CN111593055B - Siniperca chuatsi male specific anti-mullerian hormone AMHY gene and application thereof - Google Patents

Abstract

The invention discloses a Siniperca chuatsi male specific anti-mullerian hormone AMHY genome sequence and a construction method thereof, as well as Siniperca chuatsi male specific anti-mullerian hormone AMHY genes and encoding proteins thereof. Wherein the AMHY genome sequence is shown as SEQ ID NO:1, the AMHY gene sequence is shown as SEQ ID NO:4, and the sequence of the coded protein is shown as SEQ ID NO:5, also discloses a siniperca chuatsi AMHY gene-based male molecular marker primer, a siniperca chuatsi gender identification method and application of the AMHY gene, the encoded protein and the male molecular marker primer in the all-female breeding of siniperca chuatsi, wherein the sequence of the male molecular marker primer is shown as SEQ ID NO:6 and SEQ ID NO:7, the male molecular marker primer can realize the rapid and accurate identification of the sex of the siniperca chuatsi. The sex identification method is simple and short, and has high efficiency.

Description

Siniperca chuatsi male specific anti-mullerian hormone AMHY gene and application thereof

Technical Field

The invention belongs to the technical field of siniperca chuatsi, and particularly relates to a siniperca chuatsi male specific anti-mullerian hormone AMHY gene and application thereof.

Background

The sex specific molecular marker is an important prerequisite for realizing the parthenocarpy breeding of the fishes and describing the sex-determining molecular mechanism of the fishes. In recent years, with the rapid development of high throughput sequencing technologies, more and more sex-specific molecular markers have been identified for fish, such as large yellow croaker (larmichtyscocea), snakehead (Channaargus), silver carp (Hypophthalmichthys mostilis), and Bighead carp (Hypophthalmichthys molitrix). However, although sex-specific molecular markers are found in various fishes by using a high-throughput sequencing method, sex-determining genes of most of the fishes are unknown, and the difficulty in interpreting the sex-determining molecular mechanism of the fishes is increased.

anti-Mullerian hormone (AMH), a member of the TGF- β superfamily, is closely associated with the development of Mullerian. During male development in mammals, amh can induce the degradation of mullerian tube, prevent the development of reproductive organs of mammals towards females, and promote the development of the middle renal tube into male reproductive organs. Teleost does not have mullerian tubes, but in recent years, studies in various fish have shown that the amh gene is involved in sex determination and differentiation processes. And two amh genes are found in both the silver Hank and white spot pike, one in the autosome and the other in the Y chromosome. And after the amyh is knocked out or knocked down, male fishes are all converted into female fishes in a sexual reversion manner, which indicates that the amyh is the sex-determining genes of the two fishes. In addition, the presence of amyy was also found in tilapia, and studies indicate that amyy/amhrII plays a decisive role in tilapia sex determination.

Siniperca chuatsi (Siniperca chuatsi) belongs to the order Perciformes, the family Sinipercidae, the genus Sinipercica, commonly known as Osmanthus fragrans, and is named as Mandarin Fish (Mandarin Fish) by the name of English, and has a long history of eating in China. The siniperca chuatsi has delicious meat, rich nutrition and no muscle prick, is a treasure for freshwater fishes, and is deeply loved by consumers. The growth process of the siniperca chuatsi is sex-two-state, and the weight of the female fish is about 10-20% heavier than that of the male fish in the commercial fish of the same age, so that the full-female siniperca chuatsi cultivation is realized, and the economic benefit is higher.

Disclosure of Invention

The first purpose of the invention is to provide a Siniperca chuatsi male specific anti-Mullerian hormone AMHY genome sequence and a construction method thereof, as well as a Siniperca chuatsi male specific anti-Mullerian hormone AMHY gene, a coding protein and a construction method thereof.

The second purpose of the invention is to provide a male molecular marker primer based on the Siniperca Chuatsi AMHY gene and a method for identifying the Siniperca Chuatsi by using the primer.

The third purpose of the invention is to provide the application of the siniperca chuatsi AMHY gene, the encoded protein and the primers in the all-female breeding of siniperca chuatsi.

The first object of the present invention can be achieved by the following technical solutions: an Amhy genome sequence of siniperca chuatsi male specific anti-mullerian hormone (AMHY) is shown as SEQ ID NO:1 is shown.

Preferably, the method for constructing the siniperca chuatsi male specific anti-mullerian hormone AMHY genome sequence comprises the following steps:

(1) Preparing a mandarin fish DNA sample;

(2) Constructing a sequencing library and performing high-throughput sequencing;

(3) Enrichment of Y chromosome specific DNA fragments: mainly comprises male fish genome assembly, male and female comparison and deep analysis are carried out to obtain male fish Y chromosome candidate DNA fragments, and then the male Y chromosome specific DNA is annotated to obtain the AMHY genome sequence.

The siniperca chuatsi male specific anti-mullerian hormone AMHY gene provided by the invention has a nucleotide sequence shown as SEQ ID NO:4 is shown in the specification; namely the nucleotide sequence of the protein coding gene of the siniperca chuatsi male specific anti-mullerian hormone AMHY genome sequence.

The amino acid sequence of the coding protein of the AMHY gene is shown in SEQ ID NO:5, respectively.

The method for constructing the siniperca chuatsi male specific anti-mullerian hormone AMHY gene comprises the following steps:

(1) Extracting total RNA of male gonads of siniperca chuatsi;

(2) Synthesizing a cDNA chain by taking the RNA in the step (1) as a template and oligo dT as a primer;

(3) Using cDNA as a template, and using SEQ ID NO:2 and SEQ ID NO:3 as a primer, and obtaining the Siniperca chuatsi male specific anti-mullerian hormone AMHY gene by PCR.

The second object of the present invention can be achieved by the following technical solutions: a male molecular marker primer based on an Amhy gene of siniperca chuatsi comprises an upstream primer AMHY-F and a downstream primer AMHY-R, wherein the nucleotide sequence of the upstream primer AMHY-F is shown as SEQ ID NO:6, the nucleotide sequence of the downstream primer AMHY-R is shown as SEQ ID NO: shown at 7.

The invention provides a method for identifying the sex of siniperca chuatsi, which comprises the following steps:

(1) Designing and synthesizing the male molecular marker primer;

(2) Extracting DNA of the siniperca chuatsi;

(3) And (3) performing PCR amplification by using the DNA in the step (2) as a template and adopting the primer, after the reaction is finished, performing electrophoresis detection, wherein if the result shows two DNA specific bands, the detected mandarin fish is male, and if the electrophoresis result shows only one specific band, the detected mandarin fish is female.

Preferably, the DNA in step (2) is extracted by column centrifugation.

Preferably, in the PCR amplification in step (3), 50ng of DNA is contained in a 20. Mu.L PCR reaction system, 0.8. Mu.L of each of the upstream and downstream primers, 10. Mu.L of 2 XTaq MasterMix, and ddH is used for the remainder ₂ And (4) supplementing by using oxygen.

Preferably, the PCR reaction procedure is: firstly, pre-denaturation is carried out for 2min at 94 ℃; then carrying out denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s and extension at 72 ℃ for 30s for 35 cycles; final extension at 72 ℃ for 5min.

Preferably, when the electrophoresis detection is performed in the step (3), the length of the amplified fragment is detected by agarose gel electrophoresis with the mass percentage of 1%.

Preferably, the electrophoresis result in the step (3) shows that the female fish singly amplifies the male fish double-band amplification, the molecular size of the specific band amplified in the male fish is 803bp and 427bp, and the size of the band amplified in the female fish is 803bp.

The third object of the present invention can be achieved by the following technical solutions: the AMHY gene, the encoding protein of the AMHY gene and the application of the male molecular marker primer in the aspect of full female breeding of siniperca chuatsi.

Compared with the prior art, the invention has the following advantages:

(1) The method is based on genome high-throughput sequencing data of male and female Siniperca chuatsi, and utilizes analysis methods such as genome assembly and comparison to quickly and accurately screen out the Siniperca chuatsi male specific AMH genome sequence, and clones for the first time to obtain the full-length coding region sequence of the Siniperca chuatsi, wherein the gene is a specific gene of male fish and participates in a male sex determination process.

(2) The method establishes a method for identifying the sex of the siniperca chuatsi by using the male specific AMH gene of the siniperca chuatsi, completes a PCR reaction by using a pair of specific primers, and can identify the sex of the siniperca chuatsi.

(3) The male molecular marker primer developed by the invention can realize the rapid and accurate sex identification of siniperca chuatsi, and the developed sex identification method is short and has high efficiency.

Drawings

FIG. 1 is a schematic diagram showing the acquisition of candidate fragments of the Y chromosome in example 1;

FIG. 2 is a diagram of the exon (exon) and intron (intron) profiles of the AMHY and AMH genomic sequences in example 1;

FIG. 3 shows the alignment of the coding regions of the AMHY and AMH proteins of example 1;

FIG. 4 is an electrophoretogram of PCR products in which only two amplified fragments were detected in the male sample and only one amplified fragment was detected in the female sample in example 2;

FIG. 5 is an electrophoresis diagram of the PCR products for detecting male and female individuals (80 tails) with the primer AMHYF/R in example 2.

Detailed Description

The method of the present invention is further illustrated by the following examples. The following examples and drawings are illustrative only and are not to be construed as limiting the invention. The reagents or materials used in the examples, if not specifically described, were commercially available, and the equipment used in the examples below was conventional in the art, if not specifically described.

Example 1

Firstly, carrying out genome sequencing on the male and female siniperca chuatsi, and then carrying out raw trust analysis on the male and female genome sequence to enrich the male specific molecular sequence of the siniperca chuatsi (figure 1). And then performing annotation analysis on the obtained male specific sequence to obtain the genome sequence of the AMHY as shown in SEQ ID NO:1 is shown.

And comparing and analyzing the genome sequences with autosomal AMH and other nearby fish AMH to determine 5'UTR and 3' UTR sequences of the AMHY gene. Designing an upstream and downstream primer AMHY-orf-F/R according to the sequence of UTR, and obtaining a sequence shown in SEQ ID NO:2 and SEQ ID NO:3.

extracting mandarin fish testis total RNA, reverse transcribing with Oligo dT primer to synthesize testis cDNA template, and synthesizing the cDNA template with SEQ ID NO:2 and SEQ ID NO:3 is an upstream primer and a downstream primer, and the full-length coding sequence of the siniperca chuatsi AMHY gene is obtained by PCR amplification and is shown as SEQ ID NO:4, and the corresponding amino acid sequence is shown as SEQ ID NO:5, encoding 352 amino acids with a molecular weight of 38.6 kilodaltons.

According to the existing transcriptome data, the autosomal AMH gene sequence is also identified and cloned, and the comparison with the genome and coding region sequences of AMHY shows that the AMHY gene has 4 exons, while the AMH gene has 7 exons (figure 2), compared with AMH, the AMHY coding region has large deletion at the starting end, more base differences exist in the homologous region (figure 3), the total similarity of the coding region DNA sequence is 50.9%, and the total similarity of the amino acid sequence is 56.4%. Further aligning to find the deletion part of the coding region of AMHY gene, namely the No. 2 to No. 4 exon regions of AMH gene.

The siniperca chuatsi male specific AMHY genome sequence and the coding sequence are obtained by the following method, and the method comprises the following steps:

one) sequencing library construction and re-sequencing

1. Preparing a mandarin fish DNA sample:

in the mandarin fish breeding season, cutting female 3-tail and male 3-tail individual tail fins of mandarin fish, numbering female fish F1-F3 and male fish M1-M3 in sequence, preparing DNA sample by conventional column centrifugation method (universal column genome extraction kit, beijing Kan, century Biotechnology Co., ltd.) according to the instruction operation steps, and detecting quality and concentration by 1% agarose gel electrophoresis and micro spectrophotometer (NanoDrop 2000) to achieve the requirement of high throughput sequencing.

2. Sequencing library construction and high throughput sequencing:

DNA samples of female fish F1-F3 and male fish M1-M3 are taken to respectively construct a 350-500bp fragment sequencing library, and an Illumina Hiseq X Ten platform is utilized to carry out double-End (Pair-End) PE150 sequencing to respectively obtain female genome sequencing clean data and male genome sequencing clean data, wherein the female genome sequencing clean data is 94,431,090,900bp and the male genome sequencing clean data is 94,469,916,300bp. The Library construction procedure was specifically described in the Novogene NGS DNA Library Prep Kit, and sequencing was performed by Beijing Nuo Po-derived science and technology, inc.

II) enrichment of Y chromosome-specific DNA fragments

1. Assembling male fish genome:

the genome assembly of the male fish M1 sequencing reads is carried out by using an all method in SOAPdenovo v2.04-r240 (https:// github. Com/aquaskyline/SOAPdenovo 2), and 1037309 scaffolds with the total size of 819033064bp and N50=28567bp are obtained.

2. Obtaining male fish candidate DNA fragments:

the data of 3 female sequencing samples are respectively compared with reference genomes obtained by male assembly, the comparison software is bwa (version 0.7.17-r 1188), a mem comparison algorithm and default parameters are adopted, female sequencing reads of male sequencing are compared without double-end screening, and coverage information of each male genome sequence is calculated by samtools (version 1.9). The sequence that was simultaneously covered by 2 male samples (3 male samples in common) and not covered by any one female sample was selected as male-specific sequence. According to the depth information calculated by samtools (version 1.9), the sequencing depth of the male genome and the sequencing depth of the male specific sequence are counted, the sequencing depth of the female genome and the sequencing depth of the female specific sequence are counted, the sequencing depth of the sex specific sequence is estimated to be 0.5+/-0.2 (the range of 0.3-0.7) times of the whole genome depth, and the sex specific sequence which meets the depth requirement, namely the Y chromosome specific sequence is further screened (figure 1).

3. Male specific DNA fragment annotation:

and comparing the screened specific sequences to an nr database by adopting blastx (2.8.1 +) comparison software, setting the comparison parameters to be less than 0.00001 at expected values, and annotating the specific sequences by using other parameters as default parameters.

Three) Y chromosome specific AMH gene cloning

Based on the AMHY genome sequence obtained by the annotation, the autosomal AMH gene sequence is selected for comparison analysis to preliminarily identify 5 'and 3' UTR sequences of the AMHY gene, primer5 software is adopted to design PCR primers, the primers are numbered according to AMHY-orf-F/R (F represents an upstream Primer, R represents a downstream Primer, the same applies below), and the specific sequence is shown in SEQ ID NO:2 and SEQ ID NO:3. the primers were synthesized by Enwei fundi (Shanghai) trade Co., ltd.

1. Extraction of siniperca chuatsi male gonad total RNA

Taking healthy mandarin fish with tilting mouth, carrying out ice bath anesthesia for 5min, killing the fish, taking the gonad, and extracting by adopting a Trizol reagent method to obtain the total RNA of the gonad of the mandarin fish with tilting mouth.

Synthesis of cDNA Strand

Taking 1 mu g of Siniperca Chuatsi male gonad total RNA sample, carrying out DNase treatment to remove genome DNA, mixing with Oligo dT and related reverse transcription reagent, carrying out reverse transcription, and storing the obtained product at-20 ℃ for later use.

3. Cloning and analysis of cDNA sequence of Amhy gene of siniperca chuatsi

And (2) performing PCR amplification by using the AMHY-orf-F/R designed above and the first strand cDNA synthesized in the step 2 as a template, wherein the size of an amplified fragment is 1185bp, performing electrophoretic separation on the DNA fragment, cutting gel to recover a target product, connecting the purified target product to a pGEM-T vector, transforming DH5 alpha escherichia coli, selecting positive clone sequencing, and BLAST homology analysis shows that the target product is the cDNA sequence fragment of the AMHY gene. And further comparing and analyzing the protein coding sequence of the AMHY gene and the autosomal AMH gene.

The nucleotide sequence of the obtained siniperca chuatsi AMHY gene is shown as SEQ ID NO:4, respectively.

The method comprises the following specific steps:

atgtttgttttggatgtgttctactgtggagcatttatactctgctggacgaggctctgtgtggccgtggatgtcctacatggacagcaactgaccctgggcaacagcactacaatgacagagcaaagcctaaaagacatccttactggtggaaaaccaggaagtaacatcggcatgaccccacttctgcttttctcaggggaaaaagcaactgatacaagatatgcacatatttctggttcatccccgatgtcttcactgacctcctcctttctctgtgaactgaagcagttcctgggtgatgtcttgcctcagaaccaccctcagtcccttcggctcaagctggactccttacagtccctgcctcccctaccactaggcttatcctccagtgaaaccttgctggcaggactgatcaactcctcggccaccaccatcttctctttccctagctggggctccatgtttcacgtgcatcatggagagttggccctgtctcctgcactaattgaggagctcaggcagagactggagcagacagtgacgcagataatggaggtaataaggaagaaggtggtgggtcacagagccacagagagactgggaaggctcaaagaactcattgcatttccgaagaaggatccagcagcaggagaaagccagtaccgtgcatttcttctgctgagagcgctgcagacggtggcccgtgtgtatgaggtgcagagaggacagcgggttataagagctgcccccaacaacccagtaaggggcaacgtatgcaggttgagcagcctcaccgtgtcccttgaaaggcaccttgtgggtccaaacactgccaacatcaacaactgccatggttcttgtgctttccccatggtcaataccaacaaccatgcagtcctgctcaagtcctacattgacaatgaaaatgtggatgagcgggcgccatgctgtgtgcctgtgtcctatgatgttctggaggtggtggacttgaaccaacatgggacttacctctccattataccagatgtggtggcaaaggagtgtggatgccgctaa

the corresponding amino acid sequence is (SEQ ID NO: 5):

MFVLDVFYCGAFILCWTRLCVAVDVLHGQQLTLGNSTTMTEQSLKDILTGGKPGSNIGMTPLLLFSGEKATDTRYAHISGSSPMSSLTSSFLCELKQFLGDVLPQNHPQSLRLKLDSLQSLPPLPLGLSSSETLLAGLINSSATTIFSFPSWGSMFHVHHGELALSPALIEELRQRLEQTVTQIMEVIRKKVVGHRATERLGRLKELIAFPKKDPAAGESQYRAFLLLRALQTVARVYEVQRGQRVIRAAPNNPVRGNVCRLSSLTVSLERHLVGPNTANINNCHGSCAFPMVNTNNHAVLLKSYIDNENVDERAPCCVPVSYDVLEVVDLNQHGTYLSIIPDVVAKECGCR。

example 2

The embodiment provides a mandarin fish AMHY gene-based method for identifying the sex of mandarin fish, which comprises the following steps:

(1) A primer AMHY-F/R is designed according to the AMHY and AMH genome sequence homology difference segment, and is specifically shown in SEQ ID NO:6 and SEQ ID NO: the length of the amplification product corresponding to AMHY is 427bp, while the length of the product corresponding to AMH gene is 803bp.

(2) Preparing a siniperca chuatsi DNA sample:

siniperca chuatsi with visual inspection is obtained from Siniperca chuatsi water production germchit GmbH of san shui Bai mountain city, guangdong province, and 48 mandarin fishes are obtained from female and male mandarin fishes respectively through dissection. The tail fins were cut out, and DNA samples were prepared by the same conventional column centrifugation method (universal column type genome extraction kit, beijing kang, century biotechnology limited) with reference to the instruction manual.

(3) And (3) PCR amplification verification:

and performing PCR preliminary verification on the DNA samples of the male and female mandarin fishes respectively by adopting a primer AMHY-F/R.

The total system of PCR amplification reaction is 20 μ L, including 10 μ L of Kangji 2 × Taq MasterMix (Beijing is century Biotechnology Co., ltd.), 0.8 μ L each of upstream and downstream primers (10 μmol/L), 50ng of template DNA, and ddH for the rest ₂ And (4) supplementing and finishing.

The PCR reaction program is: firstly, pre-denaturation is carried out for 2min at 94 ℃; then carrying out denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s and extension at 72 ℃ for 30s for 35 cycles; final extension at 72 ℃ for 5min.

After the PCR reaction, the product was subjected to agarose gel electrophoresis with a mass percentage of 1%.

As a result: the primer AMHY-F/R is used for amplifying double bands (803 bp and 427 bp) in the DNA sample of the 8 male fish and amplifying a single band (803 bp) in the DNA sample of the 8 female fish (figure 4).

Thereafter, DNA samples were further amplified in 40-tailed female and 40-tailed male, and the results showed that both were double-banded in both female and male (FIG. 5). The molecular marker AMHY-F/R can be used for identifying the sex of the mandarin fish.

Example 3

The embodiment provides an application of the siniperca chuatsi AMHY gene in full female breeding of siniperca chuatsi, which comprises the following steps:

(1) Constructing pcDNA4.0-AMHY recombinant protein expression plasmid, and embedding the plasmid with new liposome.

(2) And (3) after the mandarin fish fries are cultured to 10 days old, mixing the embedded plasmids in the step (1) with eel feed, feeding bait fishes, and immediately feeding the bait fishes fed with the plasmid-mixed feed to the mandarin fish twice a day after the bait fishes are fully fed. Continuously feeding for more than two months, adopting natural illumination during the culture period, controlling the temperature of the culture water to be 26-28 ℃, and feeding after nearly full feeding.

(3) After the feeding is finished, screening the mandarin fish fed with androgen by adopting the method in the embodiment 2 to obtain the male fish with the hereditary form of XX, namely pseudo male fish, and referring to the embodiment 2 in the specific process.

(4) And (4) continuously culturing the XX pseudo-male fish identified by the mark until the XX pseudo-male fish is sexually mature, and mating the XX pseudo-male fish with the XX normal female fish in a breeding season to obtain offspring which are all female fish.

The above embodiments are only used for illustrating the present invention, and the scope of the present invention is not limited to the above embodiments. The object of the present invention can be achieved by those skilled in the art based on the above disclosure, and any modifications and variations based on the concept of the present invention are included in the scope of the present invention, and the specific scope of the protection is subject to the claims.

Sequence listing

<110> Zhongshan university

Guangdong Liang aquatic species Co Ltd

<120> Siniperca chuatsi male specific anti-mullerian hormone AMHY gene and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4223

<212> DNA

<213> Siniperca chuatsi (Siniperca chuatsi)

<400> 1

caggttgttg gaacgccatt tcctttcaag tttttgcaat gtttgcttta atttgcgggt 60

ttgtttttat tgtcttcttt tttagagggg caatagaatc gattgttcat aataatatgt 120

atgtgtgtgt gtgtgtgtgt gtcctcagta tggggcatgt tgatatatat tgggctgcag 180

gatctgcctt gattccttct cctctgaata tttgtattgt tgagagctga tttagctctt 240

tgaaatctga gattacagag ttgaacttaa agtaaatgtt cttcatttca ttgaatgttt 300

tactgctccc tctctctcta tctggattga aaggctggat tgacgtaact ggtgtctgcg 360

agggagccat aagtcattca ctaactcact cctcggccat ccccctgact gcgaaaggaa 420

tcatatgtct ctgttcctat atatacaccg ctcattcaca taagcttaac ccattcaaaa 480

caggcgatgg tggaagctct gaccaaagcc acgcaaggaa aaagtgaaat atgtttgttt 540

tggatgtgtt ctactgtgga gcatttatac tctgctggac gaggctctgt gtggccgtgg 600

atgtcctaca tggacagcaa ctgaccctgg gcaacagcac tacaatgaca ggtcagagtc 660

tgctccataa ccaactctaa acccactaaa ccaattattt ttgcaatgcc tttacatttt 720

atgttatagt gctggtttat agcttgtcaa ttaatgtgct ttgaggacag attggattgt 780

ttgcctgtgg ttcctgcttc tgttctgtgt gtgatgtaat ttgttctttt tctaattcaa 840

tcaaaggaga ccaccacaca atgagctcca cagaggccgg acatggtctg gatattaaaa 900

atgcagagca caccttccat tcaacaaaga cctcattagc ctccacagtt tctctccatg 960

tctctcaaca tgcaccaggc tttgtggttg acatattcac agtgttacgt gaacatgtgg 1020

ggagcgatgg tttactcaca aactacagtt tttctctgtt tgaaatctgc acaagaaagg 1080

cctggtgtga ataatgcatg attgaaacac tgtcctgaag ttccgtaatc tgttgcaaat 1140

tattttgtca cagatatttc tgctgttgtc ttttatagtc tgtgtgcatt tcaggagaaa 1200

cacagtacat tatgctgaca ggaaaagcat cagagagcaa tgttcaccag aaatggagga 1260

tttctgttga gataaaatcc ccacctctgt aacattttct ctctttgcag agcaaagcct 1320

aaaagacatc cttactggtg gaaaaccagg aagtaacatc ggcatgaccc cacttctgct 1380

tttctcaggg gaaaaagcaa ctgatacaag gttgtatttc atgttcccta ttgaaatttt 1440

acccgactat tatcagagtg gtgctcagta aaatttgtta ctctctttct cagatatgca 1500

catatttctg gttcatcccc gatgtcttca ctgacctcct cctttctctg tgaactgaag 1560

cagttcctgg gtgatgtctt gcctcagaac caccctcagt cccttcggct caagctggac 1620

tccttacagt ccctgcctcc cctaccacta ggcttatcct ccagtgaaac cttgctggca 1680

ggactgatca actcctcggc caccaccatc ttctctttcc ctagctgggg ctccatgttt 1740

cacgtgcatc atggagagtt ggccctgtct cctgcactaa ttgaggagct caggcagaga 1800

ctggagcaga cagtgacgca gataatggag gtaataagga agaaggtggt gggtcacaga 1860

gccacagaga gactgggaag gctcaaagaa ctcattgcat ttccgaagaa ggatccagca 1920

gcaggtgatg tacaagacaa cagtctccca aaccaactgt tgttcccaac cttttttgtc 1980

agatgcactc ccacagccct gtcacatgca atcaagtacc ccccttaatt gacacacccc 2040

gtcattttcc gaaagctgat tttaaaatta ttttttaact aaaaatggat ataatggttt 2100

ttccctggaa gtcccacagt gtgaacatct cattatgaac cagccttgga ttgcctgaat 2160

tatagtaaat atagtattgc atctgactct gcctgtcatt gtgttttatt tcactattga 2220

ggttttttct tcaaattttt gatttacttg ataactattg aaaaactaag tgttgttgaa 2280

gacatttgtt ggcccatctg aagtgttttt ctgcaacaaa atggccttca ttaatgtcat 2340

catgaaacac attacaaact aaatttaaat agtgtagatg tatatggttg tctttaattt 2400

tttggtatct ttgttcaatg gttaaagaca ttgattttaa ctaacagacc tttaagatac 2460

agatattgaa cactctcttt atgcagcata caattatttt tatcccacta caggctgacc 2520

atcctctgct gagacattac aggcatttca gctatgctgg tcccttctct ggccttggca 2580

ctgtgccttc attcatatgt tgcctcagct aacaggctaa gaatataacc tacatagatt 2640

tcagccagca gtccaaaaaa aatacaccac agcaatgatc taacaataaa gttgttatat 2700

agaagtactc actgcttggg aatcacagtt gtaaagcact atagacttgt atttgaatta 2760

tcatttaaca cacctaacat aaatataatt ttttttggta taaagatcct gtatttccac 2820

tttttaactg attctactgt ttcttcttct gcacttaaca ggagaaagcc agtaccgtgc 2880

atttcttctg ctgagagcgc tgcagacggt ggcccgtgtg tatgaggtgc agagaggaca 2940

gcgggttata agagctgccc ccaacaaccc agtaaggggc aacgtatgca ggttgagcag 3000

cctcaccgtg tcccttgaaa ggcaccttgt gggtccaaac actgccaaca tcaacaactg 3060

ccatggttct tgtgctttcc ccatggtcaa taccaacaac catgcagtcc tgctcaagtc 3120

ctacattgac aatgaaaatg tggatgagcg ggcgccatgc tgtgtgcctg tgtcctatga 3180

tgttctggag gtggtggact tgaaccaaca tgggacttac ctctccatta taccagatgt 3240

ggtggcaaag gagtgtggat gccgctaaag cactgctgct gctaataagt atttatttat 3300

aagttactat attatgtcac aaccatactc gcctcgccga aaataagtac atgcagattg 3360

tgtttaaata ttagtaaaaa caaaactgga ctaaaattta agccaaaatt tagactaaag 3420

gtctcaaaag gtcaccaggt ttgaggccct gattttggag tattttcaaa tgttcatatt 3480

ttctcataga caggtcccag agaccccgtg tttttttccc acacatggtg gcaggggcct 3540

agaataatcc cacatgacca aatccagtct gtggcatcta gaacagggcc agatctgtat 3600

atctctggaa cacctcattc gtggtacata agcaaaaaaa cctaattctg aaattggaaa 3660

atgggcatat ctccggaacc gaaggtcgta gagactcggg accaagacca gcgtgttcag 3720

catccacaaa aaccacaata tggactttgg ttctaattcg atctgacctg tcgttcctaa 3780

catatagagt aaaaactgct gattgggttg ttatttaggt gtgatagact atataggaag 3840

aaggtttcat ctcagtgctt tcattcattt ttgtggacct ttgaagccaa atattaagtt 3900

ttttcaattt atttatatag caccatggca cttttcctat agagcaggtc tatatcatac 3960

tctttatagt gttaacacat aagtgttagc acagttatta attattagca ccaaccatca 4020

tagggctgaa gccagtggtc agcgcaactt gtcaatggag tactggaaac gcatgcttct 4080

tcttttccct tctttcagag aagaactgaa aaacctaagt ttgttttgac acattttcta 4140

tactttaatt tgacattctt ccaggttact gttgaaggcg ttttctaatc ccagtgtttg 4200

acattgtaac atgttttatc aag 4223

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggtggaagc tctgaccaaa 20

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgtacttatt ttcggcgagg c 21

<210> 4

<211> 1059

<212> DNA

<213> Siniperca chuatsi (Siniperca chuatsi)

<400> 4

atgtttgttt tggatgtgtt ctactgtgga gcatttatac tctgctggac gaggctctgt 60

gtggccgtgg atgtcctaca tggacagcaa ctgaccctgg gcaacagcac tacaatgaca 120

gagcaaagcc taaaagacat ccttactggt ggaaaaccag gaagtaacat cggcatgacc 180

ccacttctgc ttttctcagg ggaaaaagca actgatacaa gatatgcaca tatttctggt 240

tcatccccga tgtcttcact gacctcctcc tttctctgtg aactgaagca gttcctgggt 300

gatgtcttgc ctcagaacca ccctcagtcc cttcggctca agctggactc cttacagtcc 360

ctgcctcccc taccactagg cttatcctcc agtgaaacct tgctggcagg actgatcaac 420

tcctcggcca ccaccatctt ctctttccct agctggggct ccatgtttca cgtgcatcat 480

ggagagttgg ccctgtctcc tgcactaatt gaggagctca ggcagagact ggagcagaca 540

gtgacgcaga taatggaggt aataaggaag aaggtggtgg gtcacagagc cacagagaga 600

ctgggaaggc tcaaagaact cattgcattt ccgaagaagg atccagcagc aggagaaagc 660

cagtaccgtg catttcttct gctgagagcg ctgcagacgg tggcccgtgt gtatgaggtg 720

cagagaggac agcgggttat aagagctgcc cccaacaacc cagtaagggg caacgtatgc 780

aggttgagca gcctcaccgt gtcccttgaa aggcaccttg tgggtccaaa cactgccaac 840

atcaacaact gccatggttc ttgtgctttc cccatggtca ataccaacaa ccatgcagtc 900

ctgctcaagt cctacattga caatgaaaat gtggatgagc gggcgccatg ctgtgtgcct 960

gtgtcctatg atgttctgga ggtggtggac ttgaaccaac atgggactta cctctccatt 1020

ataccagatg tggtggcaaa ggagtgtgga tgccgctaa 1059

<210> 5

<211> 352

<212> PRT

<213> Siniperca chuatsi (Siniperca chuatsi)

<400> 5

Met Phe Val Leu Asp Val Phe Tyr Cys Gly Ala Phe Ile Leu Cys Trp

1 5 10 15

Thr Arg Leu Cys Val Ala Val Asp Val Leu His Gly Gln Gln Leu Thr

20 25 30

Leu Gly Asn Ser Thr Thr Met Thr Glu Gln Ser Leu Lys Asp Ile Leu

35 40 45

Thr Gly Gly Lys Pro Gly Ser Asn Ile Gly Met Thr Pro Leu Leu Leu

50 55 60

Phe Ser Gly Glu Lys Ala Thr Asp Thr Arg Tyr Ala His Ile Ser Gly

65 70 75 80

Ser Ser Pro Met Ser Ser Leu Thr Ser Ser Phe Leu Cys Glu Leu Lys

85 90 95

Gln Phe Leu Gly Asp Val Leu Pro Gln Asn His Pro Gln Ser Leu Arg

100 105 110

Leu Lys Leu Asp Ser Leu Gln Ser Leu Pro Pro Leu Pro Leu Gly Leu

115 120 125

Ser Ser Ser Glu Thr Leu Leu Ala Gly Leu Ile Asn Ser Ser Ala Thr

130 135 140

Thr Ile Phe Ser Phe Pro Ser Trp Gly Ser Met Phe His Val His His

145 150 155 160

Gly Glu Leu Ala Leu Ser Pro Ala Leu Ile Glu Glu Leu Arg Gln Arg

165 170 175

Leu Glu Gln Thr Val Thr Gln Ile Met Glu Val Ile Arg Lys Lys Val

180 185 190

Val Gly His Arg Ala Thr Glu Arg Leu Gly Arg Leu Lys Glu Leu Ile

195 200 205

Ala Phe Pro Lys Lys Asp Pro Ala Ala Gly Glu Ser Gln Tyr Arg Ala

210 215 220

Phe Leu Leu Leu Arg Ala Leu Gln Thr Val Ala Arg Val Tyr Glu Val

225 230 235 240

Gln Arg Gly Gln Arg Val Ile Arg Ala Ala Pro Asn Asn Pro Val Arg

245 250 255

Gly Asn Val Cys Arg Leu Ser Ser Leu Thr Val Ser Leu Glu Arg His

260 265 270

Leu Val Gly Pro Asn Thr Ala Asn Ile Asn Asn Cys His Gly Ser Cys

275 280 285

Ala Phe Pro Met Val Asn Thr Asn Asn His Ala Val Leu Leu Lys Ser

290 295 300

Tyr Ile Asp Asn Glu Asn Val Asp Glu Arg Ala Pro Cys Cys Val Pro

305 310 315 320

Val Ser Tyr Asp Val Leu Glu Val Val Asp Leu Asn Gln His Gly Thr

325 330 335

Tyr Leu Ser Ile Ile Pro Asp Val Val Ala Lys Glu Cys Gly Cys Arg

340 345 350

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caatcaaagg agaccaaccc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaaatcctcc atttcacgtc 20

Claims (4)

1. A male molecular marker primer based on an Amhy gene of siniperca chuatsi is characterized in that: the primer comprises an upstream primer AMHY-F and a downstream primer AMHY-R, wherein the nucleotide sequence of the upstream primer AMHY-F is shown as SEQ ID NO:6, the nucleotide sequence of the downstream primer AMHY-R is shown as SEQ ID NO: shown at 7.

2. A method for identifying the sex of siniperca chuatsi is characterized by comprising the following steps:

(1) Designing and synthesizing a male molecular marker primer of claim 1;

(2) Extracting DNA of the siniperca chuatsi;

(3) Carrying out PCR amplification by using the DNA in the step (2) as a template and the primer in the claim 1, carrying out electrophoresis detection after the reaction is finished, wherein if the result shows two DNA specific bands, the detected mandarin fish is male, and if the electrophoresis result shows only one specific band, the detected mandarin fish is female.

3. The method for sex identification of siniperca chuatsi as claimed in claim 2, wherein: extracting DNA in the step (2) by adopting a column type centrifugation method; during PCR amplification in step (3), 20. Mu.L of PCR reaction system contains 50ng of DNA, 0.8. Mu.L of each of upstream and downstream primers, 10. Mu.L of 2 XTaq Mastermix, and ddH is used for the rest ₂ Supplementing by using oxygen; the PCR reaction procedure was: firstly, performing pre-denaturation at 94 ℃ for 2min; then carrying out denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s and extension at 72 ℃ for 30s for 35 cycles; final extension at 72 deg.C for 5min; and (4) when the electrophoresis detection is carried out in the step (3), detecting the length of the amplified fragment by adopting agarose gel electrophoresis with the mass percentage of 1%.

4. The method for sex identification of siniperca chuatsi as claimed in claim 2, wherein the sex identification method comprises the following steps: and (3) the electrophoresis result shows that the female fish singly amplifies the male fish double-band amplification, the molecular size of the specific band amplified in the male fish is 803 and 427bp, and the size of the band amplified in the female fish is 803bp.

Images