CN108893471B - Promoter P-osi specifically responding to oxidative stress signal and application thereof - Google Patents
Promoter P-osi specifically responding to oxidative stress signal and application thereof Download PDFInfo
- Publication number
- CN108893471B CN108893471B CN201810666544.XA CN201810666544A CN108893471B CN 108893471 B CN108893471 B CN 108893471B CN 201810666544 A CN201810666544 A CN 201810666544A CN 108893471 B CN108893471 B CN 108893471B
- Authority
- CN
- China
- Prior art keywords
- promoter
- osi
- oxidative stress
- expression
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a promoter sequence which can respond to an oxidative stress signal and activate the expression of a downstream target gene. Three recombinant expression strains are obtained by constructing a fusion expression vector containing the promoter and transferring the expression vector to industrial microorganism fermentation strains such as escherichia coli, bacillus subtilis, corynebacterium glutamicum and the like respectively. Experiments prove that under the condition of oxidative stress, the promoter sequence disclosed by the invention can specifically start the expression of downstream target genes, and has application values in related fields such as microbial genetic engineering, fermentation engineering and the like.
Description
The technical field is as follows:
the invention relates to a promoter DNA sequence capable of specifically responding to an oxidative stress signal. The invention also relates to the application of the promoter in the fields of microbial fermentation industry and genetic engineering.
Background art:
modern biotechnology is an engineering technology for producing various useful substances by using the growth of microorganisms and corresponding metabolic activities, and genetically engineered strains are research hotspots of the whole modern biotechnology. The genetic engineering strain is often exposed to various environmental stresses formed by high-concentration substrates and products during production and fermentation, so that a large number of Reactive Oxygen Species (ROS) appear in the strain cell to influence the physiological function exertion of microorganisms, and the yield of the microorganisms and the production of target products are limited. Therefore, a promoter sequence capable of specifically responding to the oxidative stress signal is found, and the microbial strain is genetically modified to enhance the response efficiency and adaptability of the microorganism to the oxidative stress.
Many non-coding RNAs of bacteria can be efficiently expressed in the process of cell stress response, and further play an important regulation role in the stress response system of bacteria. Deinococcus radiodurans (Deinococcus radiodurans) has extremely strong adversity stress adaptability and has super-strong resistance to strong oxidants (such as hydrogen peroxide), high temperature, radiation (such as UV radiation, gamma radiation and the like), drought and the like. In recent years, research on radiation-resistant microbial ncRNA has been reported, and research suggests that radiation-resistant deinococcus ncRNA plays an extremely important role in stress resistance reactions such as radiation and oxidation.
The invention content is as follows:
the invention aims to obtain a promoter DNA sequence which can respond to an oxidative stress signal and can effectively start the transcription of a target gene so as to be applied to the transformation of engineering strains in fermentation engineering and genetic engineering.
The invention discovers a non-coding RNA OsiR gene of deinococcus radiodurans for the first time, and the gene can specifically respond to an oxidative stress signal for transcription and plays a regulating and controlling function.
The invention identifies the promoter sequence of non-coding RNA OsiR through experiments and confirms the function:
identification of OsiR gene and analysis of promoter P-Osi thereof
The inventor firstly discovers a new transcribable functional non-coding RNA gene in the transcriptome analysis process of Deinococcus radiodurans (Deinococcus radiodurans), the expression of which is induced by oxidative stress (figure 1), and the new transcribable functional non-coding RNA gene participates in the life process of resisting the adverse environment of bacteria, and is named as an OsiR gene.
The transcription initiation site and orientation of OsiR were determined by 5' -RACE experiment. The results showed that the transcription initiation site of OsiR starts from an adenine (A), and the gene region 170bp upstream from the transcription initiation site was determined to be the promoter of OsiR gene, designated as P-Osi (FIG. 2), whose nucleotide sequence is SEQ ID NO: 1.
2. constructing promoter P-Osi fusion expression vector, transferring into 3 different bacteria to obtain 3 recombinant expression strains
A complete promoter P-Osi fragment is obtained by PCR amplification, the cloned fragment is subjected to double enzyme digestion of MulI and SpeI, and is inserted in front of a reporter gene lacZ of a promoter expression vector pRADZ3 to obtain a fusion expression vector pRAD-P-Osi-lacZ of the promoter P-Osi and lacZ genes (figure 3). The expression vector is respectively transferred into escherichia coli (Escherichia coli), Bacillus subtilis (Bacillus subtilis) or Corynebacterium glutamicum (Corynebacterium glutamicum) to obtain 3 recombinant expression strains: coli (P-Osi-lacZ); subtillis (P-Osi-lacZ); glutamicum (P-Osi-lacZ).
3. Verification experiment of response of promoter P-Osi to oxidative stress signal
Respectively carrying out H on the 3 recombinant expression strains2O2And (3) oxidative stress treatment, and determining the enzyme activity of a lacZ gene coding product beta-galactosidase in the recombinant bacteria under an induction condition. Research results show that in 3 recombinant bacteria, an oxidative stress signal can activate the expression of the promoter of the invention to start the translation of lacZ gene.
Experiments prove that under the condition of oxidative stress, the promoter disclosed by the invention can specifically and efficiently start the expression of a target gene in 3 industrial microbial fermentation strains, and can be applied to genetic modification of microbial fermentation engineering strains. Sequence information
1, SEQ ID NO: promoter P-Osi nucleotide sequence of non-coding RNA OsiR gene
Drawings
FIG. 1: promoter analysis of non-coding RNA OsiR gene in deinococcus radiodurans
In the figure, the transcription start site of the osiR gene is underlined and the direction of transcription is indicated by an arrow. Promoter sequences are in bold black;
FIG. 2: analyzing response of a deinococcus radiodurans non-coding RNA osiR oxidative stress signal;
FIG. 3: the promoter P-Osi and the target gene are fused and expressed schematically;
FIG. 4: enzyme activity determination result of 3 recombinant expression strains beta-galactosidase under oxidative stress
Wherein E, B, C represents E.coli (P-Osi-lacZ); subtillis (P-Osi-lacZ); glutamicum (P-Osi-lacZ).
Detailed Description
The invention will be further illustrated with reference to the following specific examples. The examples are intended only to illustrate the process of the invention and are not intended to limit the scope of the invention. Where specific experimental conditions are not indicated, they are in accordance with conventional conditions well known to those skilled in the art or as recommended by the manufacturer.
Example 1 identification of non-coding RNA OsiR Gene and analysis of its promoter
Firstly, experimental materials:
test strains: deinococcus radiodurans (Deinococcus radiodurans)
Is purchased from China general microbiological culture Collection center with the strain number of CGMCC 1.633.
II, an experimental method:
the transcription start site and the direction of transcription of osiR were determined by 5' RACE assay. The specific procedures are described in the 5 '/3' RACE Kit instructions from Roche. And (3) cutting the gel of the target fragment, recovering and sequencing the sequence, and comparing and analyzing the sequence obtained by sequencing with the sequence in the radiation-resistant abnormal coccus genome to finally determine the transcription initiation site and direction of OsiR.
Thirdly, experimental results:
the results of 5' RACE experiments showed that osiR is reverse transcription, which starts with an adenine (A). Meanwhile, sequence analysis of the promoter region upstream of the transcription initiation site determined by 5' RACE revealed conserved-10 region and-35 region (AGGAAA-N17-TAAAAT), and the gene region 170bp upstream from the transcription initiation site was the promoter of OsiR gene and named as P-Osi (FIG. 1)
Fourthly, experimental conclusion:
as a result of the study, osiR is reverse transcription, transcription starts from adenine (A), and a gene region which is 170bp upstream from the transcription start site is a promoter of the osiR gene and is named as P-Osi.
Example 2 analysis of expression characteristics of non-coding RNA OsiR Gene under oxidative stress
Firstly, experimental materials:
test strains: deinococcus radiodurans (Deinococcus radiodurans)
Is purchased from China general microbiological culture Collection center with the strain number of CGMCC 1.633.
II, an experimental method:
(1) the deinococcus radiodurans was activated in TGY liquid medium and cultured overnight at 30 ℃. Transferring to TGY culture medium the next day, culturing at 30 deg.C to OD600≈1.0；
(2) First, 1mL of each of the cells was used as a control, and then 1mL of each of the cells was added to a final concentration of 80mmol/L H2O2Impacting for 30min at 30 ℃;
(3) the cells were centrifuged at 8000 Xg for 5min and collected. Extracting total RNA of bacteria by adopting a Promega kit Z3741, and performing cDNA inversion on sample RNA with the same using amount;
(4) the expression levels of the OsiR gene under different stress conditions are analyzed by a qRT-PCR method.
Thirdly, experimental results:
the results of the study show that H is comparable to that in the untreated condition2O2The transcription level of the OsiR gene under oxidative stress conditions was significantly increased up to about 51-fold (fig. 2).
Fourthly, experimental conclusion:
experimental results show that OsiR is induced by oxidative stress and can respond to signals generated in the oxidative stress process and regulate the expression of other genes.
Example 3 construction of promoter P-Osi fusion expression vector
Firstly, experimental materials:
carrier: pRADZ 3: plasmid was stored in this laboratory
Recipient strain: coli, b.subtilis, and c.glutamicum: the laboratory preserves the strains
II, an experimental method:
(1) PCR amplification of OsiR gene promoter fragment: taking the genome DNA of the deinococcus radiodurans as a template, and carrying out PCR amplification by using primers P-Osi-F and P-Osi-R to obtain a fragment of a promoter P-Osi with the length of about 170 bp;
primer:
P-Osi-F：ACCACGCGTGATGTTTACGAATGACAGG
P-Osi-R：CCGACTAGTGTCTGTTTTTAGCGTGTTAG
(2) construction of an expression vector of the OsiR gene promoter: carrying out double enzyme digestion on the OsiR gene promoter fragment obtained by PCR amplification by MulI and SpeI, connecting the fragment to a promoter detection vector pRADZ3, selecting a positive clone to extract a plasmid, and carrying out enzyme digestion and PCR verification to obtain a lacZ fusion vector pRAD-P-Osi-lacZ.
(3) Obtaining of recombinant expression strains: the constructed promoter pnfiS fusion expression vector is respectively transferred into E.coli, B.subtilis and C.glutamicum by electric excitation, and 3 recombinant expression strains are obtained by resistance screening and PCR verification.
Thirdly, experimental results:
a fusion vector pRAD-P-Osi-lacZ was successfully constructed, with the promoter P-Osi inserted upstream of the reporter gene lacZ (FIG. 3). And respectively transforming the fusion vector pRAD-P-Osi-lacZ into E.coli, B.subtilis and C.glutamicum by an electric shock transformation method to obtain a recombinant expression strain.
Fourthly, experimental conclusion:
constructing a fusion expression vector pRAD-P-Osi-lacZ of promoter P-Osi and lacZ gene. 3 recombinant expression strains were obtained: coli E.coli (P-Osi-lacZ); bacillus subtilis B.subtilis (P-Osi-lacZ); corynebacterium glutamicum C.glutamicum (P-Osi-lacZ).
Example 4 Activity assay of 3 recombinant expression strains beta-galactosidase under oxidative stress
Firstly, experimental materials:
experimental strains: coli E.coli (P-Osi-lacZ); bacillus subtilis B.subtilis (P-Osi-lacZ); corynebacterium glutamicum C.glutamicum (P-Osi-lacZ).
II, an experimental method:
coli, b.thuringiensis, c.glutamicum the method for the determination of β -galactosidase activity is as follows:
(1) single colonies of 3 recombinant strains are respectively picked up and inoculated in LB liquid culture medium containing antibiotics for overnight culture. Wherein the culture temperature of E.coli (P-Osi-lacZ) is 37 ℃, and the culture temperature of the rest 2 recombinant strains is 30 ℃. Inoculating to fresh LB liquid culture medium according to 2% transfer amount the next day, and measuring bacterial liquid OD600Value up to OD600The value reaches above 0.6, 40 mmol/L H and 60mmol/L H are respectively added2O2Impacting for 10min, and taking a non-impacted strain as a negative control;
(2) taking a proper amount of bacterial liquid, centrifuging for 5min at 4 ℃ at 5,000 Xg, discarding the supernatant, washing twice with sterile water, and discarding the supernatant. The cells were resuspended as needed. The cell suspension was mixed with bufferZ to a total volume of 1mL, 2-3 drops of chloroform were added and mixed well. The cover is opened and the temperature is kept at 37 ℃ for 40 min. And (3) transferring to 30 ℃ for heat preservation for 5min, then adding 200 mu L (4.0mg/mL) of o-nitrobenzene-beta-D-galactopyranoside (ONPG), mixing uniformly, continuing to preserve heat at 30 ℃, starting the reaction, and recording the reaction starting time. When the sample turns yellow, 500. mu.L of 1mol/L Na is added2CO3And (5) stopping the reaction, recording the reaction stopping time, and placing the sample on ice to be detected.
(3) Respectively measuring OD with ultraviolet spectrophotometer420And OD550The value is obtained. The beta-galactosidase activity value was calculated according to the following formula
β-Galactosidase Units＝1000×(OD420-1.75×OD550)/(T×V×OD600)。
Each of the above experiments for each recombinant expression strain was performed in parallel three times, and the obtained results were β -galactosidase activity values calculated as the average error of three independent experiments.
Thirdly, experimental results:
different concentrations of H2O2The impact can activate the promoter sequence of the invention, thereby improving the expression of the reporter gene lacZ, the activity of the promoter P-Osi and H2O2The concentration was positively correlated (fig. 4). Wherein:
coli E.coli (P-Osi-lacZ) at 40mM H2O2The beta-galactosidase activity under shock induction was 192.2. + -. 7.26U at 60mM H2O2Under the induction of impact, the activity of beta-galactosidase is further improved to 446.3 +/-12.40U.
Bacillus subtilis B.subtilis (P-Osi-lacZ) H at 60mM2O2Under the induction of impact, the activity of beta-galactosidase is 293.7 +/-21.32U;
glutamicum glutamicum C.glutamicum (P-Osi-lacZ)) at 60mM H2O2Under the induction of impact, the activity of beta-galactosidase is also increased to 385.3 +/-19.19U.
The promoter P-Osi can specifically and efficiently start the expression of downstream target genes in 3 different industrial microbial strains under the condition of oxidative stress.
Fourthly, experimental conclusion:
the promoter discovered by the invention can specifically respond to an oxidative stress signal and start the expression of a target gene, and can be applied to the transformation of engineering strains in fermentation engineering and genetic engineering.
Sequence listing
<110> institute of biotechnology of Chinese academy of agricultural sciences
<120> a promoter P-osi specifically responding to oxidative stress signal and application thereof
<160> 1
<170> PatentIn version 3.1
<210> 1
<211> 170
<212> DNA
<213> Deinococcus radiodurans (Deinococcus radiodurans)
<400> 1
gatgtttacg aatgacaggt agcggggagc ataaccctgt ataagcgtga ggagttatgc 60
agagcacctg tataggactg gcgattgccc ggcctttcac tagggaacat agcaagtgac 120
cagaaggcga tgaggcagga aaaatatcgt ctaacacgct aaaaacagac 170
Claims (4)
1. A promoter responding to an oxidative stress signal and efficiently starting functional gene expression, and the nucleotide sequence of the promoter is shown as SEQ ID NO:1 is shown.
2. The use of the promoter of claim 1 for engineering strain engineering in fermentation engineering and genetic engineering, wherein the promoter is capable of promoting expression of a gene of interest under oxidative stress conditions.
3. The use of the fusion expression vector containing the promoter of claim 1 in engineering strain modification in fermentation engineering and genetic engineering, wherein the promoter is capable of promoting the expression of a target gene under oxidative stress conditions.
4. Use according to claim 2 or 3, characterized in that the engineered strain is selected from Escherichia coli, Bacillus subtilis or Corynebacterium glutamicum.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810666544.XA CN108893471B (en) | 2018-06-26 | 2018-06-26 | Promoter P-osi specifically responding to oxidative stress signal and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810666544.XA CN108893471B (en) | 2018-06-26 | 2018-06-26 | Promoter P-osi specifically responding to oxidative stress signal and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108893471A CN108893471A (en) | 2018-11-27 |
| CN108893471B true CN108893471B (en) | 2021-11-02 |
Family
ID=64346034
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810666544.XA Active CN108893471B (en) | 2018-06-26 | 2018-06-26 | Promoter P-osi specifically responding to oxidative stress signal and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108893471B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733089A (en) * | 2020-05-12 | 2020-10-02 | 北京理工大学 | Strain construction method for improving saccharomyces cerevisiae robustness |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105002201A (en) * | 2015-05-11 | 2015-10-28 | 中国农业科学院生物技术研究所 | Application of deinococcus geothermalis Dgeo0395 in enhancing adverse resistance of cells |
-
2018
- 2018-06-26 CN CN201810666544.XA patent/CN108893471B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105002201A (en) * | 2015-05-11 | 2015-10-28 | 中国农业科学院生物技术研究所 | Application of deinococcus geothermalis Dgeo0395 in enhancing adverse resistance of cells |
Non-Patent Citations (2)
| Title |
|---|
| Deinococcus radiodurans R1 chromosome 1, complete sequence;GenBank Accession NO：NC_001263.1;《GenBank》;20160803;第1-6页 * |
| Transcriptional analysis of Deinococcus radiodurans reveals novel small RNAs that are differentially expressed under ionizing radiation;Chen-Hsun Tsai等;《Applied and Environmental Microbiology》;20141229;第81卷(第5期);第1754-1764页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108893471A (en) | 2018-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109072207A (en) | Improved method for modifying target nucleic acid | |
| KR20180086206A (en) | Modified bi-directional catalase promoter from Bacillus | |
| WO2013132518A1 (en) | Recombinant nitrogen fixing microorganism and uses thereof | |
| AU2016260738B2 (en) | IrrE protein functional domain for improving anti-oxidation capability of cell and application thereof | |
| CN111518806B (en) | Acetobacter pasteurianus promoter and application thereof | |
| CN111926013B (en) | Promoter suitable for bacillus licheniformis and application thereof in high-efficiency expression of target product | |
| CN106755037A (en) | Streptomyces virginiae IBL14 type I-B-sv14 CAS gene editing system | |
| US11639512B2 (en) | Corynebacterium constitutive expression vector promoter screened on the basis of transcriptome sequencing, screening method thereof, and applications thereof | |
| CN108893471B (en) | Promoter P-osi specifically responding to oxidative stress signal and application thereof | |
| EP2383337A1 (en) | Novel promoter for use in transformation of algae | |
| Dorrazehi et al. | Building scarless gene libraries in the chromosome of bacteria | |
| CN111254106B (en) | Food-grade streptococcus thermophilus expression system and application thereof in yoghourt preparation | |
| CN107299074B (en) | Construction method and application of formate dehydrogenase engineering strain | |
| CN104877997B (en) | One special promoter for responding Osmotic Stress Signal Transduction and application | |
| US9976116B2 (en) | Programmable synthetic lysis system for controlled release of macromolecules | |
| CN113583931B (en) | Citrobacter williamsii ansB gene knockout mutant strain and application thereof | |
| CN110564662B (en) | Construction method of integrated bacillus subtilis for efficiently expressing acetaldehyde dehydrogenase | |
| CN111979257B (en) | Recombinant DNA and application thereof | |
| Papagianni et al. | Cloning and functional expression of the mitochondrial alternative oxidase gene (aox1) of Aspergillus niger in Lactococcus lactis and its induction by oxidizing conditions | |
| CN112175981A (en) | Vibrio harveyi site-directed gene knockout method based on stimulation of absolute ethyl alcohol or sodium dodecyl sulfate | |
| CN108893470B (en) | Non-coding RNA OsiR with oxidation resistance and high temperature stress resistance and application thereof | |
| CN115976058B (en) | Toxin gene and application thereof in construction of recombinant and/or gene-edited engineering bacteria | |
| CN114941005B (en) | Recombinant expression vector, genetically engineered bacterium for degrading phenol and application of genetically engineered bacterium | |
| CN112553236B (en) | Efficient expression system based on heterogeneous population induction | |
| CN114958853A (en) | Low-sugar response inducible promoter derived from aspergillus niger, method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |