CN111593069B - Construction method and application of plasmid for over-expressing vault RNA2-1 gene - Google Patents

Abstract

The invention discloses a construction method of a vault RNA2-1 gene overexpression recombinant plasmid and application thereof in gene function research. The invention relates to a vault RNA2-1 gene, and provides a method for constructing a vault RNA2-1 gene overexpression recombinant eukaryotic expression plasmid pcDNA3.1 (+) -vtrna2-1, and an experimental method for researching the vault RNA2-1 gene in a human colon cancer cell.

Description

Construction method and application of plasmid for over-expressing vault RNA2-1 gene

The technical field is as follows:

the invention relates to a construction method and application of eukaryotic recombinant expression plasmid for over-expressing vault RNA2-1.

Technical Field

Colorectal cancer (CRC) is one of common malignant tumors of the digestive tract, the incidence rate of which is 3 rd of malignant tumors worldwide, the mortality rate of which is 2 nd of death worldwide, and is a digestive system malignant tumor which accounts for the first of the worldwide morbidity and mortality, and the life and health are seriously threatened. In recent years, with westernization of life style and dietary structure in China, the incidence of colorectal cancer generally shows an increasing trend, and the colorectal cancer becomes malignant tumors of 2 nd and 1 st incidence of digestive system diseases in China. In 2018, the number of new cases of colorectal cancer in China is estimated to be more than 52.1 ten thousand, the number of death cases is about 24.8 ten thousand, the number of new cases and death cases are both close to 30 percent of the number of colorectal cancer cases in the same period all over the world, and the disease burden is heavy. At present, the 5-year survival rate of colorectal cancer in China is far lower than that of American and Japanese Korean, more than 85 percent of colorectal cancer is found to be in the late stage, and even through comprehensive treatment such as operation, radiotherapy and chemotherapy, targeted treatment and the like, the 5-year survival rate of patients is still obviously lower than 40 percent; in contrast, the 5-year survival rate after early colorectal cancer treatment can exceed 95% and even be completely cured. Therefore, early diagnosis and early treatment of CRC are particularly important. At present, the molecular mechanism of early colorectal carcinoma is not completely elucidated, so that the deep understanding of the molecular mechanism of colorectal carcinoma plays an important role in the research and development of early diagnosis and treatment of cancer.

Genetic engineering, also known as gene recombination technology, is a technology developed in the seventies of the twentieth century to operate DNA in vitro, and is widely used for basic research of diseases, gene therapy, gene immunization, gene vaccines and the like, and the three elements of the technology are respectively: enzyme, target gene and vector. The eukaryotic expression vector is a vector used for constructing an eukaryotic gene expression system in genetic engineering. In recent decades, various researchers around eukaryotic expression vectors have made various diseases, genes and other related researches, have made a lot of work in the aspect of genetic engineering, and have opened up a new way for medical science research.

Non-coding RNA is a key molecule for the development of tumorigenesis that has emerged in recent years, and its clinical value is receiving close attention. Vault RNA (vtrna) is a eukaryotic non-coding RNA of 84-141nt in length, which is transcribed by RNA polymerase III. They are associated with conserved vault proteins that form vault particles, a complex structure whose function and relevance in cancer is not known to date. The human vtrna family comprises the four subtypes, vtrna1-1, vtrna1-2, vtrna1-3 and vtrna2-1. Different evidence suggests that epigenetic control of vtrna2-1 is complex and may be of clinical significance. Independent reports of breast, lung, colon, bladder, esophageal, and gastric cancers show that the promoters thereof are methylated to a different extent in tumor tissues than in normal tissues.

Disclosure of Invention

The invention uses gene recombination technology to construct a recombinant eukaryotic expression vector pcDNA3.1 (+) -vtrna2-1 aiming at the vtrna2-1 gene, transfects epithelial cells of human colon cancer with the recombinant eukaryotic expression vector pcDNA3.1 (+) -vtrna2-1, constructs a cell strain of the transfection vtrna2-1 gene, provides a good tool for researching the function of the vtrna2-1 gene, lays a foundation for further researching the biological function of the vtrna2-1 gene in colorectal cancer, and provides an effective experimental method for researching the function of the vtrna2-1 gene in human colorectal cancer or other malignant tumors.

According to one aspect of the invention, the inventor provides a novel eukaryotic recombinant plasmid and a preparation method thereof, and proves that the recombinant plasmid is a good tool for researching the function of the vtrna2-1 gene and provides an effective experimental method for researching the function of the vtrna2-1 gene of human colorectal cancer.

The vtrna2-1 gene is registered in GenBank under the registration number NG _051612.1, positioned at 5q31.1 and has a full length of 108bp. The preparation method of the eukaryotic recombinant plasmid sequentially comprises the following steps:

a) Synthesizing a human vtrna2-1 gene fragment by RT-PCR;

b) Connecting the obtained nucleotide fragment with eukaryotic plasmid, wherein the restriction enzyme sites of the insert fragment are HindIII and XhoI respectively, transforming the eukaryotic recombinant plasmid into competent bacteria for culture, and screening eukaryotic recombinant plasmid clone with correct insertion;

c) Extracting eukaryotic recombinant plasmid, and analyzing the constructed eukaryotic recombinant plasmid by using restriction enzyme digestion map.

The recombinant plasmid obtained above was transfected into human colon cancer cells Caco-2 cells and HCT-116 cells to observe the cell biological properties. The result shows that when the recombinant plasmid is transfected into Caco-2 cells and HCT-116 cells of human colon cancer cells, the vtrna2-1 gene has the function of inhibiting cell proliferation. Therefore, the invention is helpful for researching the function of the vtrna2-1 gene and provides a molecular biological tool for researching the role of the vtrna2-1 gene in the onset of human colorectal cancer.

According to a further aspect of the present invention there is provided a eukaryotic recombinant expression plasmid characterised in that: the target sequence of the DNA has the deoxynucleotide sequence as follows:

CGGGTCGGAGTTAGCTCAAGCGGTTACCTCCTCATGCCGGACTTTCTATCTGTCCATCTCTGTGCTGGGGTTCGAGACCCGCGGGTGCTTACTGACCCTTTTATGCAA。

according to a further aspect of the invention, the eukaryotic recombinant expression plasmid is constructed by recombining the vtrna2-1 gene fragment with the eukaryotic expression plasmid.

According to still another aspect of the present invention, there is provided a method for preparing the above eukaryotic recombinant plasmid, characterized by comprising:

a) Synthesizing a human vtrna2-1 gene fragment by RT-PCR;

b) The vtrna2-1 gene fragment and TA cloning vector

2.1 connection, transforming the recombinant plasmid pCR 2.1-vtrna2-1 into DH5 alpha competent cells, identifying and screening positive clones by cloning PCR, extracting positive clone plasmids, carrying out enzyme cutting by using restriction enzymes, wherein the enzyme cutting sites are HindIII and XhoI respectively,

c) Connecting the enzyme digestion product with eukaryotic plasmid vector pcDNA3.1 (+), transforming the connection product into DH5 alpha competent cell, identifying by cloning PCR, identifying and screening positive clone, extracting plasmid to obtain eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1,

d) The constructed eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1 is identified by using a restriction enzyme cutting map.

According to another aspect of the invention, the application of the eukaryotic recombinant expression plasmid in preparing a medicament for inhibiting the proliferation of colon cancer cells Caco-2 cells is provided.

Drawings

FIG. 1 is a schematic structural diagram of eukaryotic recombinant vector pcDNA3.1 (+) according to the present invention.

FIG. 2 is a schematic structural diagram of a eukaryotic recombinant plasmid vector pcDNA3.1 (+) -vtrna2-1 according to the present invention.

FIG. 3 is a graph showing a band of a vtrna2-1 PCR amplification product according to the present invention.

FIG. 4 shows the restriction enzyme analysis of the eukaryotic recombinant plasmid vector pcDNA3.1 (+) -vtrna2-1.

FIG. 5 is a histogram of the transfection efficiency of the eukaryotic recombinant plasmid vector pcDNA3.1 (+) -vtrna2-1 of the present invention.

FIG. 6 is a diagram showing the proliferation of the human colon cancer cell Caco-2 cell line after transfection of the eukaryotic recombinant plasmid vector pcDNA3.1 (+) -vtrna2-1.

FIG. 7 is the growth curve of human colon cancer cell Caco-2 after eukaryotic recombinant plasmid vector pcDNA3.1 (+) -vtrna2-1 is transfected.

FIGS. 8A and 8B show the expression of the Caco-2 proliferating cell nuclear antigen PCNA after the eukaryotic recombinant plasmid vector pcDNA3.1 (+) -vtrna2-1 is transfected.

FIGS. 9A-9C show the expression of Caco-2-bromodeoxyuridine Brdu in human colon cancer cells transfected by the eukaryotic recombinant plasmid vector pcDNA3.1 (+) -vtrna2-1 of the present invention and its control.

FIGS. 10A-10C show the expression of the eukaryotic recombinant plasmid vector pcDNA3.1 (+) -vtrna2-1 transfected human colon cancer cell CaCo-2 nuclear antigen Ki67 and its control.

The specific implementation process comprises the following steps:

the invention will be further described with reference to specific examples.

Example 1: construction of recombinant eukaryotic expression vector pcDNA3.1 (+) -vtrna2-1

1. Cloning of vtrna2-1 Gene

Primers were designed using primer 3plus software based on the vtrna2-1 transcript sequence as follows:

5'-3' of the vtrna2-1 upstream primer:AAGCTTGGGTCGGAGTTAGCTCAAGC (containing HindIII restriction site)

5'-3' of downstream primer of vtrna 2-1:CTCGAGTTGCATAAAAGGGTCAGTAAGCACCCG (containing XhoI cleavage site)

Reaction system: 50 μ l

Premix Taq(TaKaRa Taq Version 2.0) 25μl

cDNA 1μl

Upstream primer 0.5. Mu.M (final concentration)

Downstream primer 0.5. Mu.M (final concentration)

Adding ribozyme-free water to a final volume of 50. Mu.l

And (3) PCR reaction conditions: 95 ℃ for 15 seconds

1 minute at 60 DEG C

72 ℃ for 30 seconds

40 cycles

The vtrna2-1 transcript sequence was successfully amplified by PCR, and the PCR product was electrophoresed to obtain an amplification product band substantially identical to the size of the target gene fragment (FIG. 3A shows the amplification product band of the upstream and downstream primers without enzyme cleavage sites, and FIG. 3B shows the amplification product band of the upstream and downstream primers with HindIII and XhoI enzyme cleavage sites).

2. Purifying and recovering PCR products after electrophoresis, wherein the kit is of Promega corporation

SV Gel and PCR Clean-Up System (Catalog number selected: A9281). The experimental steps are as follows:

1) The gel at the position of the PCR product was cut and weighed to 0.1g

2) Adding 100 μ l binding buffer, heating in 55 deg.C water bath until the gel is completely melted

3) Transferring all the obtained liquid into adsorption column, centrifuging at 16000g for 1min, discarding filtrate

4) Adding 750 μ l washing buffer, centrifuging at 16000g for 1min, discarding filtrate

5) Adding 500. Mu.l washing buffer, centrifuging at 16000g for 1min, discarding the filtrate

6) Centrifuging the adsorption column at 16000g for 1min, discarding the filtrate

7) Transferring the adsorption column into a new 1.5ml centrifuge tube, adding 50. Mu.l of ribozyme-free water into the adsorption column to elute DNA

8) 16000g, centrifuging for 1min, and collecting the filtrate to obtain purified DNA solution.

3. TA cloning (Invitrogen TA cloning kit, catalog number selected: INV-K204001)

The reaction conditions are as follows: joining at room temperature for 60min

4. Recombinant plasmid

1-vtrna2-1 transformed DH 5. Alpha. Competent cells, experimental procedures were as follows:

1) Thawing DH 5. Alpha. Competent cells on ice, 50. Mu.l per tube;

2) Adding 5 μ l of the ligation product, rapidly flicking, mixing, standing in ice bath for 30min;

3) Water bath is carried out for 1min at the temperature of 42 ℃,

4) Standing and ice-bathing for 10min;

5) Adding 300 μ l of antibiotic-free S.O.C culture medium, and shaking at 225rpm and 37 deg.C for 30min;

6) 50. Mu.l of the culture was spread on LB agar plates (100 ug/ml AMP) and incubated overnight at 37 ℃;

7) Single clonal colonies were picked for PCR identification of positive colonies.

5、Clone PCR

Reaction system: 20 μ l

Green Master Mix 10μl

Clone 1. Mu.l

Upstream primer 0.5. Mu.M (final concentration)

Downstream primer 0.5. Mu.M (final concentration)

Ribozyme-free water to a final volume of 20. Mu.l

And (3) PCR reaction conditions: 95 ℃ for 15 seconds

1 minute at 60 DEG C

72 ℃ for 30 seconds

40 cycles

The PCR product was used for 1% agarose electrophoresis to identify positive clones.

6. Placing the positive clone colony in a shaker, culturing at 225rpm at 37 ℃ overnight, and extracting plasmid (c) ((

Plus SV miniprep DNA Purification System, promega Catalog number selected A1470), restriction enzyme identification.

Reaction system: 20 μ l

Reaction conditions are as follows: water bath at 37 deg.c for 60min.

7. And (3) recovering the enzyme digestion product (recovering the kit and the PCR product), wherein the vector and the TA clone plasmid enzyme digestion product are used for a ligation reaction, and a ligation system is as follows:

the reaction conditions are as follows: ligation was performed overnight at 16 ℃.

8. The eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1 is transformed into DH5 alpha competent cells, and the experimental steps are as follows:

1) Thawing DH 5. Alpha. Competent cells on ice, 50. Mu.l per tube;

2) Adding 5 μ l of the ligation product, quickly flicking and uniformly mixing, and standing for 30min in an ice bath;

3) Water bath is carried out for 1min at the temperature of 42 ℃,

4) Standing and ice-bathing for 10min;

5) Adding 300 μ l of antibiotic-free S.O.C culture medium, and shaking at 225rpm and 37 deg.C for 30min;

6) Spreading 50 μ l of the culture on LB agar plate (containing AMP 100 ug/ml), and culturing at 37 deg.C overnight;

7) Colonies of the individual clones were picked for PCR identification of positive colonies.

9、Clone PCR

Reaction system: 20 μ l

Green Master Mix 10μl

Clone 1. Mu.l

Upstream primer 0.5. Mu.M (final concentration)

Downstream primer 0.5. Mu.M (final concentration)

Ribozyme-free water to a final volume of 20. Mu.l

And (3) PCR reaction conditions: 95 ℃ for 15 seconds

1 minute at 60 DEG C

72 ℃ for 30 seconds

40 cycles

The PCR product was used for 1% agarose electrophoresis to identify positive clones.

10. Placing the positive clone colony in a shaker, culturing at 225rpm at 37 ℃ overnight, and extracting plasmid (c) ((

Plus SV Minipreps DNA Purification System, promega Catalog number selected A1470), restriction enzyme identification.

Reaction system: 20 μ l

The reaction conditions are as follows: water bath at 37 deg.c for 60min.

The cleavage products were identified by electrophoresis in 1% agarose (FIG. 4).

11. And extracting plasmids from the positive colonies for clone sequencing identification. The sequencing result is compared by BLAST, and the sequence is consistent with the sequence published by Genebank, and the length of the target gene fragment is actually 108bp.

Example 2: activity identification of eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1

1. Cell culture

The culture was carried out in the presence of 10% by volume of fetal bovine serum in MEM Medium and McCoy's 5A Medium Modifies at 37 ℃ in 5% by volume of CO ₂ The cell culture chamber of the cell culture system cultures Caco-2 cell lines and HCT-116 cell lines of human colon cancer (Caco-2 and HCT-116 are purchased from ATCC company of America) to be full of 75cm ² And (4) a culture flask.

2. Eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1 transfected human colon cancer cell Caco-2 cell strain and HCT-116 cell strain

1) Caco-2 cells in the culture flask were digested and seeded into 6cm cell culture dishes at a density of 1.5X 10 ⁵ /ml

2) When the cells are fused to 70% -90%, the cells are ready for transfection

3) Preparing a solution A: 500 ul of Opti-MEM Medium +10 ul of Lipofectamine 2000, mixed well, left to stand at room temperature for 5min

Preparing a solution B: mu.l of Opti-MEM Medium + pcDNA3.1 (+) plasmid 1. Mu.g, mixed well, and left to stand at room temperature for 5min

C, preparing liquid C: 500 μ l of Opti-MEM Medium + pcDNA3.1 (+) -vtrna2-1 plasmid 1 μ g/2 μ g, mixing well, standing at room temperature for 5min

Negative control group D solution: solution A + solution B; overexpression group E solution: standing solution A and solution C at room temperature for 5min

4) Discarding the original culture medium from the petri dish, adding 5ml of the culture medium, adding solution D and solution E to the petri dish, respectively, at 37 deg.C, 5% ₂ Is cultured in the cell culture chamber for 48 hours.

The transfection procedure of HCT-116 into human colon carcinoma cells was identical to that described above.

3. Total RNA extraction

1) Taking the transfected pcDNA3.1 (+) -vtrna2-1 group and the control group Caco-2 cell, adding 700 mul of QIAzol lysine Reagent lysate to lyse the cell, standing at room temperature for 5min

2) Adding 140 μ l chloroform, vortexing for 15s, and standing at room temperature for 3min

3) Centrifuging at 4 deg.C and 12000g for 15min, balancing to room temperature, separating the sample into 3 layers, transferring the upper water phase containing RNA into a new centrifuge tube, adding 1.5 times volume of 100% ethanol, and mixing;

4) Sucking 700 mul of sample to RNeasy microcentrifuge column type, inserting the centrifugal column into a 2ml collecting tube, centrifuging at 10000rpm for 15s at room temperature, and discarding the filtrate;

5) Adding 700 μ l RWT buffer to the centrifugal column, centrifuging at 10000rpm for 15s at room temperature, and discarding the filtrate;

6) Adding 500 μ l RPE buffer into the centrifugal column, centrifuging at 10000rpm for 15s at room temperature, and discarding the filtrate;

7) Adding 500 μ l RPE buffer into the centrifugal column, centrifuging at 10000rpm for 2min at room temperature, and removing the filtrate;

8) Inserting the centrifugal column into a new collecting pipe, and centrifuging at 14000rpm for 1min at room temperature;

9) Transferring the centrifugal column to a new 1.5ml centrifuge tube, adding 30-50 μ l ribozyme-free water, standing for 1min, centrifuging at 14000rpm for 1min at room temperature, measuring the concentration, and freezing at-80 deg.C.

4. First Strand cDNA Synthesis

Using High-Capacity RNA-to-cDNA ^TM Kit (Applied Biosystems, catalog number: 4387406). Mu.g of total RNA sample, 1. Mu.l of 20Xenzyme Mix, 10. Mu.l of 2 XRT Buffer Mix (containing nucleotides dNTPs, random octamers, and oligo dT-16), was taken, and RNase Free H2O was added to the total reaction system to make 20. Mu.l. The reaction system is as follows: 60min at 37 ℃, 5min at 95 ℃, and infinity at 4 ℃. The reverse transcribed cDNA samples were frozen at-20 ℃.

5. Real-time PCR experiment

1) Primer and method for producing the same

5'-3' of vtrna2-1 upstream primer GGGTCGGAGTTAGCTCAAGC

5'-3' of downstream primer of vtrna2-1, AAAGGGTCAGTAAGCACCCG

GAPDH was purchased from Applied Biosystems ^TM ，Corresponding TaqMan Assay ID:Hs99999905_m1

2) Fluorescent quantitative PCR amplification

The Realtime PCR reaction system is configured as follows:

add 18. Mu.L of the mixture to each well of a 96-PCR plate.

The corresponding 2. Mu.L of cDNA was added.

Carefully stick the sealing film and mix by brief centrifugation.

The 96-PCR plate was placed on a Realtime PCR instrument for PCR reaction.

The following procedure was followed:

at 95 ℃ for 30 seconds; 40 PCR cycles (95 ℃,5 sec; 60 ℃,40 sec (fluorescence collection)). After the amplification reaction is finished, the melting curve of the PCR product is established by (95 ℃,10 seconds; 60 ℃,60 seconds;

95 ℃,15 seconds); and slowly heated from 60 c to 99 c.

3) And (3) result and calculation: the target gene and the internal reference of each sample are subjected to Realtime PCR reaction, and 3 multiple wells are detected for each sample. Data mining 2 ^-△△CT The method is used for analysis.

The experimental result shows that when the dose of the transfected pcDNA3.1 (+) -vtrna2-1 is 1 mu g, the relative expression level of the human colon cancer Caco-2 cell is 4.59 times of that of the control group, and when the dose of the transfected pcDNA3.1 (+) -vtrna2-1 is 2 mu g, the relative expression level of the human colon cancer Caco-2 cell is 9.36 times of that of the control group (FIG. 5A). When the dose of the transfected pcDNA3.1 (+) -vtrna2-1 is 1 mu g, the relative expression level of the human colon cancer HCT-116 cell is 2.95 times of that of the control group, and when the dose of the transfected pcDNA3.1 (+) -vtrna2-1 is 2 mu g, the relative expression level of the human colon cancer HCT-116 cell is 7.2 times of that of the control group (figure 5B).

Example 3: influence of eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1 on growth curve of human colon cancer cell Caco-2 cell line

And (3) preparing the cells in the exponential growth phase into cell suspension by adopting a 0.25% pancreatin digestion passage method. Counting the cells after blowing uniformly according to 1 × 10 ⁵ The density of each ml was inoculated in a 24-well culture plate. Respectively in the transfectionAnd d, digesting 3-well cells in the cells by using trypsin solution after 24h,48h and 72h of transfection for examination, calculating the average value of the number of the 3-well cells, and drawing daily cell numbers on coordinate paper by taking the culture time (d) as an abscissa and the cell number as an ordinate to obtain a cell growth curve.

The experimental results show that compared with a blank control group and a negative control group, the cell number of the over-expression group is reduced in 24h,48h and 72h after transfection, and the difference has statistical significance (p is less than 0.05). The over-expression of the vtrna2-1 has the effect of inhibiting the growth of human colon cancer cells Caco-2. (FIG. 6)

Example 4: influence of eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1 on proliferation of human colon cancer cell Caco-2 cell line

Human colon cancer Cell Caco-2 Proliferation was detected using MTT Kit (MTT Cell Proliferation Assay Kit, ab 211091). The Caco-2 cells in the growth exponential phase were cultured in a 96-well plate, and the number of cells was adjusted to 1X 10 ⁴ Transfection was performed 24h later at 70% of cell confluence per well. The procedure was the same as that of example 2, 3 groups, namely, a blank control group, a negative control group, and an overexpression group, were provided, each group having 6 duplicate wells. Discard the medium 24, 48h and 72h after transfection, replace serum-free medium 50. Mu.L, MTT Reagent 50. Mu.L, incubate at 37 ℃ for 3h, discard the medium and MTT Reagent, add 150. Mu.L MTT Solvent. And (4) keeping out of the light, shaking gently for 15min, and detecting the light absorption value of each hole at the wavelength of 590nm by using an enzyme-labeling instrument.

MTT experiment results show that compared with a blank control group and a negative control group, the cell proliferation of an overexpression group is reduced (p is less than 0.05), and the overexpression of vtrna2-1 inhibits the proliferation of human colon cancer cells Caco-2 (figure 7).

Example 5: influence of eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1 on expression of human colon cancer cell Caco-2 proliferating cell nuclear antigen PCNA

1) Protein extraction

Precooling RIPA protein extraction reagent, and adding protease inhibitor. 0.1M PMSF stock solution was added before the start of protein extraction, PMSF final concentration 1mM. Cracking on ice for 20min, centrifuging at 4 ℃,13000rpm,20min. And taking the supernatant after centrifugation, subpackaging and storing to be tested.

2) Protein quantification and adjustment by BCA method: preparing BCA working solution A: solution B =50, sample diluted with PBS. Sample preparation: BCA working solution =1, after mixing uniformly, incubating at room temperature for 60min, and reading the OD value by a 570nm wavelength filter of a microplate reader. Protein concentration was adjusted by RIPA and the final concentration of the sample was 4mg/ml after 5 Xreduction of sample buffer.

3) WB assay of target protein

(1) According to the molecular weight of the target protein, 12% of separation gel is prepared, and the concentration of the concentrated gel is 5%. (2) Loading amount of the protein sample to be detected: 20. Mu.g/well. (3) Electrophoresis conditions are as follows: the concentrated gel has constant pressure of 90V for about 20min; the gel constant pressure is 160V, and the electrophoresis stop time is determined by pre-staining protein marker. (4) Wet transfer method, transfer film conditions: constant current of 300mA, NC membrane with aperture of 0.45 mu m and membrane rotating time of 1h. (5) And (3) sealing: the membrane was completely immersed 3% BSA-TBST with gentle shaking at room temperature for 30min. (6) Primary antibody incubation: the primary antibody was diluted with 3% BSA-TBST, incubated for 10min at room temperature, and left overnight at 4 ℃. (7) The membrane was removed from 4 ℃ and incubated at room temperature for 30min. Washing the membrane: TBST membrane wash 5 times, each at 3min (8) secondary antibody incubations: the secondary antibody was diluted with 5% skim milk powder-TBST, goat anti-rabbit IgG (H + L) HRP,1 10000, gently shaken at room temperature for 40min. Washing the membrane: the membrane was washed 6 times with TBST, 3min each time. (9) ECL is added on the membrane and reacts for 3-5min, and the film is exposed: 10s-5min (exposure time adjusted with different light intensity), developing for 2min, and fixing.

4) Reference protein WB experiment

(1) Washing the membrane with striping Buffer at 37 deg.C for 30min. (2) Washing the membrane: washing the membrane with deionized water for 3 times, and washing the membrane with TBST for 3 times, each time for 3min. (3) The membrane was completely immersed in 5% skimmed milk powder-TBST and gently shaken at room temperature for 30min. (4) Incubation internal reference: GAPDH murine mab was added, the antibody was diluted with 5% skim milk powder-TBST, 1: and (4) diluting with 5000, and incubating for 40min at room temperature. (5) Washing the membrane: the membrane was washed 5 times with TBST, 3min each time. (6) And (3) secondary antibody incubation: the secondary antibody was diluted with 5% skim milk powder-TBST, goat anti-mouse IgG (H + L) HRP,1 10000, gently shaken at room temperature for 40min. (7) Washing the membrane: the membrane was washed 5 times with TBST, 3min each time. (8) ECL is added on the film to react for 3-5min, the film is exposed for 10s-5min (the exposure time is adjusted according to different light intensities), developed for 2min, and fixed. (9) Gel image analysis: and analyzing the gray value of the target strip by ImageJ software.

The experimental results show that, as shown in fig. 8A and 8B, PCNA in the vtrna2-1 overexpression group was significantly lower than that in the control group. vtrna2-1 inhibited PCNA expression in human colon cancer Caco-2 cells (PCNA band in fig. 8A and internal reference GAPDH band in fig. 8B). The over-expression of the vtrna2-1 has the effect of inhibiting the proliferation of human colon cancer cells Caco-2.

Example 6: influence of eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1 on expression of human colon cancer cell CaCo-2 nuclear antigen ki67 and 5-bromodeoxyuridine Brdu

Inoculating cells in exponential growth phase into chamber slide by adopting immunofluorescence staining, wherein the inoculation density is 1 × 10 ^5， Transfection was performed at 70% of cell fusion, as in step 2 of example 2. After 48h of transfection, the medium was discarded and washed 3 times with 1 × PBS. Fixing with 4% paraformaldehyde at room temperature for 15min. The slides were washed 3 times with 1 XPBS for 10min each time. Adding 0.2% Triton-100 permeabilization, 1% BSA blocking for 1h. Brdu and Ki67 antibodies (primary dilution ratio 1: 200) were added separately and incubated overnight at 4 ℃. The slides were washed 3 times with 1 XPBS for 10min each time. A fluorescent secondary antibody goat anti-rabbit TRITC (1. The slides were mounted with DAPI-containing anti-fluorescence quencher. Taking a photograph under a fluorescence microscope, wherein the fluorescence excitation wavelength is 494, and the emission wavelength is 518; TRITC excitation wavelength 547, emission wavelength 572; DAPI excitation 340, emission 488, and antigen expression as indicated by TRITC and FITC in the sectioned tissues was observed.

As shown in FIGS. 9A-9C, white arrows indicate positive staining of Brdu, where FIG. 9A shows positive staining of control group Brdu and FIG. 9B shows positive staining of vtrna2-1 overexpression group Brdu. When the number of positively stained cells was counted, positive expression of Brdu in the vtrna2-1 overexpression group was significantly lower than that in the control group as shown in fig. 9C. vtrna2-1 inhibits the expression of Brdu in Caco-2 cells of human colon cancer cells.

As shown in fig. 10A-10C, white arrows indicate Ki67 positive staining, wherein fig. 10A shows Ki67 positive staining in the control group, and fig. 10B shows Ki67 positive staining in the vtrna2-1 overexpression group. When the number of positively stained cells was counted, positive expression of ktrn 2-1 overexpression group Ki67 was significantly lower than that of the control group as shown in fig. 10C. vtrna2-1 inhibited Ki67 expression in human colon cancer cells Caco-2 cells.

In conclusion, the over-expression of vtrna2-1 has the effect of inhibiting the proliferation of human colon cancer cells Caco-2.

vtrna2-1 sequence (108 bp):

CGGGTCGGAGTTAGCTCAAGCGGTTACCTCCTCATGCCGGACTTTCTATCTGTCCATCTCTGTGCTGGGGTTCGAGACCCGCGGGTGCTTACTGACCCTTTTATGCAA。

Claims (2)

1. the application of a plasmid for expressing a vtrna2-1 gene in preparing a medicament for inhibiting proliferation of a colon cancer cell Caco-2 cell, wherein a deoxynucleotide sequence of a target sequence of the plasmid is as follows:

CGGGTCGGAGTTAGCTCAAGCGGTTACCTCCTCATGCCGGACTTTCTATCTGTCCATCTCTGTGCTGGGGTTCGAGACCCGCGGGTGCTTACTGACCCTTTTATGCAA，

the construction method of the plasmid is characterized by comprising the following steps:

a) Synthesizing a human vtrna2-1 gene fragment by RT-PCR;

b) Connecting the vtrna2-1 gene segment with TA cloning vector, transforming the recombinant plasmid into DH5 alpha competent cell, identifying and screening positive clone through cloning PCR, extracting positive cloning plasmid, performing enzyme cutting by using restriction enzyme, wherein the enzyme cutting sites are HindIII and XhoI respectively,

c) Connecting the enzyme digestion product with eukaryotic plasmid vector pcDNA3.1 (+), transforming the connection product into DH5 alpha competent cell, identifying by cloning PCR, identifying and screening positive clone, extracting plasmid to obtain eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1,

d) The constructed eukaryotic recombinant plasmid pcDNA3.1 (+) -vtrna2-1 is identified by using a restriction enzyme cutting map.

2. The use according to claim 1, characterized in that the plasmid is constructed by recombination of a vtrna2-1 gene fragment with a eukaryotic expression plasmid.

Images