CN114958853A

CN114958853A - Low-sugar response inducible promoter derived from aspergillus niger, method and application thereof

Info

Publication number: CN114958853A
Application number: CN202210672393.5A
Authority: CN
Inventors: 刘浩; 曹威; 谢慧珍
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2022-06-15
Filing date: 2022-06-15
Publication date: 2022-08-30

Abstract

The invention discloses a low-sugar response inducible promoter from Aspergillus niger, a method and application thereof, wherein the nucleotide sequence of the promoter is SEQ ID NO. 3. Under the condition of different glucose concentrations, a low-sugar high-expression inducible promoter is screened out, and the expression of the nucleic acid which is effectively connected can be regulated and controlled in Aspergillus niger. And further, the glucose oxidase is used as an application to confirm that the Pfrd is a low-sugar high-expression inducible promoter, so that an effective method is provided for effectively solving the problem that the synthesis of a target product is reduced due to insufficient carbon source in the late fermentation stage of Aspergillus niger.

Description

Low-sugar response inducible promoter derived from aspergillus niger, method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a low-sugar response inducible promoter from aspergillus niger, a method and application thereof.

Background

Aspergillus niger (Aspergillus niger) belongs to the genus Aspergillus filamentous fungi. Conidiophores of the conidiophores are radial, and the conidiophores are spherical brown black, and generally grow in soil, rotten plants and the like. Aspergillus niger belongs to GRAS strains, has clear genetic background, can efficiently produce organic acid, and is widely applied to industrial fermentation. At present, the problems of reduced synthesis capacity of target products caused by reduction of carbon sources in the late fermentation period and insufficient secretion power of fermentation products exist in the fermentation production process of aspergillus niger, so that the promoter of the aspergillus niger is excavated and identified, some promoter elements responding to special conditions (low sugar and low pH) are expected to be screened, a gene expression element library is enriched, and a certain element support is provided for construction of engineering strains.

Through searching, no patent publication related to the present patent application has been found.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a low-sugar response inducible promoter from aspergillus niger, a method and application thereof.

The technical scheme adopted by the invention for solving the technical problems is as follows:

a low-sugar response inducible promoter derived from Aspergillus niger, wherein the nucleotide sequence of the promoter is SEQ ID NO. 3.

Further, the promoter is a promoter of fumarate reductase ANI _1_944144 and is named as Pfrd;

alternatively, the low sugar is in a concentration environment of 10g/L or less.

The promoter is applied to the aspect of regulating and controlling the expression of the gene goxA.

The method for regulating the expression of the gene goxA by utilizing the promoter is characterized in that a vector containing the promoter is transformed into an Aspergillus niger cell and/or a filamentous fungus cell, and fermentation culture is carried out under the low sugar condition;

wherein, the promoter in the vector is connected with a heterologous gene, and the heterologous gene is controlled by the promoter.

Further, the heterologous gene is a goxA gene, and the nucleotide sequence of the goxA gene is SEQ ID NO. 1;

or, by transforming an expression cassette containing a promoter, a heterologous gene, a terminator into a host cell;

alternatively, the filamentous fungal cell is Aspergillus oryzae, Trichoderma reesei.

A plasmid comprising the promoter as described above, characterized in that: the plasmid is a plasmid which takes Pfrd as a promoter to regulate the expression of a goxA gene, and the nucleotide sequence of the goxA gene is SEQ ID NO. 1.

An expression vector comprising the promoter as described above.

An engineered strain comprising a promoter as described above.

Further, the modified bacteria are obtained by transforming an expression frame containing a promoter, a reporter gene goxA sequence and a terminator into host cells of Aspergillus niger and filamentous fungi;

wherein the nucleotide sequence of the goxA gene is SEQ ID NO. 1;

the filamentous fungus cell is Aspergillus oryzae or Trichoderma reesei.

Further, the modified strain is hygromycin sensitive strain S2361, modified strain Aspergillus oryzae and modified strain Trichoderma reesei;

the construction method of the hygromycin sensitive strain S2361 comprises the following steps:

co-culturing Agrobacterium containing plasmid pLH1442 and spores of S1691 on an IM plate, then transferring the co-culture into a CM plate containing 200. mu.M cefotaxime, 100. mu.g/mL ampicillin, 100. mu.g/mL streptomycin and 250. mu.g/mL hygromycin B, and culturing at 28 ℃ until monoclonals are formed; selecting a single clone to be transferred to a PDA (personal digital assistant) plate containing hygromycin B, screening hygromycin B resistant transformants, extracting a genome for verification, collecting correct transformant spores, inoculating the correct transformant spores to the doxycycline plate containing 30 microgram/mL, and inducing an hph resistance screening marker to be deleted from the genome to obtain a hygromycin sensitive strain S2361;

the construction method of the modified strain aspergillus oryzae comprises the following steps:

co-culturing Agrobacterium containing plasmid pLH1442 with spores of wild type Aspergillus oryzae on IM plates, spreading the co-culture on a solid plate of Chacker's medium containing 100. mu.g/mL cefotaxime, 100. mu.g/mL ampicillin, 150. mu.g/L hygromycin B, and culturing at 28 ℃ until single clones are formed; selecting a single clone to extract a genome for verification, and obtaining a modified strain aspergillus oryzae;

the construction method of the modified strain trichoderma reesei comprises the following steps:

co-culturing Agrobacterium containing plasmid pLH1442 and wild type Trichoderma reesei spores on an IM plate, then spreading the co-culture on a CM plate containing 100. mu.g/mL cefotaxime and 150. mu.g/mL hygromycin B, and culturing at 28 ℃ until monoclonals are formed; selecting a monoclonal extracted genome for verification to obtain a modified strain trichoderma reesei;

wherein the construction method of the plasmid pLH1442 comprises the following steps:

(1) construction of the pLH1288 plasmid: carrying out PCR amplification on a goxA gene sequence fragment by taking the cDNA of the Aspergillus niger S469 strain as a template and the goxA-F, goxA-R as a primer, wherein the nucleotide sequence is SEQ ID NO.1, and the length is 1770 bp; taking the genome of the Aspergillus niger S469 strain as a template and Ttrpc-F, Ttrpc-R as a primer to amplify a Ttrpc fragment, wherein the nucleotide sequence is SEQ ID NO.2, and the length is 719 bp; then carrying out overlapping PCR on the obtained goxA fragment and the Ttrpc fragment; connecting the Ttrpc fragment with a starting vector pLH924 linearized by double enzyme digestion of BamH I and Sac I, transforming competent cells of escherichia coli JM109 by the connecting product, uniformly coating the competent cells in an LB culture dish containing 100 mu g/mL kanamycin, carrying out overnight culture at 37 ℃, selecting a single clone, and carrying out single enzyme digestion verification to obtain a plasmid pLH 1288;

wherein the sequence of the goxA-F is SEQ ID NO.5, the sequence of the goxA-R is SEQ ID NO.6, the sequence of the Ttrpc-F is SEQ ID NO.7, and the sequence of the Ttrpc-R is SEQ ID NO. 8;

(2) construction of the pLH1442 plasmid:

amplifying a Pfrd fragment by taking an Aspergillus niger S469 strain genome as a template and Pfrd-F, Pfrd-R as a primer, wherein the nucleotide sequence is SEQ ID NO.3, and the length is 1023 bp; connecting the Pfrd fragment with a starting vector pLH1288 which is linearized by BglII enzyme digestion, transforming Escherichia coli JM109 competent cells of the connection product, uniformly coating the competent cells in an LB culture dish containing 100 mu g/mL kanamycin, carrying out overnight culture at 37 ℃, selecting a single clone, and carrying out double enzyme digestion verification to obtain a plasmid pLH 1442;

wherein, the sequence of Pfrd-F is SEQ ID NO.9, and the sequence of Pfrd-R is SEQ ID NO. 10.

The invention has the advantages and positive effects that:

1. the invention successfully screens a low-sugar inducible promoter from Aspergillus niger through transcriptome analysis, provides a method for starting gene expression under the low-sugar condition, and provides an effective solution strategy for synthesis reduction of a target product caused by insufficient sugar in the late fermentation stage of Aspergillus niger.

2. Under the condition of different glucose concentrations, a low-sugar high-expression inducible promoter is screened out, and the expression of the nucleic acid which is effectively connected can be regulated and controlled in Aspergillus niger. And further, the glucose oxidase is used as an application to confirm that the Pfrd is a low-sugar high-expression inducible promoter, so that an effective method is provided for effectively solving the problem that the synthesis of a target product is reduced due to insufficient carbon source in the late fermentation stage of Aspergillus niger.

Drawings

FIG. 1 is a graph showing the relative expression levels of four low sugar inducible promoters under different sugar conditions in accordance with the present invention;

FIG. 2 is a graph of a plasmid pLH1288 of the goxA reporter gene constructed in the invention;

FIG. 3 is a single restriction enzyme digestion verification diagram (Mlu I, 11381bp/3659bp) for pLH1288 in the present invention, wherein M is DNA Marker;

FIG. 4 is a diagram of pLH1442 of a Pfrd: goxA plasmid constructed in the present invention;

FIG. 5 shows a diagram of validation of pLH1442 by double digestion (BamH I/Sal I, 14875bp/1182bp) in the present invention, wherein M is DNA Marker;

FIG. 6 is a drawing of a plasmid pLH1445 of goxA constructed in the present invention;

FIG. 7 shows a double restriction verification of pLH1445 (Hind III/Bgl II, 7682bp/5281bp/3173bp) in the present invention, wherein M is DNA Marker;

FIG. 8 is a color verification of S1691, S2351 and S2361 in the present invention;

FIG. 9 shows the expression levels of the goxA gene of the present invention under different sugar levels (1g/L, 50g/L and 100g/L) for S2361;

FIG. 10 shows the expression levels of the goxA gene in the modified Aspergillus oryzae (Pfrd:: goxA) of the present invention at different sugar levels (1g/L, 50g/L, and 100 g/L);

FIG. 11 shows the expression levels of the goxA gene of the modified Trichoderma reesei (Pfrd:: goxA) of the present invention under different sugar amounts (1g/L, 50g/L and 100 g/L).

Detailed Description

The present invention is described in detail below with reference to the following examples, which are intended to be illustrative and not limiting, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

Preferably, the promoter is a promoter of fumarate reductase ANI _1_944144, and is named as Pfrd;

Preferably, the heterologous gene is a goxA gene, and the nucleotide sequence of the goxA gene is SEQ ID NO. 1;

An expression vector comprising the promoter as described above.

An engineered strain comprising a promoter as described above.

Preferably, the modified bacteria are obtained by transforming an expression frame containing a promoter, a reporter gene goxA sequence and a terminator into host cells of aspergillus niger and filamentous fungi;

wherein the nucleotide sequence of the goxA gene is SEQ ID NO. 1;

the filamentous fungus cell is Aspergillus oryzae or Trichoderma reesei.

Preferably, the modified strain is hygromycin sensitive strain S2361, modified strain Aspergillus oryzae and modified strain Trichoderma reesei;

co-culturing Agrobacterium containing plasmid pLH1442 and spores of wild type Trichoderma reesei on an IM plate, then spreading the co-culture on a CM plate containing 100. mu.g/mL cefotaxime and 150. mu.g/mL hygromycin B, and culturing at 28 ℃ until a single clone is formed; selecting a monoclonal extracted genome for verification to obtain a modified strain trichoderma reesei;

(1) construction of the pLH1288 plasmid: carrying out PCR amplification on a goxA gene sequence fragment by taking the cDNA of the Aspergillus niger S469 strain as a template and the goxA-F, goxA-R as a primer, wherein the nucleotide sequence is SEQ ID NO.1, and the length is 1770 bp; the genome of the Aspergillus niger S469 strain is taken as a template, Ttrpc-F, Ttrpc-R is taken as a primer to amplify a Ttrpc fragment, the nucleotide sequence is SEQ ID NO.2, and the length is 719 bp; then carrying out overlapping PCR on the obtained goxA fragment and the Ttrpc fragment; connecting the Ttrpc fragment with a starting vector pLH924 linearized by double enzyme digestion of BamH I and Sac I, transforming competent cells of escherichia coli JM109 by the connecting product, uniformly coating the competent cells in an LB culture dish containing 100 mu g/mL kanamycin, carrying out overnight culture at 37 ℃, selecting a single clone, and carrying out single enzyme digestion verification to obtain a plasmid pLH 1288;

(2) construction of the pLH1442 plasmid:

Specifically, the preparation and detection examples are as follows:

the invention takes glucose oxidase in aspergillus niger as a primary application, glucose generates gluconic acid and hydrogen peroxide under the action of the glucose oxidase, the hydrogen peroxide generates oxygen under the action of horseradish peroxidase, colorless hydrazinium course is oxidized to generate red quinonimine, and the shade of the color of the red quinonimine is in direct proportion to the content of the glucose. The transcription of a glucose oxidase coding gene goxA is controlled by expressing an inducible promoter responding with low sugar in a glucose oxidase defect body, the strength of the promoter is judged according to the shade of the color of a product under different glucose contents, and a strain with weaker strength and the promoter of a promoter pigment gene pptA for controlling the transcription of the goxA is used as a contrast.

In the invention, a promoter with the ANI-1-944144 gene is obtained by carrying out transcriptome and RT-qPCR verification analysis on Aspergillus niger S469 (Chinese patent, patent number: ZL201810985901.9) under the condition of different glucose concentrations, and the strength of the promoter is increased along with the reduction of the external glucose concentration (as shown in figure 1). The invention takes a glucose oxidase coding gene as a reporter gene, proves that the ANI _1_944144 promoter is a low-sugar (< 10g/L) high-expression inducible promoter, and provides a low-sugar high-expression inducible promoter for effectively solving the problem of reduced synthesis of a target product caused by insufficient sugar in the late fermentation stage of Aspergillus niger.

Example 1 construction of the pLH1288 plasmid (FIG. 2): plasmid pLH924 (Lemennov. identification and functional research of mitochondrial citrate transporter in Aspergillus niger [ D ] Tianjin science and technology university, 2021.), which has an amylase gene amyA homology arm in its expression frame, can realize the site-directed knockout of the gene and eliminate the interference of position effect on the promoter strength.

The specific construction process is as follows: carrying out PCR amplification on a goxA gene sequence fragment by taking the cDNA of the Aspergillus niger S469 strain as a template and the goxA-F, goxA-R as a primer, wherein the nucleotide sequence is SEQ NO.1, and the length is 1770 bp; taking the genome of the Aspergillus niger S469 strain as a template and Ttrpc-F, Ttrpc-R as a primer to amplify a Ttrpc fragment, wherein the nucleotide sequence is SEQ NO.2, and the length is 719 bp; the obtained goxA fragment and Ttrpc fragment were then subjected to overlap PCR. Ttrpc fragment and starting vector pLH924 linearized by double digestion of BamH I and Sac I are ligated by using Novozan C113-Clon express-MultiS One Step Cloning Kit, the ligation product is transformed into competent cells of Escherichia coli JM109, and is evenly spread on LB culture dish containing 100. mu.g/mL kanamycin, cultured overnight at 37 ℃, single clone is picked up, and plasmid pLH1288 is obtained by single digestion verification (FIG. 3). Primers for amplifying the gene sequence fragments are shown in Table 1.

Example 2 construction of the pLH1442 plasmid (FIG. 4):

pLH1442 is transformed from pLH1288 vector, and the goxA gene is transcribed under the control of fumarate reductase gene promoter Pfrd.

The specific construction process is as follows: amplifying a Pfrd fragment by taking an Aspergillus niger S469 strain genome as a template and Pfrd-F, Pfrd-R as a primer, wherein the nucleotide sequence is SEQ NO.3, and the length is 1023 bp; the Pfrd fragment and the starting vector pLH1288 linearized by Bgl II enzyme digestion are connected by using a Novozan C113-Clon express-MultiS One Step Cloning Kit, the connected product is transformed into escherichia coli JM109 competent cells, the competent cells are uniformly coated on an LB culture dish containing 100 mu g/mL kanamycin and cultured overnight at 37 ℃, a single clone is selected, and the plasmid pLH1442 is obtained by double enzyme digestion verification (figure 5). Primers for amplifying the gene sequence fragments are shown in Table 1.

Example 3 construction of the pLH1445 plasmid (FIG. 6):

pLH1445 was engineered from pLH1288 vector and the goxA gene transcription was controlled by a constitutive weak promoter PpptA.

The specific construction process is as follows: taking the genome of the Aspergillus niger S469 strain as a template and PpptA-F, PpptA-R as a primer to amplify a PpptA fragment, wherein the nucleotide sequence is SEQ ID NO.4, and the length is 1000 bp; pppta fragment and starting vector pLH1288 linearized by Bgl II and BamH I are ligated by using Novozan C113-Clonexpress-MultiS One Step Cloning Kit, the ligation product is transformed into competent cells of Escherichia coli JM109, and the competent cells are uniformly spread on LB culture dish containing 100. mu.g/mL kanamycin, cultured overnight at 37 ℃, single clone is selected, and plasmid pLH1445 is obtained by double enzyme digestion verification (FIG. 7). Primers for amplifying the gene sequence fragments are shown in Table 1.

Example 4 construction of low sugar high expression Aspergillus niger strains: the starting bacterium S1691 (Zhouyu Tao. identification and functional application of Aspergillus niger glucose oxidase coding gene [ D ]. Tianjin science and technology university, 2020.) is a goxA defect body and does not produce gluconic acid.

Agrobacterium containing plasmid pLH1442 was co-cultured with spores of S1691 on IM plates, and the co-culture was then transferred to CM plates containing 200. mu.M cefotaxime, 100. mu.g/mL ampicillin, 100. mu.g/mL streptomycin, 250. mu.g/mL hygromycin B and cultured at 28 ℃ until single colonies were formed. Selecting a single clone to be transferred to a PDA plate containing hygromycin B, screening hygromycin B resistant transformants, extracting a genome for verification, collecting correct transformant spores, inoculating the correct transformant spores to a doxycycline plate containing 30 mu g/mL, inducing a hph resistance screening marker to be deleted from the genome, and obtaining a hygromycin sensitive strain S2361(Pfrd:: goxA).

Example 5 construction of S2351(PpptA:: goxA) Strain: agrobacterium containing plasmid pLH1445 was co-cultured with spores of S1691 on IM plates, and the co-culture was then transferred to CM plates containing 200. mu.M cefotaxime, 100. mu.g/mL ampicillin, 100. mu.g/mL streptomycin, 250. mu.g/mL hygromycin B and cultured at 28 ℃ until single colonies were formed. Selecting a single clone to be transferred to a PDA plate containing hygromycin B, screening hygromycin B resistant transformants, extracting a genome for verification, collecting correct transformant spores, inoculating the correct transformant spores to a doxycycline plate containing 30 mu g/mL, inducing an hph resistance screening marker to be deleted from the genome, and obtaining a hygromycin sensitive strain S2351(PpptA:: goxA).

Example 6-color development verification of S2361:

firstly, preparing solid chromogenic culture media with different glucose contents (1g/L, 50g/L and 100g/L), pouring the sterilized culture media into a culture dish, cooling, inoculating control bacteria S1691(goxA defect body), S2351(Pppta:: goxA) and S2361(Pfrd:: goxA) onto the chromogenic culture media, pouring the chromogenic culture media into a constant temperature incubator at 28 ℃, taking out a flat plate and placing the flat plate in an ultra-clean workbench after 2 d; heating 10mL of deionized water containing 1% agarose to melt, immediately adding 2mL of developing solution II, 200uL of developing solution I and 400uL of developing solution III after cooling to below 60 ℃, uniformly mixing, pouring into the flat plate, observing the developing condition after 8h, and taking a picture to store the picture. As shown in FIG. 8, S2361 is clearly developed on a color-developing plate with a concentration of 1g/L glucose, but is weakly developed on a medium with 50g/L glucose, and hardly developed at 100g/L glucose, indicating that Pfrd is a low-sugar high-expression inducible promoter.

Wherein, the color developing solution is specifically as follows:

1) solution I: 0.1g o-dianisidine dissolved in 10mL methanol;

2) solution II: an 18% aqueous glucose solution;

3) solution III: 90uL/mL horseradish peroxidase.

Example 7-S2361 (Pfrd:: goxA) expression level of goxA gene under different sugar content conditions (see FIG. 9):

when the low-sugar inducible promoter is verified, the slow growth of thalli under the low-sugar condition is considered, so that an Aspergillus niger liquid culture medium is firstly used as a seed culture medium to culture thalli, and then the thalli are transferred to gluconic acid fermentation culture media with different sugar concentrations to be incubated for a period of time and then subsequent experiments are carried out, so that the maximum degree of experimental conditions is consistent with the measurement conditions of transcriptome data.

The specific experimental process is as follows: inoculating S2361 to PDA culture medium for 4-5 days, collecting spore suspension, inoculating to seed culture medium containing 100g/L glucose, and culturing at 28 deg.C with shaking table at 200rpm for 12 hr. Collecting the above thallus, transferring to gluconic acid fermentation medium containing 1g/L, 50g/L and 100g/L glucose, collecting thallus under different sugar content after 8h, extracting RNA, and reverse transcription kit (Prime Script) with total RNA as template ^TM RT regent Kit with gDNA) to obtain cDNA; using cDNA as template, using Real-time fluorescent Quantitative (RT-qPCR) kit (Quantitative Real-time PCR with TB Green Premix Ex Taq ^TM II) performing amplification. Actin of Aspergillus niger was calculated at 1g/L and 50g/L using 100g/L glucose as controlThe relative expression level of the goxA gene in S2361(Pfrd:: goxA) under glucose conditions was 2 ^-ΔΔCт And (4) showing. As shown in FIG. 9, in S2361, the relative expression level of goxA is 40.44 times up-regulated under 1g/L glucose condition compared with 100g/L glucose condition, whereas the relative expression level of goxA is only 3.02 times up-regulated under 50g/L glucose condition, and Pfrd promoter conforms to the low sugar inducible characteristic. This result further confirms that Pfrd is a low sugar high expression inducible promoter.

Example 8 construction of the transformed bacterium Aspergillus oryzae (Pfrd:: goxA) and expression levels of the goxA gene under different sugar conditions (see FIG. 10):

agrobacterium containing plasmid pLH1442 was co-cultured with spores of wild type Aspergillus oryzae on IM plates, and the co-culture was plated on solid plates of Chacker's medium containing 100. mu.g/mL cefotaxime, 100. mu.g/mL ampicillin, 150. mu.g/L hygromycin B and cultured at 28 ℃ until single colonies were formed. The genome of the single clone is picked up and extracted for verification, and the modified strain Aspergillus oryzae (Pfrd:: goxA) is obtained. Aspergillus oryzae (Pfrd:: goxA) was inoculated to PDA medium 3-4d, and spore suspension thereof was collected and inoculated into seed medium containing 100g/L glucose, and cultured at 200rpm in a shaker at 28 ℃ for 12 hours. Collecting the above thallus, transferring to gluconic acid fermentation medium containing 1g/L, 50g/L and 100g/L glucose, collecting thallus under different sugar content after 8h, extracting RNA, and reverse transcription kit (Prime Script) with total RNA as template ^TM RTregent Kit with gDNA) to obtain cDNA; cDNA as template, Real-time fluorescent Quantitative (RT-qPCR) kit (Quantitative Real-time PCR with TB Green Premix Ex Taq ^TM II) carrying out amplification. The relative expression of the goxA gene in Aspergillus oryzae (Pfrd:: goxA) was calculated under 1g/L and 50g/L glucose conditions using 100g/L glucose as a control, and 2 was used ^-ΔΔCт And (4) showing. As shown in FIG. 10, in Aspergillus oryzae (Pfrd:: goxA), the relative expression level of goxA was up-regulated by 25.71 times under 1g/L glucose condition compared to 100g/L glucose condition, whereas under 50g/L glucose condition, the relative expression level of goxA was lower, indicating that the low sugar inducible promoter Pfrd can be used in Aspergillus oryzae, which lays the foundation for low sugar fermentation of Aspergillus oryzae.

Example 9 construction of the modified fungus Trichoderma reesei (Pfrd:: goxA) and expression levels of the goxA gene under different sugar content conditions (see FIG. 11):

agrobacterium containing plasmid pLH1442 was co-cultured with spores of wild type Trichoderma reesei in IM plates, and the co-culture was spread on CM plates containing 100. mu.g/mL cefotaxime and 150. mu.g/mL hygromycin B and cultured at 28 ℃ until monoclonals were formed. And selecting a single clone to extract a genome for verification, and obtaining the modified strain trichoderma reesei (Pfrd:: goxA). Trichoderma reesei (Pfrd:: goxA) was inoculated to PDA medium for 5-7 days, and spore suspension thereof was collected and inoculated to seed medium containing 100g/L glucose, and cultured in a shaker at 28 ℃ and 200rpm for 12 hours. Collecting the above thallus, transferring to gluconic acid fermentation medium containing 1g/L, 50g/L and 100g/L glucose, collecting thallus under different sugar content after 8h, extracting RNA, and reverse transcription kit (Prime Script) with total RNA as template ^TM RT regent Kit with gDNA) to obtain cDNA; using cDNA as template, using Real-time fluorescent Quantitative (RT-qPCR) kit (Quantitative Real-time PCR with TB Green Premix Ex Taq ^TM II) performing amplification. The relative expression of the goxA gene in Trichoderma reesei (Pfrd:: goxA) at 1g/L and 50g/L glucose was calculated using 100g/L glucose as a control, and 2 was used ^-ΔΔCт And (4) showing. As shown in FIG. 11, in Trichoderma reesei (Pfrd:: goxA), the relative expression level of goxA is up-regulated by 23.63 times under the condition of 1g/L glucose compared with 100g/L glucose, whereas under the condition of 50g/L glucose, the relative expression level of goxA is lower, which indicates that the low-sugar inducible promoter Pfrd can also be applied in Trichoderma reesei, and lays a foundation for low-sugar fermentation of Trichoderma reesei.

Table 1 primer sequences used in the examples

The culture medium used in the invention is specifically as follows:

(1) the LB medium comprises the following components:

1 to 2 percent of tryptone, 0.5 to 1 percent of yeast powder and 1 to 2 percent of sodium chloride, the pH is adjusted to 7.0 to 7.2, and 1.5 percent of agar powder is added into a solid culture medium. Sterilizing at 121 deg.C for 20 min. After sterilization, kanamycin was added to a final concentration of 100. mu.g/mL when cooled to about 50-60 ℃.

(2) The PDA culture medium comprises the following components: 50-100g of potato is cut into small pieces, 500-2000mL of water is added for boiling for about 30min, the double-layer gauze is used for filtering, 5-10g of glucose is added until the glucose is completely dissolved, and water is added for fixing the volume to 50-1000 mL. Solid culture of 1.5% agar powder. Autoclaving at 121 deg.C for 20 min.

(3) Aspergillus niger liquid culture medium

0.05％～0.1％MgSO ₄ ·7H ₂ O, 1 to 2 percent of glucose and 0.05 to 0.1 percent of KH ₂ PO ₄ Yeast powder 0.5-1 wt% and HCl 4M to regulate pH to 4.0.

(4) Gluconic acid fermentation medium

0.1 to 20 percent of glucose, 0.02 to 0.05 percent of monopotassium phosphate, 0.05 to 0.1 percent of corn steep liquor, 0.001 to 0.003 percent of magnesium sulfate heptahydrate, 0.01 to 0.05 percent of urea, adjusting the pH value to be 7.0, and sterilizing at 115 ℃ for 20 min.

(5) Solid chromogenic medium

0.1 to 10 percent of glucose, 0.5 to 1 percent of yeast powder, 0.05 to 0.1 percent of corn steep liquor, 0.01 to 0.05 percent of urea, 0.05 to 0.1 percent of monopotassium phosphate, 0.01 to 0.03 percent of magnesium sulfate, 1 to 1.5 percent of calcium carbonate and 1.5 percent of agar, adjusting the pH value to be 7.0, and sterilizing at 115 ℃ for 20 min.

(6) Chashi culture medium

1 to 5 percent of cane sugar, 0.1 to 0.5 percent of sodium nitrate, 0.05 to 0.5 percent of dipotassium hydrogen phosphate, 0.0005 to 0.005 percent of ferrous sulfate and 0.01 to 0.1 percent of magnesium sulfate. Solid culture of 1.5% agar powder.

The sequences used in the present invention are as follows:

1, seq.1: nucleotide sequence 1770bp of goxA

CTGCCACACTACATCAGGAGCAATGGCATTGAAGCCAGCCTCCTGACTGACCCCAAGGATGTCTCCGGCCGCACGGTCGACTACATCATCGCTGGTGGAGGTCTGACTGGACTCACCACCGCTGCTCGTCTGACGGAGAACCCCAACATCAGTGTGCTCGTCATCGAAAGTGGCTCCTACGAGTCGGACAGAGGTCCTATCATTGAGGACCTGAACGCCTACGGCGACATTTTTGGCAGCAGTGTAGACCACGCCTACGAGACCGTTGAGCTCGCTACCAACAATCAAACCGCGCTGATCCGCTCCGGAAATGGTCTCGGTGGCTCTACTCTAGTGAATGGTGGCACCTGGACTCGCCCCCACAAGGCACAGGTTGATTCTTGGGAGACTGTCTTTGGAAATGAGGGCTGGAACTGGGACAATGTGGCCGCCTACTCCCTCCAGGCTGAGCGTGCTCGCGCACCAAATGCCAAACAGATCGCTGCTGGCCACTACTTCAACGCATCCTGTCATGGTACCAATGGTACTGTCCATGCCGGACCCCGTGACACCGGCGATGACTATTCCCCCATCGTCAAGGCTCTCATGAGCGCTGTCGAAGACCGGGGCGTTCCCACCAAGAAGGACTTCGGATGCGGTGACCCTCATGGTGTGTCCATGTTCCCCAACACCTTGCACGAAGACCAAGTTCGCTCCGATGCCGCTCGCGAATGGCTCCTTCCCAACTACCAACGTCCCAACCTGCAAGTCCTGACCGGACAATATGTTGGTAAGGTGCTCCTTAGCCAGAACGGCACCACCCCTCGTGCCGTCGGCGTGGAATTCGGCACCCACAAGGGCAACACCCACAACGTTTACGCTAAGCACGAGGTCCTCCTGGCTGCTGGCTCGGCTGTCTCTCCCACCATCCTCGAATATTCCGGTATCGGAATGAAGTCCATCCTGGAACCCCTTGGTATCGACACCGTCGTTGACCTGCCCGTCGGCCTGAACCTGCAGGACCAGACCACCGCTACCGTCCGCTCCCGCATCACCTCTGCTGGTGCCGGACAGGGACAGGCCGCTTGGTTCGCCACCTTCAACGAGACCTTTGGTGACTATGCCGAAAAGGCACACGAGCTGCTCAACACCAAGCTGGAGCAGTGGGCCGAAGAGGCCGTCGCCCGTGGCGGATTCCACAACACCACCGCCTTGCTCATCCAGTACGAGAACTATCGCGACTGGATTGTCAATCACAACGTCGCGTACTCGGAACTCTTCCTCGACACTGCCGGAGTGGCCAGCTTCGATGTGTGGGACCTTCTGCCCTTCACGAGAGGATACGTCCACATCCTCGACAAGGACCCCTACCTCCACCACTTTGCCTACGACCCTCAGTACTTCCTCAACGAGCTCGACCTGCTCGGTCAGGCTGCCGCTACTCAGCTGGCCCGTAACATCTCCAACTCCGGTGCTATGCAGACCTACTTCGCTGGCGAGACTATCCCCGGTGATAACCTCGCGTATGATGCCGATTTGAGCGCCTGGACTGAGTACATCCCGTACCACTTCCGTCCTAACTACCATGGCGTGGGTACTTGCTCCATGATGCCGAAGGAGATGGGCGGTGTTGTCGATAATGCTGCCCGTGTGTACGGTGTGCAGGGACTGCGTGTCATTGATGGTTCTATTCCCCCTACGCAGATGTCGTCCCATGTCATGACTGTGTTCTACGCCATGGCGTTGAAGATTGCGGATGCTATTTTGGAGGACTACGCTTCTATGCAGTGA

2, seq.2: ttrpc nucleotide sequence 719bp

CTTAACGTTACTGAAATCATCAAACAGCTTGACGAATCTGGATATAAGATCGTTGGTGTCGATGTCAGCTCCGGAGTTGAGACAAATGGTGTTCAGGATCTCGATAAGATACGTTCATTTGTCCAAGCAGCAAAGAGTGCCTTCTAGTGATTTAATAGCTCCATGTCAACAAGAATAAAACGCGTTTTCGGGTTTACCTCTTCCAGATACAGCTCATCTGCAATGCATTAATGCATTGACTGCAACCTAGTAACGCCTTNCAGGCTCCGGCGAAGAGAAGAATAGCTTAGCAGAGCTATTTTCATTTTCGGGAGACGAGATCAAGCAGATCAACGGTCGTCAAGAGACCTACGAGACTGAGGAATCCGCTCTTGGCTCCACGCGACTATATATTTGTCTCTAATTGTACTTTGACATGCTCCTCTTCTTTACTCTGATAGCTTGACTATGAAAATTCCGTCACCAGCNCCTGGGTTCGCAAAGATAATTGCATGTTTCTTCCTTGAACTCTCAAGCCTACAGGACACACATTCATCGTAGGTATAAACCTCGAAATCANTTCCTACTAAGATGGTATACAATAGTAACCATGCATGGTTGCCTAGTGAATGCTCCGTAACACCCAATACGCCGGCCGAAACTTTTTTACAACTCTCCTATGAGTCGTTTACCCAGAATGCACAGGTACACTTGTTTAGAGGTAATCCTTCTTTCTAGAC

3, SEQ.3: pfrd nucleotide sequence 1023bp

GGTCCCTGTCTTTGTGTGTATGTATGTATGGGGTAATTCGGATACTTAAATAAGGTGTATTGAATACTAATTATGATAGTTCTTATTGATAGTGTTTGTGTTTGTTGTTGTAGTGAATGTATATATATATAATGTGAGATCAACCAGTTCCAGGTACTATCTAAGCTTCAGATGAAAAGCTACCTTCACTTCACTAAATAGACATCTCATTCATGAAATCTAGATGGAGCAGACATCCCGATCATCTAGGTAACCCCAAAATTGAGACGAATCTGAATCCGGGGACAGAGTTTAAATCGAAGAGCATGACGTGCCGCGCTGACTTAAGCCTACGATTTCATTTGCTGAAAGGCTGCTGCTGGGGTTTCCAGGCATGTGAAAGCCTGGGAGTCTCTCTCTTGCCCTCAGGTATGCTTGTAGTATAATATGTCATGGGAAGGAACCGCAGGGTCAGCTTGCAGCTCCTGGTGACGCTCTGCATGTGATGGACCCCTGGTCTGCTGGAAACTCACTAGTATTCTGTCAACGACAGGGGAGTGATTTTTGAATGTCTACTGCCTATTGATAACTCGACTGTAGTACCTATACTAAGTAGAACCCGTCATTCAGTCAGTCAAGAAGCACAGGCCAGAGACAGACAAAAGAAGGACCCATCGAATCCACTTAAGACAGGCTGAACATTCGTTGATCCCCTCAAAAAGTAGAAGAGAAGATACCGGACCGGAAAAGGGAGAGGAGGGAGGAGGGGGTCATAGAACGGTAATCGTACGGTACATACCCGAGTTGAATGAATTGAATGGGGAAGAAATGAGCCTCGGCCGAGTGAGTGAGTCTCTCCCCCGTCGGCTTCTGAATGCCTGGCTCTACTCTTCTTCCCCCGGATCTCCTGGTGCTTAAAGATCTACTTGTTCCTACCTGCTTTTTGACCCTTTAATCTCCTCTTCTCATCTCTCCCCCATTCATCTTTGAATTTCTCTTCTCATCCTTGTCTCCCTTCCCTCTACATCTTCCTCCCACACGATG

And (3) the nucleotide sequence shown in SEQ.4: nucleotide sequence 1000bp of Ppppta

GTGAGGGAGGATTTTCTCCACGACGGGTGCGCGGATAAAGACGGCGGGGAAAGCGGGTTGATTAGCGCCCAGGAAGGGCAAGTCGAGAGGAGCCTGGAAACTCTCCGTCTGACGGCCAAAATGATTGCGATTGACGCGCACGTCCAGCCCACCGATCAGATCCTGGCCACCCTTCTTTGTGCGGTTGGCTGACTCGGCGAGGAGGATCAGACCGGCGCAGGTACCCCAAGTAGGCCTCCGGTGGACCCTGAGATGGTAATTAGCATACACATAGAGCAACTGTGCAGAACACCGATAAGACATACTTGACAAAGTCTCGCAAAGGCTCCAAGAGGTTGGACCTGGCGGCAACAAGGGCCATGGTTGTGCTTTCACCTCCGGGCAGCACCAGCGCATCGCATCGCTCGAGTTCCTGCGGGGTGCGCACTTCGATGAAGTCCCATTGCGAGGCGGAACTGCGGTCTTTGGCGGGCAAATCGGCGGCCGCACTCTTCAGCAATTGGATATGTTCGTAGAAGGCGCCTTGCAAGGCGAGCACGCCGACGGTGATGCAGCCCATGGCGAAGTATAGGATCTGAGAGTGTGGCGGCAGCAACAGAACTATGACTCCAAACTCTCTATACTTTATTTGATGGGAGCAACGCCGCCTTATGTCAGCGGATCAATGTCGGACCGCTTATCACCACGTGCTGCCCCGCGTTCAGCCTCGGACATTTGGGGGCCATCATTAACATCATGAGTTCAATGTCTTTTTTGCTTTGCTGTGATAATACGCTGGTTGCGGTCTTTAACATAAGACTCCGAGATTCGTCATTAGAACAGTTTAATCTCAGAATGTATCAATGACCCTCGTGGAGAACTAACCCAACCCCTCACTTCACCTCATCTCACCTCCGCATAGACGCCCGATCTCCTCACATCAGCTACACCACTACATCTCACTCAATTGAACACACCACCACCACAACAGCCTCATACCCAACCCAACCAACCCACAATG

And (3) SEQ.5: nucleotide sequence 54bp of goxA-F

ATTCAATTCGAGCTCAGATCTGGATCCTACGTACTGCCACACTACATCAGGAGC

The peptide of SEQ.6: nucleotide sequence 35bp of goxA-R

TTCAGTAACGTTAAGTCACTGCATAGAAGCGTAGT

The peptide of SEQ.7: Ptrpc-F nucleotide sequence 37bp

GCTTCTATGCAGTGACTTAACGTTACTGAAATCATCA

And (3) SEQ.8: Ptrpc-R nucleotide sequence 37bp

TCAATATCAGTTAACGTCTAGAAAGAAGGATTACCTC

And (3) SEQ.9: Pfrd-F nucleotide sequence 40bp

TTCGAGCTCAGATCTGGATCCGGTCCCTGTCTTTGTGTGT

And (3) SEQ.10: nucleotide sequence 34bp of Pfrd-R

AGATCGGAACGACATCATCGTGTGGGAGGAAGAT

The peptide of SEQ.11: nucleotide sequence 41bp of PpptA-F

ATTCAATTCGAGCTCAGATCTGTGAGGGAGGATTTTCTCCA

The peptide of SEQ.12: nucleotide sequence 37bp of PpptA-R

CATTACGTAGGATCCCATTGTGGGTTGGTTGGGTTGG

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.

Sequence listing

<110> Tianjin science and technology university

<120> a low-sugar response inducible promoter from Aspergillus niger, a method and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1770

<212> DNA

<213> nucleotide sequence of goxA (Unknown)

<400> 1

ctgccacact acatcaggag caatggcatt gaagccagcc tcctgactga ccccaaggat 60

gtctccggcc gcacggtcga ctacatcatc gctggtggag gtctgactgg actcaccacc 120

gctgctcgtc tgacggagaa ccccaacatc agtgtgctcg tcatcgaaag tggctcctac 180

gagtcggaca gaggtcctat cattgaggac ctgaacgcct acggcgacat ttttggcagc 240

agtgtagacc acgcctacga gaccgttgag ctcgctacca acaatcaaac cgcgctgatc 300

cgctccggaa atggtctcgg tggctctact ctagtgaatg gtggcacctg gactcgcccc 360

cacaaggcac aggttgattc ttgggagact gtctttggaa atgagggctg gaactgggac 420

aatgtggccg cctactccct ccaggctgag cgtgctcgcg caccaaatgc caaacagatc 480

gctgctggcc actacttcaa cgcatcctgt catggtacca atggtactgt ccatgccgga 540

ccccgtgaca ccggcgatga ctattccccc atcgtcaagg ctctcatgag cgctgtcgaa 600

gaccggggcg ttcccaccaa gaaggacttc ggatgcggtg accctcatgg tgtgtccatg 660

ttccccaaca ccttgcacga agaccaagtt cgctccgatg ccgctcgcga atggctcctt 720

cccaactacc aacgtcccaa cctgcaagtc ctgaccggac aatatgttgg taaggtgctc 780

cttagccaga acggcaccac ccctcgtgcc gtcggcgtgg aattcggcac ccacaagggc 840

aacacccaca acgtttacgc taagcacgag gtcctcctgg ctgctggctc ggctgtctct 900

cccaccatcc tcgaatattc cggtatcgga atgaagtcca tcctggaacc ccttggtatc 960

gacaccgtcg ttgacctgcc cgtcggcctg aacctgcagg accagaccac cgctaccgtc 1020

cgctcccgca tcacctctgc tggtgccgga cagggacagg ccgcttggtt cgccaccttc 1080

aacgagacct ttggtgacta tgccgaaaag gcacacgagc tgctcaacac caagctggag 1140

cagtgggccg aagaggccgt cgcccgtggc ggattccaca acaccaccgc cttgctcatc 1200

cagtacgaga actatcgcga ctggattgtc aatcacaacg tcgcgtactc ggaactcttc 1260

ctcgacactg ccggagtggc cagcttcgat gtgtgggacc ttctgccctt cacgagagga 1320

tacgtccaca tcctcgacaa ggacccctac ctccaccact ttgcctacga ccctcagtac 1380

ttcctcaacg agctcgacct gctcggtcag gctgccgcta ctcagctggc ccgtaacatc 1440

tccaactccg gtgctatgca gacctacttc gctggcgaga ctatccccgg tgataacctc 1500

gcgtatgatg ccgatttgag cgcctggact gagtacatcc cgtaccactt ccgtcctaac 1560

taccatggcg tgggtacttg ctccatgatg ccgaaggaga tgggcggtgt tgtcgataat 1620

gctgcccgtg tgtacggtgt gcagggactg cgtgtcattg atggttctat tccccctacg 1680

cagatgtcgt cccatgtcat gactgtgttc tacgccatgg cgttgaagat tgcggatgct 1740

attttggagg actacgcttc tatgcagtga 1770

<210> 2

<211> 719

<212> DNA

<213> nucleotide sequence of Ttrpc (Unknown)

<400> 2

cttaacgtta ctgaaatcat caaacagctt gacgaatctg gatataagat cgttggtgtc 60

gatgtcagct ccggagttga gacaaatggt gttcaggatc tcgataagat acgttcattt 120

gtccaagcag caaagagtgc cttctagtga tttaatagct ccatgtcaac aagaataaaa 180

cgcgttttcg ggtttacctc ttccagatac agctcatctg caatgcatta atgcattgac 240

tgcaacctag taacgccttn caggctccgg cgaagagaag aatagcttag cagagctatt 300

ttcattttcg ggagacgaga tcaagcagat caacggtcgt caagagacct acgagactga 360

ggaatccgct cttggctcca cgcgactata tatttgtctc taattgtact ttgacatgct 420

cctcttcttt actctgatag cttgactatg aaaattccgt caccagcncc tgggttcgca 480

aagataattg catgtttctt ccttgaactc tcaagcctac aggacacaca ttcatcgtag 540

gtataaacct cgaaatcant tcctactaag atggtataca atagtaacca tgcatggttg 600

cctagtgaat gctccgtaac acccaatacg ccggccgaaa cttttttaca actctcctat 660

gagtcgttta cccagaatgc acaggtacac ttgtttagag gtaatccttc tttctagac 719

<210> 3

<211> 1023

<212> DNA

<213> nucleotide sequence of Pfrd (Unknown)

<400> 3

ggtccctgtc tttgtgtgta tgtatgtatg gggtaattcg gatacttaaa taaggtgtat 60

tgaatactaa ttatgatagt tcttattgat agtgtttgtg tttgttgttg tagtgaatgt 120

atatatatat aatgtgagat caaccagttc caggtactat ctaagcttca gatgaaaagc 180

taccttcact tcactaaata gacatctcat tcatgaaatc tagatggagc agacatcccg 240

atcatctagg taaccccaaa attgagacga atctgaatcc ggggacagag tttaaatcga 300

agagcatgac gtgccgcgct gacttaagcc tacgatttca tttgctgaaa ggctgctgct 360

ggggtttcca ggcatgtgaa agcctgggag tctctctctt gccctcaggt atgcttgtag 420

tataatatgt catgggaagg aaccgcaggg tcagcttgca gctcctggtg acgctctgca 480

tgtgatggac ccctggtctg ctggaaactc actagtattc tgtcaacgac aggggagtga 540

tttttgaatg tctactgcct attgataact cgactgtagt acctatacta agtagaaccc 600

gtcattcagt cagtcaagaa gcacaggcca gagacagaca aaagaaggac ccatcgaatc 660

cacttaagac aggctgaaca ttcgttgatc ccctcaaaaa gtagaagaga agataccgga 720

ccggaaaagg gagaggaggg aggagggggt catagaacgg taatcgtacg gtacataccc 780

gagttgaatg aattgaatgg ggaagaaatg agcctcggcc gagtgagtga gtctctcccc 840

cgtcggcttc tgaatgcctg gctctactct tcttcccccg gatctcctgg tgcttaaaga 900

tctacttgtt cctacctgct ttttgaccct ttaatctcct cttctcatct ctcccccatt 960

catctttgaa tttctcttct catccttgtc tcccttccct ctacatcttc ctcccacacg 1020

atg 1023

<210> 4

<211> 1000

<212> DNA

<213> nucleotide sequence of Ppppta (Unknown)

<400> 4

gtgagggagg attttctcca cgacgggtgc gcggataaag acggcgggga aagcgggttg 60

attagcgccc aggaagggca agtcgagagg agcctggaaa ctctccgtct gacggccaaa 120

atgattgcga ttgacgcgca cgtccagccc accgatcaga tcctggccac ccttctttgt 180

gcggttggct gactcggcga ggaggatcag accggcgcag gtaccccaag taggcctccg 240

gtggaccctg agatggtaat tagcatacac atagagcaac tgtgcagaac accgataaga 300

catacttgac aaagtctcgc aaaggctcca agaggttgga cctggcggca acaagggcca 360

tggttgtgct ttcacctccg ggcagcacca gcgcatcgca tcgctcgagt tcctgcgggg 420

tgcgcacttc gatgaagtcc cattgcgagg cggaactgcg gtctttggcg ggcaaatcgg 480

cggccgcact cttcagcaat tggatatgtt cgtagaaggc gccttgcaag gcgagcacgc 540

cgacggtgat gcagcccatg gcgaagtata ggatctgaga gtgtggcggc agcaacagaa 600

ctatgactcc aaactctcta tactttattt gatgggagca acgccgcctt atgtcagcgg 660

atcaatgtcg gaccgcttat caccacgtgc tgccccgcgt tcagcctcgg acatttgggg 720

gccatcatta acatcatgag ttcaatgtct tttttgcttt gctgtgataa tacgctggtt 780

gcggtcttta acataagact ccgagattcg tcattagaac agtttaatct cagaatgtat 840

caatgaccct cgtggagaac taacccaacc cctcacttca cctcatctca cctccgcata 900

gacgcccgat ctcctcacat cagctacacc actacatctc actcaattga acacaccacc 960

accacaacag cctcataccc aacccaacca acccacaatg 1000

<210> 5

<211> 54

<212> DNA

<213> goxA-F(Unknown)

<400> 5

attcaattcg agctcagatc tggatcctac gtactgccac actacatcag gagc 54

<210> 6

<211> 35

<212> DNA

<213> goxA-R(Unknown)

<400> 6

ttcagtaacg ttaagtcact gcatagaagc gtagt 35

<210> 7

<211> 37

<212> DNA

<213> Ttrpc-F(Unknown)

<400> 7

gcttctatgc agtgacttaa cgttactgaa atcatca 37

<210> 8

<211> 37

<212> DNA

<213> Ttrpc-R(Unknown)

<400> 8

tcaatatcag ttaacgtcta gaaagaagga ttacctc 37

<210> 9

<211> 40

<212> DNA

<213> Pfrd-F(Unknown)

<400> 9

ttcgagctca gatctggatc cggtccctgt ctttgtgtgt 40

<210> 10

<211> 34

<212> DNA

<213> Pfrd-R(Unknown)

<400> 10

agatcggaac gacatcatcg tgtgggagga agat 34

<210> 11

<211> 41

<212> DNA

<213> PpptA-F(Unknown)

<400> 11

attcaattcg agctcagatc tgtgagggag gattttctcc a 41

<210> 12

<211> 37

<212> DNA

<213> PpptA-R(Unknown)

<400> 12

cattacgtag gatcccattg tgggttggtt gggttgg 37

Claims

1. A low-sugar response inducible promoter derived from Aspergillus niger, comprising: the nucleotide sequence of the promoter is SEQ ID NO. 3.

2. The A.niger-derived low-sugar response inducible promoter of claim 1, wherein: the promoter is a promoter of fumarate reductase ANI _1_944144 and is named as Pfrd;

3. Use of the promoter according to claim 1 or 2 for regulating the expression of the gene goxA.

4. Method for regulating the expression of the gene goxA using the promoter according to claim 1 or 2, characterized in that: the method comprises the steps of transforming a vector containing the promoter into an Aspergillus niger cell and/or a filamentous fungus cell, and carrying out fermentation culture under the low sugar condition;

5. The method of claim 4, wherein: the heterologous gene is a goxA gene, and the nucleotide sequence of the goxA gene is SEQ ID NO. 1;

alternatively, by transforming an expression cassette containing a promoter, a heterologous gene, a terminator into a host cell;

6. A plasmid comprising the promoter of claim 1 or 2, wherein: the plasmid is a plasmid which takes Pfrd as a promoter to regulate the expression of a goxA gene, and the nucleotide sequence of the goxA gene is SEQ ID NO. 1.

7. An expression vector comprising the promoter of claim 1 or 2.

8. An engineered strain comprising the promoter of claim 1 or 2.

9. The engineered strain of claim 8, wherein: the modified bacteria are obtained by transforming an expression frame containing a promoter, a reporter gene goxA sequence and a terminator into host cells of aspergillus niger and filamentous fungi;

wherein the nucleotide sequence of the goxA gene is SEQ ID NO. 1;

the filamentous fungus cell is Aspergillus oryzae or Trichoderma reesei.

10. The engineered strain of claim 8, wherein: the modified strains are hygromycin sensitive strains S2361, modified bacteria Aspergillus oryzae and modified bacteria Trichoderma reesei;

co-culturing Agrobacterium containing plasmid pLH1442 and spores of S1691 on an IM plate, then transferring the co-culture into a CM plate containing 200 μ M cefotaxime, 100 μ g/mL ampicillin, 100 μ g/mL streptomycin and 250 μ g/mL hygromycin B, and culturing at 28 ℃ until a single clone is formed; selecting a single clone to be transferred to a PDA (personal digital assistant) plate containing hygromycin B, screening hygromycin B resistant transformants, extracting a genome for verification, collecting correct transformant spores, inoculating the correct transformant spores to the doxycycline plate containing 30 microgram/mL, and inducing an hph resistance screening marker to be deleted from the genome to obtain a hygromycin sensitive strain S2361;

the construction method of the modified trichoderma reesei comprises the following steps:

(2) construction of the pLH1442 plasmid: