CN108893471A - One special promoter P-osi for responding oxidative stress signal and its application - Google Patents

One special promoter P-osi for responding oxidative stress signal and its application Download PDF

Info

Publication number
CN108893471A
CN108893471A CN201810666544.XA CN201810666544A CN108893471A CN 108893471 A CN108893471 A CN 108893471A CN 201810666544 A CN201810666544 A CN 201810666544A CN 108893471 A CN108893471 A CN 108893471A
Authority
CN
China
Prior art keywords
promoter
osi
oxidative stress
gene
application
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810666544.XA
Other languages
Chinese (zh)
Other versions
CN108893471B (en
Inventor
林敏�
周正富
张维
陈明
高丽华
战嵛华
燕永亮
陆伟
柯秀彬
王劲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biotechnology Research Institute of CAAS
Original Assignee
Biotechnology Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotechnology Research Institute of CAAS filed Critical Biotechnology Research Institute of CAAS
Priority to CN201810666544.XA priority Critical patent/CN108893471B/en
Publication of CN108893471A publication Critical patent/CN108893471A/en
Application granted granted Critical
Publication of CN108893471B publication Critical patent/CN108893471B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Present invention finds one can respond oxidative stress signal, activate the promoter sequence of downstream destination gene expression.By constructing the fusion expression vector containing the promoter, and expression vector is gone to respectively in the industrial microorganisms fermentation strain such as Escherichia coli, bacillus subtilis and corynebacterium glutamicum, obtains three plants of recombinant strains.It is experimentally confirmed that promoter sequence of the invention has application value in the expression that can specifically start downstream target gene, in the related fieldss such as microbiological genetic engineering and Fermentation Engineering under oxidative stress conditions.

Description

One special promoter P-osi for responding oxidative stress signal and its application
Technical field：
The present invention relates to the promoter DNA sequences that one can specifically respond oxidative stress signal.The invention further relates to this Application of the promoter in microbial fermentation industry and genetic engineering field.
Background technique：
Modern biotechnology is one kind that various utilities are produced using the growth of microorganism and corresponding metabolic activity Engineering technology, and engineering strain is the research hotspot of entire modern biotechnology.Engineering strain is when producing fermentation A variety of environment-stress that high concentration substrate and product are formed usually are faced, lead to occur a large amount of active oxygen radicals in strain cell (ROS) microbial physiology Function, the production of restriction micro-organisms yield and purpose product are influenced.Consequently found that can specifically ring The promoter sequence for answering oxidative stress signal carries out genetic modification to microbial strains, to enhance microorganism to oxidative stress Response efficiency and adaptability.
Many bacterium non-coding RNAs during cellular stress can high efficient expression, and then answered in the stress of bacterium It answers and plays important adjustment effect in reaction system.Deinococcus radiodurans (Deinococcus radiodurans) have Extremely strong environment stress adaptability, to strong oxidizer (such as hydrogen peroxide), high temperature, radiation (UV radiation, γ are radiated) and arid Deng resistance all with super strength.Research in recent years in relation to Anti-radiation Microbes ncRNA is it has been reported that resistance to spoke is thought in related research It penetrates abnormal cocci ncRNA and has played extremely important effect in the stress resistances reaction such as radiation, oxidation.
Summary of the invention：
The purpose of the present invention is obtaining one to be able to respond oxidative stress signal, and being capable of the transcription of effectively start target gene Promoter DNA sequence, to be applied to the transformation of engineered strain in Fermentation Engineering and genetic engineering.
Present invention firstly discovers that a non-coding RNA OsiR gene of Deinococcus radiodurans, which can be special Response oxidative stress signal is transcribed, and adjusting function is played.
The promoter sequence of non-coding RNA OsiR is identified by the experiment present invention and confirms its function：
The identification of 1.OsiR gene and its promoter P-Osi analysis
The present inventor is in the transcriptome analysis process for carrying out Deinococcus radiodurans (Deinococcus radiodurans) In, a kind of non-coding RNA new gene of transcribed functional property is had found for the first time, expression is induced (Fig. 1) by oxidative stress, The life process for participating in the resistance adverse circumstance of bacterium, is named as OsiR gene.
Transcription initiation site and the direction for determining OsiR are tested by 5'-RACE.The result shows that the transcription initiation position of OsiR Point starts from an adenine (A), determines that the gene region of the upstream 170bp from the transcription initiation site is the starting of OsiR gene Son is named as P-Osi (Fig. 2), and nucleotide sequence is SEQ ID NO：1.
2. constructing promoter P-Osi fusion expression vector, and it is transferred to 3 kinds of different bacteriums respectively, obtains 3 kinds of recombinant expression bacterium Strain
Complete promoter P-Osi segment is obtained using PCR amplification, cloned sequence carries out MulI and SpeI double digestion, inserts Enter to before the reporter gene lacZ of promoter expression vector pRADZ3, obtains the amalgamation and expression of promoter P-Osi and lacZ gene Carrier pRAD-P-Osi-lacZ (Fig. 3).The expression vector is transferred to Escherichia coli (Escherich coli), withered grass bud respectively Spore bacillus (Bacillus subtilis) or corynebacterium glutamicum (Corynebacterium glutamicum) obtain 3 kinds Recombinant strains：E.coli(P-Osi-lacZ)；B.subtillis(P-Osi-lacZ)；C.glutamicum(P-Osi- lacZ)。
3. promoter P-Osi is to the confirmatory experiment of the response of oxidative stress signal
Above-mentioned 3 kinds of recombinant strains are subjected to H respectively2O2Oxidative stress processing, measurement is under inductive condition in recombinant bacterium The enzyme activity of lacZ gene coded product beta galactosidase.Result of study shows that in 3 plants of recombinant bacteriums, oxidative stress signal can Activate the translation of the expression starting lacZ gene of promoter of the present invention.
It is experimentally confirmed that promoter of the present invention is either in 3 kinds of industrial microorganism zymophytes under oxidative stress conditions The expression that can specifically, efficiently start target gene in strain, can be applied to the genetic modification of microbial fermentation engineering bacterial strain. Sequence information
SEQ ID NO:1：The promoter P-Osi nucleotide sequence of non-coding RNA OsiR gene
Detailed description of the invention
Fig. 1：The promoter Analysis of non-coding RNA OsiR gene in Deinococcus radiodurans
The transcription initiation site of osiR gene indicates that transcriptional orientation is indicated by an arrow with underscore in figure.Promoter sequence It is indicated with black runic；
Fig. 2：The analysis of Deinococcus radiodurans non-coding RNA osiR oxidative stress signal response；
Fig. 3：Promoter P-Osi and target gene amalgamation and expression schematic diagram；
Fig. 4：The enzyme activity determination result of the lower 3 plants of recombinant strains beta galactosidases of oxidative stress
Wherein, E, B, C respectively represent E.coli (P-Osi-lacZ)；B.subtillis(P-Osi-lacZ)； C.glutamicum(P-Osi-lacZ)。
Specific embodiment
Present invention will be further explained below with reference to specific examples.Embodiment is only used for the method illustrated the present invention, It is unable to limit the scope of the invention.It is all that specific experiment condition is not specified, it is according to well known to those skilled in the art Normal condition or according to the normal condition proposed by manufacturer.
The identification and its promoter Analysis of 1 non-coding RNA OsiR gene of embodiment
One, experimental material：
Test strain：Deinococcus radiodurans (Deinococcus radiodurans)
It purchases in China General Microbiological culture presevation administrative center, strain number CGMCC 1.633.
Two, experimental method：
The transcription initiation site and transcriptional orientation of osiR has been determined by 5 ' RACE experimental methods.Specific steps reference 5 '/3 ' RACE Kit kit specifications of Roche company.Target fragment gel extraction is subjected to sequence, sequencing is obtained The sequence obtained is by being compared the final transcription initiation for determining OsiR with the sequence in Deinococcus radiodurans genome Site and direction.
Three, experimental result：
By 5 ' RACE, the experimental results showed that, osiR is reverse transcription, and transcription initiation is in an adenine (A).Meanwhile Sequence analysis, which is carried out, by the promoter region of the transcription initiation site upstream determined 5 ' RACE has found conservative -10th area and -35 Area (AGGAAA-N17-TAAAAT), the gene region of upstream 170bp is the starting of OsiR gene from the transcription initiation site Son is named as P-Osi (Fig. 1)
Four, experiment conclusion：
Result of study shows that osiR is reverse transcription, and transcription initiation rises in an adenine (A), the transcription initiation site The gene region of upstream 170bp is the promoter of OsiR gene, is named as P-Osi.
Signature analysis is expressed under 2 non-coding RNA OsiR gene oxidative stress of embodiment
One, experimental material：
Test strain：Deinococcus radiodurans (Deinococcus radiodurans)
It purchases in China General Microbiological culture presevation administrative center, strain number CGMCC 1.633.
Two, experimental method：
(1) Deinococcus radiodurans are activated in TGY fluid nutrient medium, 30 DEG C are incubated overnight.Next day is forwarded to TGY training It supports in base and cultivates to OD for 30 DEG C600≈1.0；
(2) 1mL thallus is respectively taken first, as control, then respectively takes 1mL thallus that final concentration of 80mmol/L is added again H2O2, 30 DEG C of impact 30min；
(3) 8000 × g are centrifuged 5min, collect thallus.Bacterium total serum IgE is extracted using Promega kit Z3741, will be made The identical sample RNA of dosage carries out cDNA reversion；
(4) expression of OsiR gene under the conditions of Different stress is analyzed by qRT-PCR method.
Three, experimental result：
Result of study shows, under the conditions of untreated compared with, H2O2The transcriptional level of OsiR gene is aobvious under oxidative stress conditions It writes and improves, be up to about 51 times (Fig. 2).
Four, experiment conclusion：
The experimental results showed that OsiR is induced by oxidative stress, the signal generated during oxidative stress can be responded, it is regulated and controled The expression of its gene.
The building of 3 promoter P-Osi fusion expression vector of embodiment
One, experimental material：
Carrier：pRADZ3：This laboratory saves plasmid
F-strain：E.coli, B.subtilis and C.glutamicum：This laboratory saves bacterial strain
Two, experimental method：
(1) PCR amplification of OsiR promoter gene fragment：Using Deinococcus radiodurans genomic DNA as template, using drawing Object P-Osi-F and P-Osi-R carry out the segment that PCR amplification obtains the promoter P-Osi that length is about 170bp；
Primer：
P-Osi-F：ACCACGCGTGATGTTTACGAATGACAGG
P-Osi-R：CCGACTAGTGTCTGTTTTTAGCGTGTTAG
(2) building of OsiR gene promoter expression vector：The OsiR promoter gene fragment that PCR amplification is obtained carries out It after MulI and SpeI double digestion, is connected on promoter detection carrier pRADZ3, picking positive colony extracts plasmid, digestion and PCR LacZ fusion vector pRAD-P-Osi-lacZ is obtained after verifying.
(3) acquisition of recombinant strains：The promoter pnfiS fusion expression vector of building is transferred to by electric shock respectively In E.coli, B.subtilis and C.glutamicum, 3 plants of recombinant strains are obtained by resistance screening and PCR verifying.
Three, experimental result：
Success constructs fusion vector pRAD-P-Osi-lacZ, and promoter P-Osi is inserted in the upstream reporter gene lacZ (figure 3).By Electroporation conversion by fusion vector pRAD-P-Osi-lacZ distinguish Transformed E .coli, B.subtilis and In C.glutamicum, recombinant strains are obtained.
Four, experiment conclusion：
Construct the fusion expression vector pRAD-P-Osi-lacZ of promoter P-Osi and lacZ gene.Obtain 3 kinds of recombination tables Up to bacterial strain：E. coli (P-Osi-lacZ)；Bacillus subtilis B.subtilis (P-Osi-lacZ)；Glutamic acid rod Shape bacillus C.glutamicum (P-Osi-lacZ).
The determination of activity of the lower 3 plants of recombinant strains beta galactosidases of 4 oxidative stress of embodiment
One, experimental material：
Experimental strain：E. coli (P-Osi-lacZ)；Bacillus subtilis B.subtilis (P-Osi- lacZ)；Corynebacterium glutamicum C.glutamicum (P-Osi-lacZ).
Two, experimental method：
The betagalactosidase activity method for measuring of E.coli, B.thuringiensis, C.glutamicum are as follows：
(1) 3 plants of recombinant bacterial strain single colonies are picked them separately, antibiotic LB liquid medium is inoculated in, is incubated overnight.Its Middle E.coli (P-Osi-lacZ) cultivation temperature is 37 DEG C, and the cultivation temperature of remaining 2 plants of recombinant bacterial strain is 30 DEG C.Next day according to 2% switching amount is inoculated in fresh LB liquid medium, surveys bacterium solution OD600Value, until OD600Value reaches 0.6 or more, is separately added into 40、60mmol/L H2O2, 10min is impacted, does not impact bacterial strain as negative control；
(2) appropriate bacterium solution is taken, 4 DEG C, 5,000 × g is centrifuged 5min, abandons supernatant, twice with sterile washing, abandons supernatant.On demand It will suspension thalline again.Thallus suspension liquid is mixed with bufferZ, makes total volume 1mL, and 2-3 drop chloroform is added, and is mixed.It uncaps In 37 DEG C of heat preservation 40min.30 DEG C of heat preservation 5min are transferred to, 200 μ L (4.0mg/mL) ortho-nitrophenyl-β-D- gala pyrans are added later Glucosides (ONPG) continues to keep the temperature for 30 DEG C, starts to react after mixing, record reaction initial time.There is yellow to sample, adds The Na of 500 μ L 1mol/L2CO3Reaction is terminated, records the reaction terminating time, sample is put to be measured on ice.
(3) OD is measured respectively with ultraviolet specrophotometer420And OD550Value.Beta galactosidase is calculated according to following formula Activity value
β-Galactosidase Units=1000 × (OD420-1.75×OD550)/(T×V×OD600)。
The each of the above experiment of every plant of recombinant strains carries out parallel laboratory test three times, obtained the result is that calculating The betagalactosidase activity value of the mean error of independent experiment three times.
Three, experimental result：
The H of various concentration2O2Impact can activate promoter sequence of the present invention, and then improve the table of reporter gene lacZ It reaches, the activity and H of promoter P-Osi2O2Concentration is positively correlated (Fig. 4).Wherein：
H of the E. coli (P-Osi-lacZ) in 40mM2O2The activity of beta galactosidase is under impact induced 192.2 ± 7.26U, and in the H of 60mM2O2Under impact induced, the activity of beta galactosidase further increased as 446.3 ± 12.40U。
H of the bacillus subtilis B.subtilis (P-Osi-lacZ) in 60mM2O2Under impact induced, beta galactosidase Activity be 293.7 ± 21.32U；
Corynebacterium glutamicum C.glutamicum (P-Osi-lacZ)) in the H of 60mM2O2Under impact induced, beta galactose The activity of glycosides enzyme also rises to 385.3 ± 19.19U.
Illustrate in the case where aoxidizing saturating stress conditions, promoter P-Osi can be special in 3 plants of different industrial microorganism bacterial strains Expression that is different, efficiently starting downstream target gene.
Four, experiment conclusion：
Present invention discover that promoter can specifically respond oxidative stress signal, start destination gene expression, can apply The transformation of engineered strain in Fermentation Engineering and genetic engineering.
Sequence table
<110>Biological Technology institute, Chinese Academy of Agricultural Sciences
<120>One special promoter P-osi for responding oxidative stress signal and its application
<160> 1
<170> PatentIn version 3.1
<210> 1
<211> 170
<212> DNA
<213>Deinococcus radiodurans（Deinococcus radiodurans）
<400> 1
gatgtttacg aatgacaggt agcggggagc ataaccctgt ataagcgtga ggagttatgc 60
agagcacctg tataggactg gcgattgccc ggcctttcac tagggaacat agcaagtgac 120
cagaaggcga tgaggcagga aaaatatcgt ctaacacgct aaaaacagac 170

Claims (5)

1. a response oxidative stress signal and the efficiently promoter of startup function gene expression, nucleotide sequence such as SEQ ID NO：Shown in 1.
2. promoter described in claim 1 is in the application of genetic engineering and Fermentation Engineering.
3. application as claimed in claim 2 is that the promoter being capable of effectively start target gene under oxidative stress conditions Expression.
4. application of the fusion expression vector containing promoter described in claim 1 in the expression product of culturing gene engineering bacteria.
5. application as claimed in claim 4, the genetic engineering bacterium are to distinguish fusion expression vector as claimed in claim 4 It is transferred to obtained following recombination engineering：Escherichia coli (Escherich coli), bacillus subtilis (Bacillus ) or corynebacterium glutamicum (Corynebacterium glutamicum) subtillis.
CN201810666544.XA 2018-06-26 2018-06-26 Promoter P-osi specifically responding to oxidative stress signal and application thereof Active CN108893471B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810666544.XA CN108893471B (en) 2018-06-26 2018-06-26 Promoter P-osi specifically responding to oxidative stress signal and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810666544.XA CN108893471B (en) 2018-06-26 2018-06-26 Promoter P-osi specifically responding to oxidative stress signal and application thereof

Publications (2)

Publication Number Publication Date
CN108893471A true CN108893471A (en) 2018-11-27
CN108893471B CN108893471B (en) 2021-11-02

Family

ID=64346034

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810666544.XA Active CN108893471B (en) 2018-06-26 2018-06-26 Promoter P-osi specifically responding to oxidative stress signal and application thereof

Country Status (1)

Country Link
CN (1) CN108893471B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111733089A (en) * 2020-05-12 2020-10-02 北京理工大学 Strain construction method for improving saccharomyces cerevisiae robustness

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105002201A (en) * 2015-05-11 2015-10-28 中国农业科学院生物技术研究所 Application of deinococcus geothermalis Dgeo0395 in enhancing adverse resistance of cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105002201A (en) * 2015-05-11 2015-10-28 中国农业科学院生物技术研究所 Application of deinococcus geothermalis Dgeo0395 in enhancing adverse resistance of cells

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHEN-HSUN TSAI等: "Transcriptional analysis of Deinococcus radiodurans reveals novel small RNAs that are differentially expressed under ionizing radiation", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 *
GENBANK ACCESSION NO：NC_001263.1: "Deinococcus radiodurans R1 chromosome 1, complete sequence", 《GENBANK》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111733089A (en) * 2020-05-12 2020-10-02 北京理工大学 Strain construction method for improving saccharomyces cerevisiae robustness

Also Published As

Publication number Publication date
CN108893471B (en) 2021-11-02

Similar Documents

Publication Publication Date Title
Holguin et al. Genetics and molecular biology of Azospirillum
CN107502585A (en) One plant of bacillus licheniformis engineering bacteria for efficiently synthesizing poly- γ glutamic acid
CN111926013B (en) Promoter suitable for bacillus licheniformis and application thereof in high-efficiency expression of target product
US11130973B1 (en) Recombinant strain for producing L-lactic acid
CN102174557A (en) Recombinant spores of surface displayed silkworm alcohol dehydrogenases and preparation method of same
CN106636168A (en) Method for regulating and controlling synthesis of EPS (extracellular polymeric substance) of clostridium acetobutylicum
CN101880676A (en) Constructing method of nifA gene-introduced rhizobium japonicum genetic engineering bacterial strain HD-SFH-01
CN107881140A (en) The Leuconostoc mesenteroides mutant strain of one plant height production mannitol and its application process
WO2008043368A2 (en) Method for obtaining endospores of sporogenous fermentable thermophilic strains of microorganism and use of the obtained endospores to inoculate fermentation
CN108893471A (en) One special promoter P-osi for responding oxidative stress signal and its application
CN114891806B (en) Citrobacter welchii yqjH gene knockout mutant strain and application thereof
CN106916797A (en) A kind of high activity Laccase mutant albumen and preparation method thereof
CN113583931B (en) Citrobacter williamsii ansB gene knockout mutant strain and application thereof
CN104877997B (en) One special promoter for responding Osmotic Stress Signal Transduction and application
CN104862315B (en) A kind of gene for maintaining bacterial strain high-efficiency nitrogen-fixing ability
CN107299074B (en) Construction method and application of formate dehydrogenase engineering strain
CN111961634B (en) Bacillus amyloliquefaciens engineering bacterium for efficiently inhibiting staphylococcus aureus
CN105316383B (en) A method of improving the oxytetracycline yield of streptomycete by gene disruption
CN115976058B (en) Toxin gene and application thereof in construction of recombinant and/or gene-edited engineering bacteria
CN111057710A (en) Construction method of lactobacillus with enhanced stress tolerance, recombinant lactobacillus and application thereof
US20230002796A1 (en) Method for inducing microbial mutagenesis to produce lactic acid
CN108359629A (en) Hydrogenlike silicon ion recombinant bacterium and its construction method and application
CN114958853B (en) Low-sugar response inducible promoter derived from aspergillus niger, method and application thereof
CN115747230B (en) Deinococcus radiodurans dodH gene and method for improving biological stress resistance thereof
CN101892228A (en) Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant