1), the condition system of enzyme digestion is as follows:

the time for enzyme digestion was 10min at 37 ℃.

Further, it is preferred that the linker system is:

further, preferably, the ligated product is transformed into competent cell DH 5A, and the plasmid is extracted after the single colony growth by coating, screening and culturing in SOC solid medium containing 100. mu.g/mL ampicillin to obtain 302a1-L4440 recombinant plasmid. The method for expanding the propagation is not particularly limited, but preferably, after the single colony grows out, the single colony is picked up by an inoculating loop and cultured in a centrifuge tube of SOC liquid culture medium containing 100 mug/mL ampicillin for 10 hours by a shaking table to extract the plasmid.

Further, it is preferable that the specific method of step (2) is: transforming the 302a1-L4440 recombinant plasmid obtained in the step (1) into an Escherichia coli competent cell HT115(DE3) strain, coating the strain on an SOC solid culture medium containing 100 mu g/mL ampicillin and 50 mu g/mL tetracycline, culturing for 12h in a dark place, and picking a single colony to obtain 302a1-L4440-HT115 thalli;

further, it is preferable that the specific method in the step (3) is to shake-culture the 302a1-L4440-HT115 cells in SOC liquid medium containing 100. mu.g/mL ampicillin and 50. mu.g/mL tetracycline at 37 ℃ for 10 to 12 hours in the absence of light, and then shake-culture them in 2 × YT liquid medium containing 75. mu.g/mL ampicillin and 12.5. mu.g/mL tetracycline to OD₆₀₀And (3) adding IPTG (isopropyl thiogalactoside) to induce and culture for 3-4 h to obtain a dsRNA bacterial liquid containing the fraxinus chinensis 302a1 gene fragment.

The invention provides a system construction method for obtaining dsRNA in a single cell cloning mode in large quantity, which mediates RNAi of wax insect to cause target gene expression silencing. According to the method, wax insect RNAi interference is taken as an example, wax insect cDNA is taken as a template to obtain a wax insect 302a1 target gene fragment by a PCR mode, sticky ends are formed at two ends of the gene fragment through restriction enzyme modification, and the sticky ends are connected with a linear L4440 plasmid formed through restriction enzyme modification in the same mode to form a plasmid 302a1-L4440 recombinant plasmid containing the wax insect target gene fragment. The 302a1-L4440 recombinant plasmid is transformed into an escherichia coli competent HT115(DE3) strain to form a 302a1-L4440-HT1115 strain, the combined strain has ampicillin and tetracycline resistance at the same time, RNA hydrolase cannot be synthesized, and the combined strain contains a fraxinus chinensis 302a1 gene fragment, so that the escherichia coli can be cultured and propagated by a single-cell cloning mode and an SOC liquid culture medium (containing ampicillin and tetracycline) in a shaking table, dsRNA can be generated in the propagation process through IPTG induction, a large amount of dsRNA containing the fraxinus chinensis 302a1 gene fragment can be obtained, the recombinant escherichia coli liquid is collected, and the bacterium liquid is diluted and then directly sprayed on fraxinus chinensis larva stage worm bodies. The method can clone escherichia coli containing the fraxinus 302a1 target gene through single cells, obtain bacterial liquid containing a large amount of fraxinus gene fragment dsRNA through self secondary metabolism and self-reproduction replication of the escherichia coli, spray the fraxinus dsRNA bacterial liquid containing the fraxinus gene fragment on fraxinus larvae, enter the body from the surface of the fraxinus insect, effectively interfere the expression amount of the target gene, and provide reference for the RNAi transfection approach that a large amount of dsRNA is synthesized and enters the body through the body surface because the insect has too small volume and no chewing mouthparts and can not adopt micro-injection insect types in the RNAi transfection process.

Compared with the prior art, the invention has the beneficial effects that:

according to the invention, in the RNA gene function verification of the fraxinus chinensis, the single-cell clone microorganism escherichia coli is introduced for the first time, so that the genetic material of the fraxinus chinensis contains a 302a1 gene segment, the secondary metabolism contains dsRNA of a 302a1 gene segment, no RNA hydrolase exists, and the dsRNA containing a 302a1 gene segment is enriched in the propagation and self-replication processes of the escherichia coli. When the research object is too small, such as the white wax worm of the research has the characteristics of small volume and immobility, and the dsRNA needs to be sprayed on the body surface or needs to be soaked, fed and other transfection modes with large dsRNA consumption in the RNAi transfection process, the method can provide a large amount of dsRNA, and is easy to popularize and apply.

Taking a white wax insect spraying experiment as an example, a conventional RNAi experiment adopts kit synthesis, the amount of dsRNA synthesized in one time is 20ul, the concentration is 0-1000 ug/ml, (the concentration is related to the proficiency of operators), and the ultralow temperature storage of the synthesized dsRNA can not exceed 1 year; the cost for synthesizing 1ul dsRNA by using the kit is 3-5 yuan per ul, namely the cost of 1ml is 3000-5000 yuan; taking one gene as an example, 60ml is needed in one in-vitro spraying experiment, so that the synthesis of the kit is between 18 and 30 ten thousand yuan, and the cost is too high to be advisable; the cost of each gene experiment of the large intestine rod of the unicellular cloned microorganism is between 800 and 1500 yuan, the escherichia coli strain which is cloned and transformed can be preserved at the ultralow temperature for 2 to 3 years, and can be expanded and cultured according to the requirements of the experiment, and can still be activated, recovered and reused at the later stage of the ultralow temperature preservation, thereby greatly reducing the experiment cost.

Drawings

FIG. 1 is a schematic diagram of a construction process of obtaining dsRNA in vitro in large quantities;

FIG. 2 is an electrophoretogram of PCR products; wherein a is a PCR amplification product, and the band is between 250bp and 500 bp; m is mark; b to f different target genes are compared, and the invention is not excessively disclosed as the invention is not influenced;

FIG. 3 is a comparative electrophoretogram before and after double digestion of L4440 plasmid; wherein, a 1: control, circular L4440 plasmid (before double digestion); b 1: linear L4440 plasmid (after double digestion); m: mark; the plasmid is annular before double enzyme digestion, so the moving speed of electrophoresis is very slow, and the linearity of the plasmid after double enzyme digestion is between 2500bp and 2000 bp;

FIG. 4 is a photograph of 302a1-L4440 recombinant plasmid transformed into Escherichia coli competent cell strain HT115(DE3) and cultured on SOC solid medium containing 100. mu.g/mL ampicillin and 50. mu.g/mL tetracycline;

FIG. 5 is an electrophoretogram before and after induction; wherein m: DNA molecule Mark; a, after induction; b, before induction.

Detailed Description

The present invention will be described in further detail with reference to examples.

It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The materials or equipment used are not indicated by manufacturers, and all are conventional products available by purchase.

Example 1

A method for obtaining a large amount of fraxinus chinensis double-stranded RNA fraxinus chinensis in vitro comprises the following steps:

extracting fraxinus chinensis total RNA, carrying out reverse transcription on the fraxinus chinensis total RNA to obtain cDNA, carrying out PCR amplification, carrying out SacI and SalI double digestion on an amplification product and an L4440 vector plasmid respectively (figure 3), and carrying out overnight connection on the product after the double digestion at 4 ℃ by using T4 ligase to obtain a recombinant plasmid 302a1-L4440 containing a 302a1 gene fragment;

step (2), the 302a1-L4440 recombinant plasmid obtained in the step (1) is transformed into an escherichia coli competent cell HT115(DE3) strain, and a solid culture medium is coated to screen a single colony, so that 302a1-L4440-HT115 thalli are obtained;

step (3) of shaking-culturing the 302a1-L4440-HT115 bacterial cell liquid obtained in step (2) to OD₆₀₀Adding IPTG (isopropyl thiogalactoside) for induction to obtain a dsRNA bacterial liquid containing the fraxinus 302a1 gene fragment;

and (4) concentrating the dsRNA bacterial liquid containing the fraxinus 302a1 gene fragment obtained in the step (3) for RNA interference experiments.

Example 2

Extracting fraxinus chinensis total RNA, carrying out reverse transcription on the fraxinus chinensis total RNA to obtain cDNA, carrying out PCR amplification, carrying out SacI and SalI double digestion on an amplification product and an L4440 vector plasmid respectively (figure 3), and carrying out overnight connection on the product after the double digestion at 4 ℃ by using T4 ligase to obtain a recombinant plasmid 302a1-L4440 containing a 302a1 gene fragment;

step (2), the 302a1-L4440 recombinant plasmid obtained in the step (1) is transformed into an Escherichia coli competent cell HT115(DE3) strain, and a solid culture medium is coated to screen a single colony, so that 302a1-L4440-HT115 thalli are obtained (figure 4);

step (3) of shaking-culturing the 302a1-L4440-HT115 bacterial cell liquid obtained in step (2) to OD₆₀₀Adding IPTG (isopropyl thiogalactoside) to induce for 3.5h when the gene is equal to 0.42, and obtaining dsRNA bacterial liquid containing the fraxinus chinensis 302a1 gene fragment;

and (4) concentrating the dsRNA bacterial liquid containing the fraxinus 302a1 gene fragment obtained in the step (3) for RNA interference experiments.

In the step (1), the fraxinus chinensis RNA comprises total RNA of fraxinus chinensis 302a1 gene.

The primers adopted by the PCR amplification are ECEGT01-F and ECEGT 01-R;

ECEGT01-F：5'-atgagctccgctctggtataaattcatttggac-3'(SEQ ID NO.6)；

ECEGT01-R：5'-atgtcgacgcctgttgaatcattatcactccta-3'(SEQ ID NO.7)；

the PCR amplification system is as follows:

the PCR amplification procedure was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extending for 5min at 72 ℃, and storing at 4 ℃.

In the step (1), the condition system of enzyme digestion is as follows:

the time for enzyme digestion was 10min at 37 ℃.

The connecting system is as follows:

the product after connection is transformed into competent cell DH5 alpha, coated, screened and cultured in SOC solid medium containing 100 mu g/mL ampicillin, and the plasmid is extracted after the grown single colony is propagated, thus obtaining 302a1-L4440 recombinant plasmid.

The specific method of the step (2) is as follows: transforming the 302a1-L4440 recombinant plasmid obtained in the step (1) into an Escherichia coli competent cell HT115(DE3) strain, coating the strain on an SOC solid culture medium containing 100 mu g/mL ampicillin and 50 mu g/mL tetracycline, culturing for 12h in a dark place, and picking a single colony to obtain 302a1-L4440-HT115 thalli;

the specific method of the step (3) is that the 302a1-L4440-HT115 thallus is put into SOC liquid culture medium containing 100 mug/mL ampicillin and 50 mug/mL tetracycline, is protected from light at 37 ℃ for 10-12h, and is then shake-cultured in 2 × YT liquid culture medium containing 75 mug/mL ampicillin and 12.5 mug/mL tetracycline to OD₆₀₀When the strain is equal to 0.42, IPTG is added for induction cultureCulturing for 3h to obtain dsRNA bacterial liquid containing the fraxinus chinensis 302a1 gene segment.

And (3) further carrying out centrifugal concentration on the thalli at 4 ℃ on the obtained bacterial liquid.

Examples of the applications

All media involved in the experiment were purchased from bio-engineering (shanghai) gmbh, where:

SOC culture medium composition: peptone 20.0 g; 5.0g of yeast powder; 0.5g of sodium chloride; magnesium sulfate heptahydrate 5.0 g; 3.6g of D-glucose.

SOC solid medium composition: SOC culture medium: 34g, agar powder: 12g, distilled water: 1L of

SOC liquid medium composition: SOC culture medium: 34g, distilled water: 1L of

SOC solid/liquid medium containing ampicillin: 1ml of the medium contained 100. mu.g of ampicillin.

SOC solid/liquid medium containing ampicillin and tetracycline: 1ml of the medium contained 100. mu.g of ampicillin and 50. mu.g of tetracycline.

2 × YT medium components: 10.0g of yeast powder; peptone 16.0 g; 5.0g of sodium chloride.

Ampicillin and tetracycline in 2 × YT liquid medium: each ml of the medium contained 75. mu.g of ampicillin and 12.5. mu.g of tetracycline.

Note: in this context "/" means "or". The 302a1 gene can be replaced by any gene that is desired to interfere with the experiment.

The invention relates to a method for obtaining a large amount of dsRNA containing fraxinus chinensis gene fragments by adopting unicellular cloned microorganisms in gene function verification of fraxinus chinensis, which is used for RNAi (ribonucleic acid interference) body surface spraying transfection of fraxinus chinensis. The invention aims at 1, exploring a system construction method for obtaining a large amount of dsRNA containing fraxinus chinensis gene segments in vitro; 2. the cost of synthesizing dsRNA by using a conventional kit in an RNAi experiment is reduced; 3. once successfully prepared, the modified plasmid containing the wax insect gene can be stored at low temperature, and downstream RNAi experiments can be repeatedly carried out. Based on the three purposes, a construction system for obtaining dsRNA in vitro is established

1 construction of recombinant vector

Extracting Ceriporia chinensis total RNA with RNA extraction kit (EZ-10Tatal RNA min-presps kit, Biotechnology (Shanghai) Co., Ltd.) by referring to kit description, and reverse transcription kit (PrimeScript)^TMRT reagent Kit with gDNA Eraser, Takara) into cDNA. Designing a primer ECEGT01-F according to the sequence of the 302a1 gene fragment: 5'-atgagctccg ctctggtataaattcatttggac-3', respectively; ECEGT 01-R: 5'-atgtcgacgcctgttgaatcattatcactccta-3' are provided. PCR amplification Using cDNA as template [ Taq PCRMaster Mix (2X, with Red Dye), Biotechnology engineering (Shanghai) Ltd]The PCR reaction system is shown in Table 1. The PCR reaction condition is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extending for 5min at 72 ℃, and storing at 4 ℃.

TABLE 1

Taq PCR Master Mix	25.0μl，
		cDNA	3.0μl，
ECEGT01-F 10μM	2.0μl，
		ECEGT01-R 10μM	2.0μl，
dH2O	18.0μl，
		Total of	50.0μl。

The results of the electrophoretic detection of the amplified fragments were between 250-500bp (FIG. 2), which is consistent with the expectation. According to the process of vector construction in FIG. 1, the recovered products of the 302a1 gene fragment gel and the L4440 vector were digested with SacI and SalI (NEB (Beijing) Co., Ltd.) in water bath at 37 ℃ for 10min, the reaction system is shown in Table 2, the products were separately recovered and purified by electrophoresis, and the products were detected by agarose gel electrophoresis (FIG. 3). Then, the ligation was performed overnight at 4 ℃ by using T4 ligase to obtain a 302a1-L4440 recombinant plasmid.

TABLE 2

SacⅠ	1.0μl，
		SalⅠ	1.0μl，
NE Buffer(10x)	5.0μl，
		Amplification product or L4440	4.0μl，
dH2O	39.0μl，
		Total of	50.0μl。

The connecting system is as follows:

the 302a1 and L4440 plasmids were double-digested, ligated and transformed into 50. mu.L DH 5. alpha. competent cells, plated on SOC solid medium containing ampicillin, cultured for 12h, and single colonies were picked and cultured in SOC liquid medium. The PCR was directly amplified by primers ECEGT01-F, ECEGT01-R and bacterial solution, the reaction system is shown in Table 3, the PCR conditions are: the PCR reaction condition is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extending for 5min at 72 ℃, and storing at 4 ℃. The DNA fragment is sent to a company for sequencing, and the result alignment is matched with the target fragment, and the 302a1-L4440 recombinant plasmid is successfully constructed.

SEQ ID NO. 1-SEQ ID NO.5 of the sequence table are the comparison of the PCR product and the 302a1 gene fragment sequence; wherein SEQ ID NO.1 is a sequence of a PCR product sequenced by taking a primer ECEGT01-F as a template; SEQ ID NO.2 is a PCR product sequence sequenced by taking a primer ECEGT01-R as a template; SEQ ID NO. 3-5 show 302a1 gene, and the 3 gene segments from transcriptome data (transcriptome data only contains exon and no intron) are > CL1378.Contig1_ All, > CL1378.Contig2_ All, > CL1378.Contig3_ All. Wherein, SEQ ID NO. 3-SEQ ID NO.5 are 302a1 gene segments, underlined partial sequences are coincided with SEQ ID NO.1 and SEQ ID NO.2, PCR products belong to 302a1 gene segments, namely, an amplification band is a desired target gene.

Inducible expression of 2dsRNA

Transforming the 302a1-L4440 recombinant plasmid obtained in the step (1) into an Escherichia coli competent cell HT115(DE3) strain, coating the strain on an SOC solid culture medium containing 100 mu g/mL ampicillin and 50 mu g/mL tetracycline, culturing for 12h in the absence of light, picking up a single colony to obtain 302a1-L4440-HT115 thallus, placing the 302a1-L4440-HT115 thallus in an SOC liquid culture medium containing 100 mu g/mL ampicillin and 50 mu g/mL tetracycline, culturing for 10-12h in the absence of light at 37 ℃, and then performing shake culture in a 2 × YT liquid culture medium containing 75 mu g/mL ampicillin and 12.5 mu g/mL tetracycline until the OD is reached₆₀₀When the concentration was 0.4, IPTG was added thereto for induction for 4 hours, and the cells were collected. The total RNA detection of the induced bacterial suspension is shown in FIG. 5. The gel electrophoresis result shows that after induction, 302a1-L4440-HT115 bacterial solution extractionThe RNA taken is one more RNA band than that before induction, and the RNA extracted from the 302a1-L4440-HT115 bacterial solution before induction does not contain the band, so that the success of dsRNA induction expression of the 302a1 gene fragment can be shown.

The bacterial liquid for obtaining dsRNA containing fraxinus 302a1 gene fragment in large quantity is prepared by transforming the constructed 302a1-L4440 recombinant plasmid into HT115 competent cells, coating the competent cells on SOC solid culture medium containing ampicillin and tetracycline, culturing for 12h in the dark, selecting single bacteria to SOC liquid culture medium (containing 100 mug/mL ampicillin and 50 mug/mL tetracycline) for 10-12h in the dark at 37 ℃, and then culturing in 2 × YT liquid culture medium (containing 75 mug/mL ampicillin and 12.5 mug/mL tetracycline) to OD₆₀₀＝0.38～0.42。

As a result:

the escherichia coli 302a1-L4440-HT115 formed by the constructed system is successfully cultured, dsRNA containing the target 302a1 gene fragment is obtained through induction, and the culture of the bacterial liquid can be expanded and cultured according to requirements to obtain the required dsRNA bacterial liquid.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> resource insect research institute of China forestry science research institute

<120> a system construction method for obtaining cercidiphyllum japonicum dsRNA in large quantity in vitro

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>416

<212>DNA

<213> Artificial sequence ()

<400>1

ggtggggcaa atattctggc agtcgacaag atacttgatt ttgtgtaata accatggtcc 60

ccgctggaac atgataattc gatagaatag catcttctga taaaattcta ccaatgccaa 120

tagatacagg gttcatacga tgaatttccc tcataaacag ctttcgtgta aaccgatttt 180

tgtaacattt cttcagtaat tgattcgtcc gctgtcatta atttattcag ttctagaaac 240

attttctctt gcttttcttcatttttagct aagtgataaa gagcaaaaga cgatgtataa 300

gccatcgtat caataccagc gaggagaaaa tcaactatcg cgcctaagac atctttttca 360

tctaaatttt catttttaag gaattgatct aggagtggta atgattaaac agaggg 416

<210>2

<211>434

<212>DNA

<213> Artificial sequence ()

<400>2

gagggcgggg aaattcctta aaatgaaaat ttaggatgaa aaagatgtct taggcgcgat 60

agttgatttt ctcctcgctg gtattgatac gatggcttat acatcgtctt ttgctcttta 120

tcacttagct aaaaatgaag aaaagcaaga gaaaatgttt ctagaactga ataaattaat 180

gacagcggac gaatcaatta ctgaagaaat gttacaaaaa tcggtttaca cgaaagctgt 240

tatgagggaa attcatcgta tgaaccctgt atctattggc attggtagaa ttttatcaga 300

agatgctatt ctatcgaatt atcatgttcc agcggggacc atggttatta cacaaaatca 360

agtatcttgt cgactgccag aatattttgc cagtccaaat gaatttatac cagagcggag 420

gagcatactt aagt 434

<210>3

<211>2292

<212>DNA

<213> Artificial sequence ()

<400>3

ggctataaat gagatttcat caaaaatttc aacagtgtag aatttgttgg tccaaagaaa 60

tgacacactg ccacagtaca aatgaaaaaa aggttaagta ctcattgaat cgataattta 120

cgttcttggc tgaaaatgaa tctgaacagg tttttccggt ttattaatca gcacggatac 180

acaatccaaa tcgttaccca gccacttcag tttgaatttg tgaacaatgt tcatcaacaa 240

aagttgtaag ttctgttctg ccaatcgacg agcaatacaa gtccggggcc cgtgtccgaa 300

aggtaaaacc aagtacggat gtatttgttc gcttcctgat tctcgtaacc aacgctctgg 360

tataaattca tttggactgg caaaatattc tggcagtcga caagatactt gattttgtgt 420

aataaccatg gtccccgctg gaacatgata attcgataga atagcatctt ctgataaaat 480

tctaccaatg ccaatagata cagggttcat acgatgaatt tccctcataa cagctttcgt 540

gtaaaccgat ttttgtaaca tttcttcagt aattgattcg tccgctgtca ttaatttatt 600

cagttctaga aacattttct cttgcttttc ttcattttta gctaagtgat aaagagcaaa 660

agacgatgta taagccatcg tatcaatacc agcgaggaga aaatcaacta tcgcgcctaa 720

gacatctttt tcatctaaat tttcattttt aaggaattga tctaggagtg ataatgattc 780

aacaggccgg tcgtccaagt tttttaattt tttatgcaaa aatttttgag caactatttc 840

tatatatcta tgagctttgg aaaatttgcg atatgcagga gtattgaagt gtttccaaag 900

ttgtaaccca ccgtctgtac gtgaaatcac actattcatg cacgcagccg cctcaatcaa 960

atttgatgtt tgcgagtttg gttccaattc aaattccgaa aaacagttga gcgattcatc 1020

gaaacagact aatcctatca attcgagaaa gagtcttgat agctccggca gaaaatcaga 1080

agactgatta ttggttcgaa ggtccaaaaa ctttttaata actccgtcgg tacgaggcag 1140

atacaatctc acattctgaa ttttactaat atctttttga aatatcttcc ggatacgacc 1200

ccactctgga ccattcgtcg gtatgagacc tccagaatta tacaattccg gtctttcacg 1260

gcgatatttt tctaaaataa gatgacttct tctctgcgga tatcgacctt cacaccgata 1320

cacagcttct atgtcttcgg gtttgaaaac caagacgact gtaacacctg gtacaatttc 1380

ttctttaatg attgtcccga attgctgtaa tttttggaat ccatcgtgat gtaatttttt 1440

aaatccataa ttgccaatca ctggcaagta aatctcaagg gtcctaatga aggaaagtga 1500

tttaggacca ggtatcgcat caaatggctt aatctcgctg gtgaaggtac agaaattcag 1560

tctaggaaac caacaatata atttcttcac atgcattatt tttactatca taaaattcga 1620

aaaaaattca tcattgaaaa ttattgtcaa taaagcatcc gaaaaaataa tacgtaaaaa 1680

tatgcgtgag ttttaaatga caatccaaaa cagaatagaa aaaacaattc aaaaacaaat 1740

atagaaagat tgaactacgt attaggaatt gtaaaaatga aaacaaaaca aaacgacgca 1800

ccttaaatta aaaacatatt ttttcactca catatacgac acgtaagttt acataattta 1860

catatttgaa aatcagaatt aacagaaact atttgtttct tgattattca gtatactact 1920

gagtgctccc tcgatttgtt caagtccttt ccttaaaaag cgatcaaatt taacgcatgt 1980

acagtattag atgatggcca cagttttcaa tgcctctgat tacctatact ctgttcatat 2040

gcctgtaaat atacacttgc acttgcatgt ggagaaaata ttttgagcaa attaatacgt 2100

caaatagtat tataatatta cattttcgtt aacactcact cacagtccta caatggcagt 2160

agggtagaga tgctgattga ggaatcagta atgccgggct cgaatcctac caagggcaac 2220

gttttataaa catttttttt gttttaagat aaattttttt ttttaaaatg gttattagat 2280

tctctgtttt tt 2292

<210>4

<211>395

<212>DNA

<213> Artificial sequence ()

<400>4

attcatcgaa acagactatt cctatcaatt ccaaaaaaag tcttgatagt tctggcaaaa 60

aatcttaaaa ttgagtatta gctcgaagat ccaaaaactt tttaataact tcgtcggtac 120

gcggcagata caatcttaca ttcggaattt tactaatacc tttttgaaat attttccgga 180

tacgacccca ctctgaacca ttcctcggta ttagacaccc agaatttcat aattcccgtc 240

tttcaaggct atatttttct aaaataagat gacttcttct ctgcggatat cgaccttcgc 300

atcgatacac agcttctatg tttttgggtt tgaaaaccta gacaacagta acacctggta 360

caatttcttc ctttaataac tgtctcgaat tgctg 395

<210>5

<211>4904

<212>DNA

<213> Artificial sequence ()

<400>5

gttgaatttt taatctacgt tcgaaatttt attcagcgtg ttagtttttg cccgaagtat 60

tattggatgg ccgaaagatt ggttgatcga ttgcataatg aattaataaa actgcggttg 120

ttatgcggga cggtagataa cttaccggat tatatagtga attactcggc cagtagtgct 180

gggaatcgta atacgcagcc gtcatatcat ttatttcatt gtcacctcga tataaagtgg 240

ttacacatta cgcttttgta tcaattaatt gtaataaaac agagacttgg aactgaaaaa 300

tcttccgaag aatatgaaac ttctttgaat tttcgtgcat tagataactt cgttgagctc 360

ctgatgtcag atttaattat cattactctc aaaagatttc aacagatttc catcgacgat 420

cttgctgtta aatcgttatt tacgtgtact tgcgtacgag aaatgtggaa gctgctgcag 480

ctaagtgttg accatcttca taggcgcggt ttcatatcga atttctggca ttttgtgaac 540

cgaatttgtg ataaaattgc attaaacagt gttattcaaa cagactacaa tgattgttca 600

atgttaaaaa tgccgcaaac ctactcttct tcccatccat ctatgtttgt ggtttggttg 660

ttgaaacact taataaaatt gtggagctct ggtgaaaaac tggaaattga atccaattat 720

ttgcttttag aaaatgcaat aaaaatatgc gtaaattcgg aaccagctga atcctgtttg 780

cgtgttttcc tattttttgt ggaaaatatt ttgaattctg attgggaaat gcgaactgag 840

ccacttgtac ttctttggga gtattttaac aaaaagctta attccttgtt ttacattcct 900

ggatcgtcga ttagtggaat tgctgtcatg agcaaaagtg catcaggctt attgacgcag 960

ttgaacaata aattagaaca atttgtttta gacaaaaata tggacagttt tcatttgttt 1020

cttcgattac tgggaagaaa cttgaaaaaa tggcgtgaca attcgcgctt ttggaaccaa 1080

ttaaaaggtc gtatatactc caagttttca gcttccaagt tatcatccct gaatgagatc 1140

ggattgtatc attttgtatc gttattttta actttggctc ttaccaccga tctcaatgaa 1200

gtgagcaaga agttgcaatc cttcctcaac ttacttattg cagaaaatct tgatgaagct 1260

cgattaaaat tagtctggaa agctcatata gctttgattt tattgtttgc cgagaacaac 1320

ctagatataa gcattgtgtc gaatccatta atggatatgg tagaaacagc cgtacagcta 1380

ccaaattgct tgagtttaat gagggtattt ttggaggggt ttcaagattt gatagattgc 1440

acaaataatt tggaactggg gcagtacatt tttatcggaa actggatttc ttcctatctt 1500

tcgcaatgca atgaatcgga ttcgaatagg tttctggaga ctatatcggt attaatcaat 1560

aaactgaatt ctctaatgtc agctcagtta ccacttggtc aagacaatca attgatcctt 1620

atgtataatg cattatggga acacttggta ccgtatttga aaaaaataat gagctccgcg 1680

tcgaacaatt cttaccaggt accggatatt gctgccacac ttaccacatt atcattcaaa 1740

tcttgttttc ctctcagtac tagaaatcgg gctgtagact tactaacagt tttcgttagt 1800

cacgattcaa ttgatgtcag gttgttatgt cgttatctta gccaagtatc gcgttccatg 1860

cattcgcatt tattaaataa ttttagcatt actttgatca agggatggtt aagatgcctt 1920

attcttctat cgagcgatga agagttagaa gaggatctcg ctagatttac cacatttatc 1980

accacgttac ccgaaataca aaaactattt tcagaaacac aaatcaccct gaatctgcat 2040

tcagattatt ttgagaattt tctcatggca ttgcagttga aatactcatc acttcaagat 2100

ttccattcaa aaaataagtt tagtagccaa gtatggtcgt atttcgctaa tattgagcga 2160

tggctgttgc atttagtaaa aattcctaaa tcaataaatt tggccatgaa tatttaccga 2220

aacgttggac agatgttttt taagattccg gaaatgctgt acactaagtc tcgtccaaat 2280

agtttgctgc agtctttttt ggatttatta cttttaccga tacaaattcg aaatcccgag 2340

tttaaactta attgtcattt aagcgatgcg ataaaaaaat actttctact tgttcatttg 2400

tggtcttttc aaattaggtt ggtgaacagt tttctctgtt caagtgtttt gaattctcgg 2460

aacgctttga attaactagt aaatcaatta ttgaaatact atgctgcgca tttttaagaa 2520

agcgagccaa aacacctcac caatacgctt ttcaaacatt aattttcctc aataatctca 2580

tcagattaca caaaaataac gacgctgttg taaaatgttt tataaaaaat gctctggaga 2640

ggatatgtga tgtcgtaatg ttctgtgaag atattagtcc ctgtaaaaaa gaggcaaaag 2700

atatattgca gtttaccttg gatttaaata ttcttcgaag tgaatcagat gttggaaatt 2760

ttttaatcga agtgttcggt aaactctgtc aagagcatct agctttcaat tcgggaaact 2820

tattcgattt gttcgaggaa attatttccg tagctccgga ttcagtggct cgatttttac 2880

cgcagtttag agaaaaaatc aaagaagttg aacataaacg aggtgttgga tttgatcgtt 2940

cgttaaggaa aggacttgaa cgaatcgagg aagcactcgg tagtatacgg aataatcaaa 3000

gaacaaatag tttctgttaa ttcagatttt caaatatgta aattatgtaa acttatgtgt 3060

cgtatatgtg agtgaaaaaa tatatgtttt taatttaagg agcgtcgttt taatttgttt 3120

tcatttttac aattcccaat acgtagttca atgctttcta tatttgtttt tgaattgttt 3180

tttctattct gttttggatt gtcatttaaa actcacgcat atttttacgt attatttttt 3240

cggatgcttt attgacaata attttcaatg atgaattttt ttcgaatttt atgatagtaa 3300

aaataatgca tgtgaagaaa ttatattgtt ggtttcctag actgaatttc tgtaccttca 3360

ccagcgagat taagccattt gatgcgatac ctggtcctaa atcactttcc ttcattagga 3420

cccttgagat ttacttgcca gtgattggca attatggatt taaaaaatta catcacgatg 3480

gattccaaaa attacagcaa ttcgggacaa tcattaaaga agaaattgta ccaggtgtta 3540

cagtcgtctt ggttttcaaa cccgaagaca tagaagctgt gtatcggtgt gaaggtcgat 3600

atccgcagag aagaagtcat cttattttag aaaaatatcg ccgtgaaaga ccggaattgt 3660

ataattctgg aggtctcata ccgacgaatg gtccagagtg gggtcgtatc cggaagatat 3720

ttcaaaaaga tattagtaaa attcagaatg tgagattgta tctgcctcgt accgacggag 3780

ttattaaaaa gtttttggac cttcgaacca ataatcagtc ttctgatttt ctgccggagc 3840

tatcaagact ctttctcgaa ttgataggat tagtctgttt cgatgaatcg ctcaactgtt 3900

tttcggaatt tgaattggaa ccaaactcgc aaacatcaaa tttgattgag gcggctgcgt 3960

gcatgaatag tgtgatttca cgtacagacg gtgggttaca actttggaaa cacttcaata 4020

ctcctgcata tcgcaaattt tccaaagctc atagatatat agaaatagtt gctcaaaaat 4080

ttttgcataa aaaattaaaa aacttggacg accggcctgt tgaatcatta tcactcctag 4140

atcaattcct taaaaatgaa aatttagatg aaaaagatgt cttaggcgcg atagttgatt 4200

ttctcctcgc tggtattgat acgatggctt atacatcgtc ttttgctctt tatcacttag 4260

ctaaaaatga agaaaagcaa gagaaaatgt ttctagaact gaataaatta atgacagcgg 4320

acgaatcaat tactgaagaa atgttacaaa aatcggttta cacgaaagct gttatgaggg 4380

aaattcatcg tatgaaccct gtatctattg gcattggtag aattttatca gaagatgcta 4440

ttctatcgaa ttatcatgtt ccagcgggga ccatggttat tacacaaaat caagtatctt 4500

gtcgactgcc agaatatttt gccagtccaa atgaatttat accagagcgt tggttacgag 4560

aatcaggaag cgaacaaata catccgtact tggttttacc tttcggacac gggccccgga 4620

cttgtattgc tcgtcgattg gcagaacaga acttacaact tttgttgatg aacattgttc 4680

acaaattcaa actgaagtgg ctgggtaacg atttggattg tgtatccgtg ctgattaata 4740

aaccggaaaa acctgttcag attcattttc agccaagaac gtaaattatc gattcaatga 4800

gtacttaacc tttttttcat ttgtactgtg gcagtgtgtc atttctttgg accaacaaat 4860

tctacactgt tgaaattttt gatgaaatct catttatagc caat 4904

<210>6

<211>33

<212>DNA

<213> Artificial sequence ()

<400>6

atgagctccg ctctggtata aattcatttg gac 33

<210>7

<211>33

<212>DNA

<213> Artificial sequence ()

<400>7

atgtcgacgc ctgttgaatc attatcactc cta 33

Claims (9)

1. A system construction method for obtaining largehead wax worm dsRNA in vitro in large quantity is characterized by comprising the following steps:

extracting fraxinus chinensis total RNA, carrying out reverse transcription on the fraxinus chinensis total RNA to obtain cDNA, carrying out PCR amplification, carrying out SacI and SalI double digestion on an amplification product and an L4440 carrier plasmid respectively, and carrying out overnight connection on the product after the double digestion at 4 ℃ by using T4 ligase to obtain a recombinant plasmid 302a1-L4440 containing a 302a1 gene fragment;

step (2), the 302a1-L4440 recombinant plasmid obtained in the step (1) is transformed into an escherichia coli competent cell HT115(DE3) strain, and a solid culture medium is coated to screen a single colony, so that 302a1-L4440-HT115 thalli are obtained;

step (3) of shaking-culturing the 302a1-L4440-HT115 bacterial cell liquid obtained in step (2) to OD₆₀₀=0.38-0.42, adding IPTG to induce to obtain dsRNA bacterial liquid containing the fraxinus 302a1 gene segment;

and (4) concentrating the dsRNA bacterial liquid containing the fraxinus 302a1 gene fragment obtained in the step (3) for RNA interference experiments.

2. The method for constructing a system for obtaining a large amount of wax insect dsRNA in vitro according to claim 1, wherein the total RNA of wax insect comprises the total RNA of the 302a1 gene of wax insect.

3. The method for constructing a system for obtaining fraxinus chinensis dsRNA in large quantity in vitro according to claim 1, wherein the primers used for PCR amplification are ECEGT01-F and ECEGT 01-R;

ECEGT01-F：5'-atgagctccgctctggtataaattcatttggac-3'（SEQ ID NO.6）；

ECEGT01-R：5'-atgtcgacgcctgttgaatcattatcactccta-3'（SEQ ID NO.7）。

4. the method for constructing a system for obtaining fraxinus chinensis dsRNA in large quantity in vitro according to claim 1, wherein in step (1), the PCR amplification system is:

Taq PCR Master Mix(2X, with Red Dye) 25.0μl，

cDNA 3.0μl，

ECEGT01-F 10μM 2.0μl，

ECEGT01-R 10μM 2.0μl，

ddH₂O 18.0μl，

total 50.0. mu.l;

the PCR amplification procedure was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; extending for 5min at 72 ℃, and storing at 4 ℃.

5. The method for constructing a system for obtaining fraxinus chinensis dsRNA in large quantity in vitro according to claim 1, wherein in the step (1), the condition system of enzyme digestion is as follows:

SacⅠ 1.0 μl，

SalⅠ 1.0 μl，

NE Buffer(10x) 5.0 μl，

the amplification product or L44404.0. mu.l,

dH₂O 39.0 μl，

total 50.0. mu.l;

the time for enzyme digestion was 10min at 37 ℃.

6. The method for constructing a system for obtaining fraxinus chinensis dsRNA in large quantity in vitro according to claim 1, wherein the linker system is:

4.0ul of the amplified product after enzyme digestion,

the enzyme-digested L44401.0ul,

1.0ul of T4 enzyme,

T4 Buffer 2.5ul，

H₂O 11.5ul，

a total of 20.0 ul.

7. The method for constructing the system for obtaining the fraxinus chinensis dsRNA in large quantity in vitro according to claim 1, wherein the product after the connection is transformed into competent cells DH5 alpha, the competent cells are coated and screened in an SOC solid medium containing 100 μ g/mL ampicillin, and plasmids are extracted after the grown single colony is propagated in an expanded manner, so that the 302a1-L4440 recombinant plasmids are obtained.

8. The method for constructing a system for obtaining fraxinus chinensis dsRNA in large quantity in vitro according to claim 1, wherein the specific method in the step (2) is as follows: the 302a1-L4440 recombinant plasmid obtained in the step (1) is transformed into an Escherichia coli competent cell HT115(DE3) strain, spread on an SOC solid culture medium containing 100 mu g/mL ampicillin and 50 mu g/mL tetracycline, and cultured for 12h in a dark place, and a single colony is picked to obtain 302a1-L4440-HT115 thalli.

9. The method of claim 1, wherein the step (3) comprises culturing 302a1-L4440-HT115 in SOC liquid medium containing 100. mu.g/mL ampicillin and 50. mu.g/mL tetracycline at 37 ℃ in the absence of light for 10-12h, and shake culturing in 2 × YT liquid medium containing 75. mu.g/mL ampicillin and 12.5. mu.g/mL tetracycline until OD is reached₆₀₀And (3) =0.38-0.42, adding IPTG (isopropyl-beta-D-thiogalactoside) to induce and culture for 3-4 h, and obtaining the dsRNA bacterial liquid containing the fraxinus chinensis 302a1 gene fragment.

Images