CN114395561B - Method for regulating CD276 gene expression - Google Patents

Abstract

The present application relates to a method of modulating the expression of the CD276 gene comprising the use of a substance that specifically modulates the expression of CD 276. The application also analyzes the regulation mechanism and finally determines a new drug target. The method can effectively inhibit cell proliferation, invasion and metastasis, and can screen patients sensitive to CD 276-targeted drugs or treatment according to the substance or a regulation mechanism so as to carry out accurate treatment, so that the method has a good clinical application prospect.

Description

Method for regulating CD276 gene expression

Technical Field

The application relates to a method for regulating and controlling CD276 gene expression, belonging to the technical field of biology.

Background

Cancer is a general term for malignant tumors characterized by uncontrolled division of abnormal cells, unlimited proliferation, invasion and destruction of surrounding normal tissues. Cancer is the second leading cause of death worldwide, resulting in about 1 million deaths each year, with about one-sixth of deaths worldwide being caused by cancer. Chemotherapy is still the primary treatment for cancer, but the ideal effect is far from being achieved. In recent years, as targeted therapy or precision therapy has been proven to greatly improve the therapeutic effect of cancer patients, targeted therapy or precision therapy is increasingly becoming a hotspot in the field of anti-tumor therapy. However, the development of targeted or precision therapies is still limited by a number of conditions, largely attributed to the lack of suitable targets and the lack of methods for accurately typing various types of patients.

Among the immunotherapeutic approaches for cancer, inhibitor therapy with checkpoints is currently the most commonly used immunotherapeutic regimen. B7-H3 (CD 276) is an important immune checkpoint member of B7 and CD28 families, is expressed in various malignant tumors and is closely related to factors such as growth, metastasis, recurrence, poor prognosis and the like of the malignant tumors, so that a regulation substance specific to the CD276 needs to be screened out, a regulation mechanism in the regulation substance is cleared, a new drug target is developed, the effects of effectively inhibiting cell proliferation, invasion and metastasis are achieved, and patients sensitive to drugs or treatment targeting the CD276 can be screened out according to the regulation substance or the regulation mechanism so as to carry out precise treatment.

Disclosure of Invention

In view of the above technical problems, the present application provides a method for regulating the expression of CD276 gene.

The inventors found for the first time that there is a close association between FKHD family proteins and CD 276. The FKHD family protein can specifically regulate the expression of CD276, and the target sequence for the regulation is an FKHD motif in a CD276 gene enhancer. The core technical idea of the present application will be exemplified by experiments of the specific FKHD family protein FOXA1 in certain cells (prostate cancer cells).

In a first aspect, the present application provides a method of modulating the expression of a CD276 gene in a cell, comprising the step of altering the expression or activity of an FKHD family protein in said cell; or a step of intervening in the binding of the FKHD family protein to the enhancer of the CD276 gene in the cell; or a step of editing the FKHD motif in the enhancer of the CD276 gene in the cell.

As is known to those skilled in the art, the function of a protein is usually related to the expression level and activity of the protein, so that when the FKHD family protein specifically regulates the expression of CD276, the regulation effect on CD276 can be influenced by changing the expression level or activity of the FKHD family protein.

In some embodiments, "modulating" is inhibiting or enhancing.

In some embodiments, "change" is an increase or decrease; this can be accomplished by means of conventional techniques in the art, including but not limited to, adding an enhancer or agonist that increases the amount or activity of the FKHD family protein, or adding an inhibitor or repressor that decreases the amount or activity of the FKHD family protein, or editing the nucleic acid sequence of the FKHD family protein, or allowing the FKHD family protein to be recombinantly expressed in the cell, etc.; such as EZH2 or its inhibitor GSK126, EPZ-6438, BET or its inhibitor JQ1, LSD1 or its inhibitor GSK2879552.

In some embodiments, "intervention" is promotion or hindrance; this can be accomplished by means of routine techniques in the art, including but not limited to the addition of competing ligands for the FKHD family proteins, thereby blocking the FKHD family proteins from binding to the enhancer of the CD276 gene; or editing the enhancer sequence of the CD276 gene to promote or block the binding of FKHD family proteins to the enhancer of the CD276 gene, and the like.

In some embodiments, "editing" is mutation, modification or knock-out; this can be accomplished by means of techniques that are conventional in the art, including, but not limited to, point mutations, frameshift mutations, rearrangements, methylation modifications, chemical modifications, gene targeting, gene editing, gene silencing (e.g., using siRNA, shRNA plasmids, and shRNA lentiviral particles), and the like.

In some embodiments, the sequence of the FKHD motif is shown as SEQ ID No.1 or SEQ ID No.2, or the sequence of the enhancer of the CD276 gene is shown as SEQ ID No. 3.

In a second aspect, the present application provides a method for detecting, monitoring or evaluating the expression level of CD276 in a test sample, comprising determining the expression level of FKHD family protein in the test sample, and inferring whether the expression level of CD276 in the test sample is increased or decreased relative to that in a control sample based on a negative correlation between FKHD family protein and CD276 expression by comparison with the expression level of FKHD family protein in a control sample.

In a third aspect, the present application provides the use of an FKHD family protein in the manufacture of a medicament, compound, composition or formulation for reducing the amount of CD276 expressed in a cell, or the use of an FKHD family protein in the manufacture of a medicament, compound, composition or formulation for simultaneously reducing the amount of CD276 and TGF β expressed in a cell.

In a fourth aspect, the present application provides a method of inhibiting cell proliferation, invasion or migration, comprising inhibiting the expression of CD276, and/or increasing the expression level or activity of an FKHD family protein.

In some embodiments, the cell or its corresponding individual has undergone radiation therapy.

The present application provides a method for treating cancer, comprising inhibiting the expression of CD276, and/or increasing the expression level or activity of FKHD family proteins; preferably, the individual suffering from cancer has undergone radiation therapy.

In a fifth aspect, the present application provides a method of screening an individual for sensitivity to a drug or treatment, or a method of assessing the sensitivity of an individual to a drug or treatment, or a method of assessing the prognosis of a treatment for an individual; comprising the step of determining the expression level or activity of an FKHD family protein targeted to CD276 in an individual.

The present application provides a method for evaluating the progression of a disease, comprising the step of determining the expression amount or activity of an individual FKHD family protein.

In some embodiments, the FKHD family protein is FOXA1, a fragment of FOXA1, a variant of FOXA1, and/or a derivative of FOXA1.

In some embodiments, FOXA1, a fragment of FOXA1, a variant of FOXA1, and/or a derivative of FOXA1 all contain a sequence that binds to the FKHD motif.

In a sixth aspect, the present application provides a nucleic acid having a sequence as shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No. 3.

In a seventh aspect, the present application provides the use of a nucleic acid as described above, or a ligand thereof, as described above, for inhibiting the expression of the CD276 gene, wherein the nucleic acid is bound or edited as a target.

The present application has the following advantages over the prior art:

1) The FKHD family protein is proved to have a regulating effect on the expression of a CD276 gene for the first time.

2) The FKHD family protein is proved to be capable of being specifically combined with an enhancer of a CD276 gene for the first time, so that the transcription of the CD276 gene is inhibited.

3) The sequence of the enhancer's FKHD motif was first shown to regulate CD276 expression as a drug or therapeutic target.

4) The expression level of the FKHD family protein can be used as a basis for screening patients sensitive to CD276 regulation in the future.

Drawings

Various additional advantages and benefits will become apparent to those of ordinary skill in the art upon reading the following detailed description of the preferred embodiments. The drawings are only for purposes of illustrating the preferred embodiments and are not to be construed as limiting the application.

FIG. 1 shows a FOXA1 knockdown cell line constructed.

FIG. 2 shows that a decrease in FOXA1 expression increases the expression of CD 276.

FIG. 3 shows that FOXA1 was successfully knocked out with nucleic acid sequences that specifically bind to the CD276 gene enhancer.

FIG. 4 shows FOXA1 specifically binds to the CD276 gene enhancer to inhibit the expression of the CD276 gene.

FIG. 5 shows that FOXA1 knock-out results in enhanced cell invasion.

FIG. 6 shows that knocking down CD276 specifically inhibits cell invasion.

FIG. 7 shows that the FOXA1 protein expression level decreases with increasing irradiation intensity.

FIG. 8 shows that the protein expression of CD276 increased with increasing irradiation intensity.

FIG. 9 shows the inhibition of cell proliferation by a combination of radiotherapy and CD276 knockdown.

FIG. 10 shows the expression difference of FOXA1 protein in human prostate cancer cell lines.

FIG. 11 shows the efficiency of CD276 knock-out in PC-3 cells.

FIG. 12 shows that knock-out of CD276 inhibits PC-3 cell proliferation.

FIG. 13 shows that CD276 knock-out inhibits PC-3 cell invasion.

FIG. 14 shows that knock-out of CD276 inhibits PC-3 cell migration.

Detailed Description

The following examples are only used to illustrate the technical solutions of the present application more clearly, and therefore are only used as examples, and the protection scope of the present application is not limited thereby.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs; the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application; the terms "including" and "having," and any variations thereof, in the description and claims of this application and the description of the above figures are intended to cover non-exclusive inclusions.

Reference herein to "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment can be included in at least one embodiment of the application. The appearances of the phrase in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments. It is explicitly and implicitly understood by one skilled in the art that the embodiments described herein can be combined with other embodiments.

In the description of the embodiments of the present application, the term "and/or" is only one kind of association relationship describing the association object, and means that three relationships may exist, for example, a and/or B, and may mean: a exists alone, A and B exist simultaneously, and B exists alone. In addition, the character "/" herein generally indicates that the former and latter associated objects are in an "or" relationship.

As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

As used herein, "CD276", also known as B7-H3, is a 534 amino acid type I transmembrane glycoprotein belonging to the B7-CD28 family of immune checkpoint molecules. Under normal conditions, the protein expression level of CD276 is tightly controlled and maintained at a low level, but CD276 is over-expressed in various tumors, such as prostate cancer, pancreatic cancer and breast cancer, and the high expression level of CD276 is positively correlated with the development of cancer and negatively correlated with the survival time of patients.

As used herein, "FKHD (Forkhead) family protein" is also referred to as a Forkhead box protein or FOX (Forkhead box) protein, which is a class of transcription factors having a wing-like helical structure in their DNA binding region. Since the amino acid residues that bind to this DNA binding region are conserved, researchers speculate that this binding pattern may be prevalent in FKHD family proteins.

As used herein, the term "FKHD motif (FKHD motif)" is a conventional term in the art and refers to a nucleic acid sequence of the enhancer region of a target gene that binds to FKHD family proteins.

As used herein, "FOXA1 (Forkhead box A1)", also known as HNF-3 α, is one of the Forkhead gene family transcription factors. The FOXA1 protein regulates transcription of a target gene by direct binding to the FKHD motif.

The application also applies to fragments of FOXA1, variants of FOXA1 and/or derivatives of FOXA1.

As used herein, "fragment" refers to a segment of a polypeptide contained in a protein.

As used herein, "variant" refers to an amino acid sequence that has 50% to 60% or more homology, 61% to 70% or more homology, or 71% to 80% or more homology, or 81% to 90% or more homology, or 91% to 99% or more homology, or 100% homology to the original protein sequence.

As used herein, "derivative" refers to a novel substance which is synthesized by a series of reactions on a protein, and which has properties or functions similar to those of the original protein.

In some embodiments, a fragment of FOXA1, a variant of FOXA1, and/or a derivative of FOXA1 comprises all of the amino acids that bind to the FKHD motif in the CD276 enhancer; or has the function of binding to the FKHD motif in the CD276 enhancer.

As used herein, "transforming growth factor-beta (TGF- β)" belongs to a group of newly discovered TGF- β superfamilies that regulate cell growth and differentiation.

In the medical context, "detecting" or "determining" is the act or process of identifying one or more health conditions (including disease and/or injury) by measuring one or more factors to determine the nature and/or cause of the disease.

As used herein, the term "treating" refers to reducing or alleviating the progression, severity and/or duration of the onset and/or symptoms of a disease.

As used herein, "monitoring" relates to tracking those diseases, conditions, complications, or risks that have been diagnosed, such as analyzing the progression of a disease, or analyzing the effect of a particular treatment on the progression of a disease or condition.

As used herein, "assessing" refers to predicting the condition or complication of a disease before symptoms or markers of the disease become apparent, or have significantly changed.

In medicine, "prognosis" refers to the empirically predicted progression of a disease.

As used herein, "cell proliferation" is the basis for the growth, development, reproduction, and inheritance of an organism, and aberrant cell proliferation may lead to the production of tumors.

As used herein, "invasion" refers to the invasion or occupation of a malignant tumor from a primary or secondary tumor to adjacent host tissue.

As used herein, "migration" refers to invasion of a tumor cell from its primary site into a lymphatic vessel, blood vessel, or body cavity site, where the tumor cell is carried by the blood stream, lymphatic stream to another site or organ to continue growing, forming the same type of tumor as the primary tumor.

As used herein, the term "ligand" refers to a substance that selectively binds to a target, including, but not limited to, proteins, aptamers (aptamers), peptidomimetics (peptibodies), mimetics (mimetics), bacteriophages, inhibitors, compounds, antibodies, and the like.

The term "specifically recognizes" or "selectively binds" or "specifically binds" means that when the binding partner is present in a mixture with other molecules or organisms, the target also preferentially binds or recognizes the binding partner. The binding may be mediated via covalent or non-covalent interactions or a combination of both.

The methods of the present application may be in vitro or in vivo; the method can be diagnostic or therapeutic, or non-diagnostic or non-therapeutic, and can be selected by those skilled in the art according to the actual situation.

As used herein, a "cell" is an animal or human cell, which may be an isolated cell, an in vitro cell, or an in vivo cell; optionally tumor cells (cancer cells) or metastatic cancer cells, e.g., breast cancer cells, pancreatic cancer cells, prostate cancer cells, and the like.

In some embodiments, the cell is a Castration Resistant Prostate Cancer (mCRPC) cell.

In some embodiments, the cells are the aforementioned various cancer cells with low expression of FOXA1.

As used herein, "patient" or "individual" or "subject" refers to a human or an animal.

In some embodiments, the individual has cancer, e.g., breast cancer, pancreatic cancer, prostate cancer, and the like.

As used herein, "target" or "target" refers to a binding site for the action of a drug in vivo, or a site targeted by a therapeutic method.

As used herein, the term "control population" or "control sample" can be a negative control population or a positive control population. In some embodiments, the control population is a population of individuals having the same disease as the subject individual. In some embodiments, the control population is a population of individuals who have the same disease as the subject individual and do not exhibit a crisis response and/or a life-threatening response to the disease. In some embodiments, the control population is a population of normal individuals. In some embodiments, the control population is a population of individuals wherein a majority of the members of the control population do not have the same disease as the subject individual. In some embodiments, the population is an unbiased population.

As used herein, a "test sample" refers to a sample of fluid, tissue, secretion or excretion obtained from a subject, including but not limited to a sample of blood, serum, plasma, saliva, sputum, urine, gastric fluid, digestive fluid, tears, sweat, stool, semen, vaginal fluid, interstitial fluid, fluid derived from tumor tissue, ocular fluid, mucus, cerumen, oil, glandular secretions, spinal fluid, skin, cerebrospinal fluid from within the skull, tissue, fluid or material from a nasal swab, throat swab, oral swab (e.g., buccal swab), vaginal swab, or nasopharyngeal wash, biopsy fluid or material, fetal fluid, amniotic fluid, umbilical cord blood, lymph, luminal fluid, pus, microbiota obtained from the subject, meconium, milk or other secretion or excretion.

The application discloses the association of the FKHD family protein and CD276 and the mechanism of the FKHD family protein for regulating the CD276 for the first time, and provides an important research idea and an intervention target for treating related diseases. To illustrate only the core idea of the present invention, experiments were performed below using FOXA1, a specific FKHD family protein, in a specific cell (prostate cancer cell).

Example 1 construction of knock-down vector pLKO.1-puro-FOXA1

Designing shRNA primers: shFOXA1 sequence is obtained, shRNA restriction endonuclease site joint is designed to match with vector restriction endonuclease sites (Age 1 and EcoR.1), the sequence of the primer is detailed in Table 1, and the synthesis of Huada gene company is entrusted.

TABLE 1 shFOXA1 primers

Annealing of shFOXA1 primer: after the primers were centrifuged at 12000rpm for 10min, sterile water was added to dilute the primers to 100uM, and an annealing system was prepared as shown in Table 2 below, and the mixture was cooled naturally in a water bath at 100 ℃ for 15 min.

TABLE 2 primer annealing System

Annealing system	50ul
		Forward primer	1ul
Reverse primer	1ul
		10xNEB buffer4	5ul
ddH 2 O	43ul

Vector plasmid pLKO.1-puro double digestion: the reaction tube of the enzyme digestion system is sealed by a sealing film, mixed evenly and centrifuged, and is digested for at least 2 hours at 37 ℃, then the system is subjected to 1% agarose gel electrophoresis (the voltage is set to be 120V, and the electrophoresis time is set to be 30 minutes), and then the product of the plasmid pLKO.1-puro enzyme digestion fragment is recovered, and the reaction system is shown in the following table 3.

TABLE 3 pLKO.1-puro double digestion reaction system

Enzyme digestion system	50ul
		pLKO.1-puro	3ul
EcoR I-HF	1ul
		Age I-HF	1ul
10x QuickCut buffer	5ul
		ddH 2 O	40ul

Ligation of vector plasmid pLKO.1-puro with shFOXA1 primer annealing product: the reaction tubes of the following connection system were sealed with a sealing film, mixed and centrifuged. The reaction conditions were 4 ℃ overnight and the linker system is as in Table 4 below.

TABLE 4 T4 ligase ligation

Connection system	10ul
		pLKO.1-puro restriction enzyme plasmid	2ul
T4 ligase	2ul
		T4 ligase buffer	1ul
Shfoxa1 annealed product	5ul

Transformation and identification:

(1) the above-described ligation product can be used directly in the conversion process, operating on ice. First, 5uL of the ligation product was added to 50. Mu.L of competent cells (DH-5. Alpha.), pipetted uniformly (note that the competent cells were weak and did not blow hard), and allowed to stand on ice for 30 minutes.

(2) The product was placed in a pre-preheated metal bath at 42 ℃ and after a heat shock of 45 seconds, it was kept on ice for 2 minutes.

(3) Adding pre-preheated 1mL of non-resistant LB liquid medium, horizontally placing the medium, and restoring the culture on a shaker at 37 ℃ for 1-2 hours.

(4) 150-200 mu L of the culture medium is evenly coated on a plate containing ampicillin and cultured in an incubator at 37 ℃ for 16-18 hours.

(5) Randomly selecting 5 single colonies with plump growth vigor, inoculating the single colonies into 3-5 mL LB culture medium (the concentration of ampicillin is 100 mug/mL), culturing the single colonies in a constant temperature shaking table overnight (200 rpm and 37 ℃), and randomly selecting 3-5 clonal bacterial liquids to send to a biological company for sequencing verification.

Example 2 packaging of FOXA1-knockdown lentiviruses

HEK-293T cells with good growth state are selected, each well is evenly inoculated in a six-well plate at the density of 1-2 multiplied by 106, the plate is laid one day before transfection, and the cells can be used for transfection when the cells grow to 80-90% confluence.

Transfection: the viral backbone plasmid and helper plasmid were mixed in the ratio of plko.1-puro-shFOXA1: psPAX2: pmd2.G = 4.

TABLE 5 solution formulation system

Component (A tube)	Volume of
		Opti-MEM serum-free medium	500ul
Lipofectamine 3000 transfection reagent	40ul

TABLE 6 solution preparation System

Component (B tube)	Volume of
		pLKO.1-puro-shFOXA1	500ul
Opti-MEM serum-free medium	40ul

Preparation of liposome-DNA complexes: and mixing the contents in the tube A and the tube B uniformly, and incubating for 15-20 minutes at room temperature.

Before adding the complex, the old medium was discarded, 9mL of fresh DMEM medium without diabody but with 10% fetal bovine serum was added to each well, the medium was carefully added along the walls of the well plate (HEK-293T cells have poor anchorage and therefore the medium was carefully added to avoid damaging the cells), 1mL of the mixture from step (3) was added to each well, and the dish was gently shaken to make the distribution uniform.

After the 293T cells were returned to the cell culture chamber (37 ℃ C., 5% CO2) and incubated for 6 to 8 hours, the medium was carefully discarded and replaced with 10mL of previously preheated DMEM medium which is completely free of diabodies but to which 10% FBS was added, and the old medium was treated with 84 disinfectant solution for sterilization and then disposed.

The culture dish was placed in an incubator (37 ℃ C., 5% CO2) and incubated for 48 hours.

About 48 hours after transfection, 10mL of the supernatant of the cultured cells was collected from each well by a syringe, and the supernatant was filtered using a filter having a pore size of 0.45 μm in order to remove residual cell debris from the lentiviral supernatant, i.e., shFOXA1 knockdown lentivirus.

Example 3 construction of knockdown FOXA1 Stable cell lines

Host cell plating: host cells LNCaP in logarithmic growth phase at 2-3X 10 in the evening one day before infection ⁵ Cells/well were seeded in 6-well plates containing 2mL of medium and returned to the cell incubator (37 ℃ C., 5% CO2) for overnight incubation to achieve a cell density of 30-40% confluency upon infection (note that too much cell seeding should not be done).

And (3) centrifugal infection of a pore plate: the above 2mL of prepared virus supernatant was transferred to the corresponding well, while adding 2. Mu.g/mL polybrene (polybrene functions to enhance the infection efficiency of the virus). The periphery of the well plate was sealed with a sealing film to prevent cell contamination, the 6-well plate was centrifuged at room temperature (2000 rpm, with the speed-up/down parameter set to 3, for 20 minutes), the sealing film on the plate was torn off after centrifugation was completed, and incubation was continued in an incubator (37 ℃ C., 5% CO2).

Knockdown cell line screening: after 2 days of culture, the original medium was replaced with a purine-containing medium for pressure selection culture (see FIG. 1).

Example 4 validation of fluorescent quantitative PCR on FOXA1 knockdown cell lines

Designing a target gene sequence and a primer: expression conditions of FOXA1 and CD276 of LNCaP cells are detected by a qRT-PCR method, primers are synthesized according to design target genes FOXA1 and CD276 and an internal reference gene GAPDH primer shown in table 7, and the primers are synthesized by Huada gene company.

TABLE 7 fluorescent quantitative PCR primers

Name of primer	Primer sequences (5 'to 3')
		FOXA1-F	GAAGATGGAAGGGCATGAAA(SEQ ID NO.6)
FOXA1-R	CGCTCGTAGTCATGGTGTTC(SEQ ID NO.7)
		CD276-F	AGCTGTGAGGAGGAGAATGC(SEQ ID NO.8)
CD276-R	TGCTGTCAGAGTGTTTCAGAGG(SEQ ID NO.9)
		GAPDH-F	TGCACCACCAACTGCTTAGC(SEQ ID NO.10)
GAPDH-R	GGCATGGACTGTGGTCATGAG(SEQ ID NO.11)

Extracting total RNA of cells: the following experimental materials and equipment are prepared in advance according to experimental needs: RNA extraction kit, chloroform, absolute ethyl alcohol, centrifuge, vortex instrument, PCR instrument, liquid transfer device and gun head with filter element. Tumor cells in logarithmic growth phase were collected and total RNA of the cells was extracted. The basic operation steps are as follows:

(1) the old medium was discarded, washed one to two times with PBS, and 1mL of RNA lysate (lysate was added according to the number of cells, the kit required 10 cm) ² Adding 1mL of lysate into adherent cells), blowing and beating uniformly until the cells are completely lysed, and adding the lysate into a 2mL nuclease-free centrifuge tube.

(2) Adding 0.2mL of chloroform into each 1mL of cracking sample, vortexing and shaking for 15-30 seconds, and incubating for 10-15 minutes on ice.

(3) Centrifugation was continued at 12000g at 4 ℃ for 15 minutes, after which the upper aqueous phase was aspirated as far as possible and transferred to a nuclease-free centrifuge tube, and an equal volume of absolute ethanol to the aqueous phase was added and vortexed vigorously for 20 seconds.

(4) The Hibind RNA collection tube was mounted on a 2mL centrifuge tube, and the mixture was transferred to the Hibind RNA collection tube, centrifuged (10000 g, 25 ℃ C., 1 minute), and the liquid in the tube was discarded.

(5) 500. Mu.L of RNA Wash Buffer I was added for washing, centrifuged (10000 g, 25 ℃ C., 1 minute), and the liquid was discarded. Then, 500. Mu.L of RNA Wash Buffer I was added thereto, and the mixture was washed 1 time, centrifuged again (10000 g, 25 ℃ C., 1 minute), and the liquid was discarded.

(6) Add 500 u L RNA Wash Buffer II washing 2 times, 13000g free 2 minutes.

(7) The Hibind RNA collection tube was mounted on a new centrifuge tube, 50. Mu.L of DEPC water preheated at 70 ℃ in advance was added thereto, and after standing for 5 minutes, centrifugation was carried out (13000 g, 25 ℃,1 minute) to collect RNA in the centrifuge tube.

First Strand cDNA Synthesis (reverse transcription):

(1) the reaction substances in Table 8 were added to the PCR tubes sterilized in advance.

TABLE 8 solution formulation system

Components	Volume of
		Total RNA (0.1 ng-5. Mu.g)	3ul
Oligo(dT)18(0.1μg/μL)	1ul
		DEPC water	Up to 12ul

(2) Centrifuging and mixing the template and the primers uniformly, incubating for 10 minutes at 65 ℃ in a PCR instrument, and then incubating on ice;

(3) the reaction described in (2) was placed on ice, the reactions were added to the above PCR tube in the following order (in this case, the total volume was 20. Mu.L), the system (see Table 9) was gently mixed, and centrifuged instantaneously.

TABLE 9 solution formulation system

Components	Volume of
		5×Reaction Buffer	4ul
riboLock RNase inhibitors	1ul
		10mM dNTP Mix	2ul
Reverand M-MuLV reverse transcriptase	1ul

(4) Reverse transcription was then performed according to the following procedure: incubate at 42 ℃ for 60 minutes and 70 ℃ for 5 minutes.

(5) The cDNA is subjected to concentration measurement by using Nanodrop, and the concentration is adjusted to 800 to 1000 ng/. Mu.L, and the cDNA is stored at-20 ℃ or-80 ℃ for later use.

Fluorescent quantitative PCR:

(1) GAPDH was selected as a relatively quantitative reference gene in this experiment, the reaction system was 12uL, and the reaction system is shown in Table 10:

TABLE 10 fluorescent quantitative PCR reaction System

Components	Volume of
		2×Light Cycler 480 SYBR GreenI Master	6ul
Forward primer	0.5ul
		Reverse primer	0.5ul
cDNA	5ul

(2) The preparation of the reaction solution needs to be carried out on ice, the reaction solution is fully and uniformly mixed in the tube, a sealing plate film is covered, and the instantaneous centrifugation is carried out. A fluorescent quantitative PCR reaction program was set up and the reaction mixture was placed into a fluorescent quantitative PCR instrument. The reaction conditions are shown in Table 11:

TABLE 11 fluorescent quantitative PCR reaction procedure

As a result, FOXA1 was significantly decreased in the FOXA1 knockdown cell line LNCaP cells, and the expression level of FOXA1 was decreased while the expression level of CD276 was increased (see fig. 2).

Example 5 construction of knockout vector plentiCRISPRV2-sgRNA1+2 (CD 276 enhancer-targeting) targeting CD276enhancer

Obtaining a binding sequence (shown as SEQ ID NO. 3) of FOXA1 and CD276enhancer, wherein the sequence of FKHD motif is shown as SEQ ID NO.1 or SEQ ID NO. 2.

Design of sgRNA1+2 (CD 276 enhance-targeting) primer: obtaining sgRNA1+2 (CD 276 enhance-targeting), designing a restriction endonuclease site joint to be matched with a vector restriction endonuclease site (BsmBI), and leading a primer sequence to be detailed in a table 12 and entrusted to the synthesis of Huada Gene company.

TABLE 12 sgRNA1+2 primer

sgRNA1+2 (CD 276 enhance-targeting) primer annealing: after the primers were centrifuged at 12000rpm for 10min, sterile water was added to dilute the primers to 100uM, and an annealing system was prepared as shown in Table 13 below, followed by water bath at 100 ℃ for 15min and natural cooling in the water bath.

TABLE 13 primer annealing System

Annealing system	50ul
		Forward primer	1ul
Reverse primer	1ul
		10xNEB buffer4	5ul
ddH 2 O	43ul

Vector plasmid plentiCRISPRv2 single cleavage: the reaction tube of the enzyme digestion system was sealed with a sealing film, mixed and centrifuged, and digested at 37 ℃ for at least 2 hours, and then subjected to 1% agarose gel electrophoresis (voltage set at 120V, electrophoresis time set at 30 minutes) to recover the plasmid plentiCRISPRV2 enzyme digestion fragment product, and the reaction system is as shown in Table 14 below.

TABLE 14 pLKO.1-puro double digestion reaction System

Ligation of the vector plasmid plentiCRISPRv2 with sgRNA1+2 (CD 276 enhancer-targeting) primer annealing product: the reaction tubes of the following connection system were sealed with a sealing film, mixed and centrifuged. The reaction conditions were 4 ℃ overnight and the linker system is as in Table 15 below.

TABLE 15 T4 ligase ligation System

Connection system	10ul
		PlentiCRISPRV2 plasmid single enzyme cleavage product	2ul
T4 ligase	2ul
		T4 ligase buffer	1ul
sgRNA1+2 (CD 276 enhancer-targeting) primer annealing product	5ul

Transformation and identification:

(1) the above-described ligation product can be used directly in the conversion process, operating on ice. Firstly, taking 5uL of the ligation product, adding the ligation product into 50uL of competent cells (DH-5 alpha), uniformly blowing the competent cells (note that the competent cells are fragile and do not blow the competent cells hard), and standing the competent cells on ice for 30 minutes;

(2) putting the product in a preheated metal bath at 42 ℃, thermally exciting for 45 seconds, and then putting the product on ice for 2 minutes;

(3) adding 1mL of nonresistance LB liquid culture medium preheated in advance, horizontally placing the liquid culture medium, and restoring the culture on a shaking table at 37 ℃ for 1-2 hours;

(4) 150-200 mu L of the culture medium is evenly coated on a plate containing ampicillin and cultured in an incubator at 37 ℃ for 16-18 hours;

(5) randomly selecting 5 single colonies with plump growth vigor, inoculating the single colonies into 3-5 mL LB culture medium (the concentration of ampicillin is 100 mug/mL), culturing the single colonies in a constant temperature shaking table overnight (200 rpm and 37 ℃), and randomly selecting 3-5 clonal bacterial liquids to send to a biological company for sequencing verification.

Example 6 packaging of knockout lentiviruses targeting the CD276enhancer

Selecting HEK-293T cells with good growth state, wherein the cell size per hole is 1-2 multiplied by 10 ⁶ The density of the cells is evenly inoculated in a six-well plate, the cells are plated one day before transfection, and the cells can be used for transfection when the cells grow to 80-90% confluence.

Transfection: the viral backbone plasmid and helper plasmid were mixed in the ratio of plenticrisprrv 2-sgRNA1+2 (CD 276 enhancer-targeting) psPAX2: pmd2.G =4, where Lipofectamine 3000 acts to enhance transfection efficiency, in the following table 16, table 17.

TABLE 16 solution formulation system

Component (A tube)	Volume of
		Opti-MEM serum-free medium	500ul
Lipofectamine 3000 transfection reagent	40ul

TABLE 17 solution formulation system

And (3) preparing a liposome-DNA compound, namely uniformly mixing the contents of the A tube and the B tube, and incubating for 15-20 minutes at room temperature.

Before adding the complex, the old medium was discarded, 9mL of fresh DMEM medium without diabody but with 10% fetal bovine serum was added to each well, the medium was carefully added along the walls of the well plate (HEK-293T cells have poor anchorage and therefore the medium was carefully added to avoid damaging the cells), 1mL of the mixture from step (3) was added to each well, and the dish was gently shaken to make the distribution uniform.

After the 293T cells were returned to the cell culture chamber (37 ℃ C., 5% CO2) and incubated for 6 to 8 hours, the medium was carefully discarded and replaced with 10mL of previously preheated DMEM medium which is completely free of diabodies but to which 10% FBS was added, and the old medium was treated with 84 disinfectant solution for sterilization and then disposed.

The culture dish was placed in an incubator (37 ℃ C., 5% CO2) and incubated for 48 hours.

After about 48 hours of transfection, 10mL of the supernatant of the cultured cells was collected from each well by a syringe and filtered by using a filter having a pore size of 0.45 μm in order to remove the residual cell debris in the lentiviral supernatant, i.e., CD276 enhance-targeting knockout lentivirus.

Example 7 construction of Stable cell lines targeting knock-out FOXA1 and CD276enhancer binding sites

Host cell plating: host cells LNCaP in logarithmic growth phase at 2-3X 10 in the evening one day before infection ⁵ Cells/well were seeded in 6-well culture plates containing 2mL of medium, which were returned to the cell incubator (37 ℃, 5% CO2) for overnight incubation, with cell density reaching 30-40% confluency upon infection (note that too much seeding of cells should not be done).

And (3) centrifugal infection of a pore plate: the above 2mL of prepared virus supernatant was transferred to the corresponding well, while adding 2. Mu.g/mL polybrene (the effect of polybrene is to enhance the infection efficiency of the virus). The wells were sealed around the plate with a sealing film to prevent cell contamination, and the 6-well plate was centrifuged at room temperature (2000 rpm, 3-rpm acceleration/deceleration parameters, 20 minutes), and after centrifugation, the sealing film was torn off from the plate, and incubation was continued in an incubator (37 ℃, 5% CO2).

Screening of knockout cell lines: after 2 days of culture, the original medium was replaced with a purine-containing medium and pressure-screening culture was carried out.

Example 8 PCR and sequencing validation of Stable cell lines targeting knock-out FOXA1 and CD276enhancer binding sites

Genomic DNA (gDNA) extraction of stable LNCaP cell lines targeting knockout of the FOXA1 and CD276enhancer binding site: the following experimental materials and equipment are prepared in advance according to experimental needs: genome DNA extraction kit (TaKaRa), centrifuge, vortex instrument, PCR instrument, pipettor and rifle head with filter core. Tumor cells in logarithmic growth phase were collected and gDNA of the cells was extracted. The basic operation steps are as follows:

(1) cells were harvested and suspended in 200. Mu.l PBS.

(2) Mu.l Buffer GB, 20. Mu.l protease K and 10. Mu.l RNase A (10 mg/ml) were added and mixed well, followed by warming and bathing in a 56 ℃ water bath for 10 minutes.

(3) Add 200. Mu.l 100% ethanol to the lysate, mix well, move the solution to Spin Column, centrifuge at 12,000rpm for 2 minutes, discard the filtrate.

(4) 500. Mu.l of Buffer WA 12,000rpm WAs added and centrifuged for 1 minute, and the filtrate WAs discarded.

(5) Add 700. Mu.l of Buffer WB 12,000rpm and centrifuge for 1 min, discard the filtrate, rinse 2 times, and centrifuge for 12,000r for 2 min.

(6) Adding 50-200. Mu.l of sterilized water for elution to obtain gDNA.

Verifying primer design: verification primers are designed at two ends of sgRNA1+2 (CD 276 enhancer-targeting) according to a CD276enhancer sequence, the synthesis of the primers is shown in Table 18, and the primers are synthesized by Huada Gene Co.

TABLE 18 PCR primers

Amplification and electrophoresis of the gDNA target fragment: and (3) amplifying a corresponding position sequence of a genome by taking gDNA of a stable LNCaP cell line targeting a binding site of FOXA1 and a CD276enhancer to be knocked out as a template, and preliminarily verifying the knocking-out condition of the binding site of FOXA1 and the CD276enhancer in the LNCaP cell genome by using a PCR product through the fragment length of the PCR amplification product.

Sequencing the amplified fragment of the committee organism in the last step, and further verifying the knockout of the binding site of FOXA1 and CD276enhancer in LNCaP cell genome.

The results show that the nucleic acid sequence of transcription factor FOXA1 specifically binding to the CD276 gene enhancer in the LNCaP cell line was successfully knocked out by using CRISPR-Cas9 gene editing technology in combination with next-generation sequencing technology (see fig. 3).

Example 9 knockdown of FOXA1 again in stable cell lines targeting the FOXA1 knock-out and CD276enhancer binding site demonstrates its regulation of CD276

Host cell plating: host cells LNCaP ctr gRNAs and LNCaP sgRNAs 1+2 in logarithmic growth phase were inoculated at 2 to 3X 105 cells/well into 6-well plates containing 2mL of the medium one night before infection, and returned to the cell incubator (37 ℃ C., 5% CO2) for overnight incubation to achieve a cell density of 30 to 40% confluency (note that cell inoculation should not be excessive) at the time of infection.

And (3) centrifugal infection of a pore plate: 2mL of the prepared shCtrl/shFOXA1 virus supernatant was transferred to the corresponding well, while 2. Mu.g/mL of polybrene (the effect of polybrene was to enhance the infection efficiency of the virus) was added. The wells were sealed around the plate with a sealing film to prevent cell contamination, and the 6-well plate was centrifuged at room temperature (2000 rpm, 3-rpm acceleration/deceleration parameters, 20 minutes), and after centrifugation, the sealing film was torn off from the plate, and incubation was continued in an incubator (37 ℃, 5% CO2).

Screening of knockout cell lines: after 2 days of culture, the original medium was replaced with a purine-containing medium and pressure-screening culture was carried out.

Example 10 validation of FOXA1 on CD276 Regulation in Stable cell lines targeting knock-out FOXA1 and CD276enhancer binding sites by PCR and Fluorogenic quantitative PCR

PCR validation of gDNA fragments of interest from CD276 knock-out and FOXA1 knock-down groups of cells: extracting gDNA of each group of cells for knocking out CD276 and knocking down FOXA1 according to the genome extraction method, amplifying corresponding position sequences of the genome by using the gDNA as a template, and preliminarily verifying the knocking-out condition of the FOXA1 and CD276enhancer binding sites in the LNCaP cell genome through the fragment length of a PCR amplification product.

Validation of FOXA1 on CD276 regulation in fluorescence quantitative PCR on CD276enhancer knockdown and FOXA1 knockdown cell lines in each group: extracting total RNA of cells according to the RNA extraction and reverse transcription method and performing reverse transcription. The control of FOXA1 on CD276 in each of the CD276 knock-out and FOXA1 knock-down cell lines was detected by the primers in Table 7 and the above fluorescent quantitative PCR system and program.

Real-time fluorescent quantitative polymerase chain reaction was used to confirm that prostate cancer cells no longer cause CD276 gene expression changes after knocking out the nucleic acid sequence where the transcription factor FOXA1 specifically binds to the CD276 gene enhancer, confirming that FOXA1 specifically binds to the CD276 gene enhancer in prostate cancer cells to inhibit the expression of the CD276 gene (fig. 4).

Example 11 transwell invasion assay validation of FOXA1 Low expressing prostate cancer cell line on sensitivity to CD276 knockdown

Digesting LNCaP with good growth state into single cell suspension, centrifuging, re-suspending with 1% serum-free RPMI-1640 culture medium, adjusting cell density to 3.3 × 10 ⁵ Each cell/mL, 100. Mu.L of a solution containing 3.3X 10 cells was added to a Transwell upper chamber to which Matrigel matrix gel was added ⁴ Suspension of individual cells, lower chamber was added 650 μ L of RPMI-1640 complete medium containing 40% FBS; culturing in a CO2 incubator at 37 deg.C and 5% for 48 hr, and counting the staining.

The results showed that knocking out FOXA1 in prostate cancer cells caused increased cell invasion (see fig. 5) and knocking down CD276 specifically inhibited cell invasion (see fig. 6).

EXAMPLE 12 inhibition of cell proliferation by combination of radiotherapy and CD276 knockdown

Experiments show that after mouse prostate cancer cells Myc-CaP are irradiated by radiation, the expression level of FOXA1 protein detected by Western Blot shows gradient reduction along with the enhancement of irradiation intensity, and the protein expression of CD276 detected by flow cytometry shows gradient increase (see figures 7-8).

MTT assay to examine the effect of radiotherapy and CD276 knockdown combination on prostate cancer cell growth:

Myc-CaP cells were plated into six-well plates at 1X10 per well ⁵ . After the cells are attached to the wall, plko/shmCD276-1 virus is respectively infected, the liquid is changed after 15h infection, and after 36h, the cells are transferred to a screening culture medium containing puro for screening for 72h. Cells were then plated into three six-well plates, three wells for each plate of Myc-Cap plko/shmCD 276-1. After the cells adhere to the wall, a six-well plate is taken to irradiate for 10GY, the cells are harvested after irradiation for 48h, and 500cells per well are paved into a 96-well plate for 4 plates in total. After the cells adhere to the wall, adding MTT, and after 4h of adding MTT, removing the culture medium by aspiration and adding 150ul DMSO, and shaking the 96-well plate for 10min in a dark place. MTT is completely dissolved, then the light absorption value at 490nm is detected by a microplate reader,MTT was added every 24h thereafter for three consecutive days. The results showed that the knockdown of CD276 on the basis of radiotherapy had a more pronounced inhibitory effect on cell proliferation (see figure 9).

Study of CD276 knockout in PC-3 cells, the effect on cell proliferation, invasion and migration:

when the expression difference of FOXA1 protein in human prostate cancer cell lines was analyzed by GEO, the expression level of FOXA1 was found to be low in PC-3 cells of mCRPC cell line (see FIG. 10).

The PC-3 cells were examined by qPCR and found to be highly efficient in knocking out CD276 (see FIG. 11).

The results showed that, after knocking out CD276, PC-3 cell proliferation (see FIG. 12), PC-3 cell invasion (see FIG. 13) and PC-3 cell migration (see FIG. 14) were inhibited.

The foregoing description of the specific embodiments of the present application discloses technical details of the present application in detail, and illustrates the technical idea of the application to satisfy the requirements of the patent law, but should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make various changes and modifications in light of the present application, together with its knowledge and techniques, without departing from the spirit and scope of the present application, as defined in the appended claims.

SEQUENCE LISTING

<110> Zhengzhou university

<120> a method for regulating CD276 gene expression

<130> 20211227

<160> 17

<170> PatentIn version 3.3

<210> 1

<211> 15

<212> DNA

<213> Artificial Synthesis

<400> 1

catatattta ctttc 15

<210> 2

<211> 11

<212> DNA

<213> Artificial Synthesis

<400> 2

tatttacttt c 11

<210> 3

<211> 666

<212> DNA

<213> Artificial Synthesis

<400> 3

tatagaaccc cacagccctg aggcttggtg ggggagggca gggcaggtgg acggaatgtc 60

gttctttgac tcctttttac aatttgtctt gtagagatca aaatatgcca ctccaaaaca 120

tgccactttg gcatacaatt atttcagatt caacagatgc agaaagaagc catctcagag 180

cttcccttat ctcatgagaa gcagaaactt ctgagaaatg aggactgctg taaatctcct 240

cttctaggga agttttatgg ccacagagaa gatgaagttg gcgccaagat ggatctgcac 300

aaacaaacct tactccatta atttccctca tatatttact ttcccatggt ttactgcctt 360

tgggagccta agattttttt tttttccttt gacttgtcac ttctctacga atttattgtt 420

ctttgttaag atgcataaac ccacattcta accacctctt tgagtttttc atcatatcac 480

tgagtttctc ctgggtacac gcccactgta catgctaata aactatttgt ttttcccttg 540

ttaatctgtt ttttctcagt taattttcag agccccagcc agagaaccta tgtgggtaga 600

ggaaaaagct cccaccctct taccgtcaat tttggtattt tatgcatctc ctgggaaatc 660

atccat 666

<210> 4

<211> 58

<212> DNA

<213> Artificial Synthesis

<400> 4

ccgggcgtac taccaaggtg tgtatctcga gatacacacc ttggtagtac gctttttg 58

<210> 5

<211> 58

<212> DNA

<213> Artificial Synthesis

<400> 5

aattcaaaaa gcgtactacc aaggtgtgta tctcgagata cacaccttgg tagtacgc 58

<210> 6

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 6

gaagatggaa gggcatgaaa 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 7

cgctcgtagt catggtgttc 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 8

agctgtgagg aggagaatgc 20

<210> 9

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 9

tgctgtcaga gtgtttcaga gg 22

<210> 10

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 10

tgcaccacca actgcttagc 20

<210> 11

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 11

ggcatggact gtggtcatga g 21

<210> 12

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 12

caccgtatag aaccccacag ccctg 25

<210> 13

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 13

aaaccagggc tgtggggttc tatac 25

<210> 14

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 14

caccgcccag ccagagaacc tatgt 25

<210> 15

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 15

aaacacatag gttctctggc tgggc 25

<210> 16

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 16

ttgtgatatg caatcaagtt tagaa 25

<210> 17

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 17

tccattttta ggtgtgcagt tt 22

Claims (5)

1. A non-therapeutic method for inhibiting the expression of CD276 gene in a cell in vitro, comprising the step of increasing the expression level or activity of FKHD family proteins in said cell; or a step of promoting binding of the FKHD family protein to an enhancer of the CD276 gene in the cell; the FKHD family protein is FOXA1.

2. The method of claim 1, wherein the sequence of the FKHD motif is set forth in SEQ ID No.1 or SEQ ID No.2, or the sequence of the enhancer of the CD276 gene is set forth in SEQ ID No. 3.

Use of an FKHD family protein, which is FOXA1, in the manufacture of a medicament or composition for the treatment of prostate cancer.

4. The use of claim 3, wherein the prostate cancer is human prostate cancer.

5. The use of claim 3 or 4, wherein the prostate cancer is castration-resistant prostate cancer.

Images