CN111574598B

CN111574598B - Method for improving AMEP412 protein yield and application of method in plant immunity stimulation

Info

Publication number: CN111574598B
Application number: CN202010503925.3A
Authority: CN
Inventors: 刘权; 殷奎德
Original assignee: Heilongjiang Quansheng Biotechnology Co ltd; Heilongjiang Bayi Agricultural University
Current assignee: Heilongjiang Quansheng Biotechnology Co ltd; Heilongjiang Bayi Agricultural University
Priority date: 2020-06-05
Filing date: 2020-06-05
Publication date: 2023-02-03
Anticipated expiration: 2040-06-05
Also published as: CN111574598A

Abstract

The invention relates to a method for improving the yield of AMEP412 protein and application thereof in stimulating plant immunity. The invention discloses a method for improving the expression level and purification efficiency of AMEP412 in a strain, which can improve the expression yield of AMEP412, and can be applied to the stimulation of plant immunity to improve the functional activity of the plant immunity to induce anaphylactic reaction, so that the utilization efficiency of AMEP412 in practical application is improved, and the development and utilization of the protein are guaranteed.

Description

Method for improving AMEP412 protein yield and application of method in plant immunity stimulation

Technical Field

The invention belongs to the field of protein expression, purification and application, and relates to a method for improving the yield of AMEP412 protein and application thereof in stimulating plant immunity.

Background

The AMEP412 protein is a protein that is widely found in Bacillus strains. The total length of the protein is 76 amino acids, the relative molecular mass of the protein is 8.36kDa, but according to the result of molecular sieve size exclusion chromatography, AMEP412 actually shows the molecular weight to be 40-50kDa, and a polymer is formed. In AMEP412, 50% of amino acids are hydrophobic amino acids, but since they form polymers, they can block hydrophobic side faces and can be dissolved in an aqueous solution and exist in a culture supernatant. AMEP412 has 2 negatively charged residues and 12 positively charged residues, theoretically a positive net charge, is a basic protein, isoelectric point is 10.05, but due to the formation of polymer, AMEP412 in neutral aqueous solution appears as a negative net charge, is an acidic protein, can be separated and purified by anion exchange resin.

The research shows that AMEP412 has the function of protein elicitor, can activate the immune system of plants, trigger a series of defense reactions, such as induction of plant anaphylactic reaction (HR), induction of active oxygen burst, improvement of the expression of defense enzymes, and reduction of damage caused by infection of pathogenic bacteria. The AMEP412 can induce a plant autoimmune defense system to act, comprehensively improve the plant metabolism level, enhance the capability of defending diseases and natural stress, and further improve the yield and quality of crops. The AMEP412 does not cause drug resistance of pathogens and has no harmful effect on the environment, and has the potential of being developed into green biological agents.

For the application development of AMEP412, the key is to obtain a large amount of high-purity protein samples with high efficiency. This includes both increasing the expression level of the protein and increasing the recovery yield of the protein.

It has been found that the conventional recombinant expression method is not suitable for the AMEP412 protein. When the AMEP412 is expressed in a recombinant expression system of the Escherichia coli, the AMEP412 has toxic effect on Escherichia coli cells, and an expression product cannot be obtained. Other recombinant expression systems, such as bacillus recombinant expression system, yeast recombinant expression system, insect baculovirus recombinant expression system, mammalian cell recombinant expression system, etc., are not suitable for the expression of AMEP412 due to low expression level. Therefore, the research on how to efficiently express the AMEP412 protein through the wild type bacillus is a key solution for developing and utilizing the protein.

AMEP412 is expressed in Bacillus and can be secreted into the culture supernatant. How to recover AMEP412 protein from culture supernatant with high efficiency is also the key for development and utilization. The interference of numerous hetero-proteins, polypeptides and small molecular substances in the culture supernatant increases the difficulty of purification, and the high-yield recovery of AMEP412 is a difficult and important problem considering that the purification method should be simplified as much as possible to reduce the application cost.

In addition, there are many imperfect factors in the application of AMEP412 as a plant immune activator. Protein formulations are generally sprayed onto plant leaves in liquid form, and the nature and composition of the buffer may have an effect on the functional activity of the protein formulation. This requires an intensive analysis of the protein properties of AMEP412, specifying the factors that influence its functional activity during the administration phase, and making targeted improvements to increase the efficiency of protein utilization.

Disclosure of Invention

The invention aims to provide a method for increasing the yield of AMEP412 protein, and the method is applied to the stimulation of plant immunity, so as to lay a foundation for the development and utilization of the protein.

The invention is realized by the following technical scheme:

1. a method for improving the yield of AMEP412 protein, which comprises the aspects of improving the protein expression level and recovering the yield.

Further, fermentation using the efficient expression strain brevibacillus belgii BU396 of the AMEP412 protein increased the protein expression level.

Further, glucose is used as a carbon source of the culture medium for fermentation, and the dosage of the glucose is 14g/L; fermenting by using yeast powder as a nitrogen source of a culture medium, wherein the dosage of the yeast powder is 15.2g/L; fermentation mediumThe pH value of the culture medium is maintained at 6.89, the fermentation time is 23.84 hours, the contents of sodium chloride, calcium chloride and zinc sulfate in the culture medium are respectively less than 0.5g/L, and the Ca content in the culture medium is less than ₃ (PO ₄ ) ₂ The content of (B) is 2g/L.

Further, the concentration of AMEP412 protein in the supernatant of the fermentation liquor is more than or equal to 3mg/mL.

Further, the improvement of the recovery yield of the AMEP412 protein comprises 2 steps of purification by ion exchange resin and ultrafiltration membrane interception, and the high-purity AMEP412 protein is obtained.

According to the above method, the method comprises the steps of: firstly, carrying out first-step purification by using DEAE anion exchange resin, removing impurity proteins by using a buffer solution of 50mM NaCl, 50mM Tris-HCl and pH 8.0 after a culture solution supernatant passes through the anion exchange resin, eluting by using a buffer solution of 275mM NaCl, 50mM Tris-HCl and pH 8.0, and collecting a protein sample; and secondly, performing ultrafiltration by using an ultrafiltration membrane with the molecular weight cutoff of 30kDa, and collecting a protein sample which does not pass through the ultrafiltration membrane, namely AMEP412 protein.

Further, the recovery of the purified AMEP412 protein is greater than or equal to 2.5mg/mL, and the recovery yield is greater than or equal to 83%.

2. Use of a method according to the above for stimulating immunity in a plant.

Further, the plant immunity is induced by applying AMEP412 protein to tobacco leaf and causing anaphylactic reaction.

Further, the AMEP412 protein is applied with a buffer solution with the pH value of 8-9, the ferrous sulfate concentration of 0.1-1mM and the urea concentration of 0.1-0.2mg/mL, and organic silicon is added to dilute according to the proportion of 1/10000-1/5000.

Firstly, a strain capable of efficiently expressing AMEP412 protein is searched, the existence of AMEP412 gene in various bacillus is detected by PCR, four strains BU108, B.subtilis 168, BU396 and BU412 are screened out, the protein expression levels of the strains are compared, and the BU396 is determined to be an efficient expression strain. And (3) taking the YME culture medium as a basic culture medium, determining the types of the most suitable carbon source and the most suitable nitrogen source through a single factor test, determining the dosage, pH and culture time of the nitrogen source through a response surface test, and improving the expression level of the AMEP412 protein. In addition, the effect of inorganic salts in the medium on the production of AMEP412 protein was also examined.

And then recovering and purifying the AMEP412 from the culture supernatant, firstly purifying by using DEAE anion exchange resin, eluting by using a buffer solution containing 275mM NaCl, then purifying by using an ultrafiltration membrane with a 30kDa retention volume, and collecting a protein sample with the volume of more than 30kDa, namely the target protein. The AMEP412 protein can be efficiently recovered from the culture supernatant by the two-step method.

Finally, the application conditions of the AMEP412 protein for stimulating the plant immunity are researched, the pH of the application buffer is determined by taking the anaphylactic reaction activity as a reference index, and the content of the added components (including ferrous sulfate, urea and organic silicon) in the buffer is determined. These application conditions effectively increase the functional activity of the AMEP412 and increase the efficiency of utilization.

Adopt above-mentioned technical scheme's positive effect: the invention relates to a method for improving the expression yield and utilization efficiency of AMEP412 protein, which can efficiently and quickly obtain a large number of AMEP412 protein samples, improve the application activity of the protein in stimulating plant immunity and provide technical support for development and utilization of the protein.

Drawings

FIG. 1 shows PCR amplification for detecting the presence of AMEP412 encoding gene in each strain, and 1-15 show the amplification results of different strains, wherein 1, 7, 10 and 13 are positive and represent strains BU108, B.subtilis 168, BU396 and BU412 respectively;

figure 2 is a graph of the effect of different carbon sources on the expression level of AMEP412 protein;

FIG. 3 is a graph showing the effect of varying amounts of mannitol on the expression level of AMEP412 protein;

FIG. 4 is a graph of the effect of different nitrogen sources on the expression level of AMEP412 protein;

FIG. 5 is a graph showing the effect of different amounts of yeast extract on the expression level of AMEP412 protein;

FIG. 6 is a graph of the effect of different inorganic salts on the expression level of AMEP412 protein;

figure 7 is a graph of the effect of varying concentrations of calcium phosphate on the expression levels of AMEP412 protein;

FIG. 8 is a graph showing the effect of different buffer pH on the induction of allergic reactions by the AMEP412 protein;

fig. 9 shows the effect of different concentrations of ferrous sulfate in buffer on the induction of allergic reactions by the AMEP412 protein;

FIG. 10 is a graph showing the effect of different concentrations of urea in buffer on the induction of allergic reactions by AMEP412 protein;

FIG. 11 is a graph showing the effect of different dilutions of silicone in buffer on the induction of allergic reactions by AMEP412 protein.

Detailed Description

The present invention is further described below by way of examples, it being understood that these examples are for illustrative purposes only and do not limit the scope of the present invention in any way.

Sources of the biological material in the present invention:

1. the used Bacillus subtilis BU412 is preserved in the China typical culture collection center at 2016, 3 and 30 days, with the preservation number of CCTCC M2016142; the strain has been disclosed in the patent documents of application number 2018.08.14, publication number 2019.01.04, application number 201810919181.6, and patent name "a bacillus subtilis protein elicitor AMEP412 and its function";

2. bacillus subtilis BU108: the separation and identification of bacillus BU108 and the prevention and treatment of potato scab are reported by Zhejiang university of agriculture and forestry, 04 th 2018, 757-764 th, and the authors: song Ye, junliang, shen Yongrui, wang Jiaqi, liu Quan, yan Kuide, the strain is always preserved at the university of eight agricultural cultivations in Heilongjiang, and the applicant is guaranteed to distribute the biological material to the public within twenty years from the date of this application;

3. bacillus belgii (Bacillus velezensis) BU396: isolation and identification of streptomyces scabies antagonistic strain BU396 and analysis of antibacterial properties, microbiological report, 10 th 2019, pages 2601-2611, author: shengmeir, zuoqin, wang Jiaqi, liu Shuang, li Zhanglei, liu Quan, yan Kuide, the strain has been maintained at eight agricultural reclamation universities in black longjiang, and the applicant has guaranteed that the biomaterial is delivered to the public within twenty years from the date of this application;

4. the Bacillus subtilis 168 is a strain preserved in the China center for type culture Collection in 7.23.2013, the preservation number is CCTCC AB 130001, and the Bacillus subtilis is purchased from the China center for type culture Collection;

5. AMEP412 protein: patent application No. 201810919181.6 entitled "a bacillus subtilis protein elicitor AMEP412 and its function", filed as 20180814, published as 20181228, published as 109096378A.

Example 1

This example illustrates the comparison of the expression levels of AMEP412 protein in various Bacillus species.

The AMEP412 protein was found to be present in the genome of various bacilli by a search through the BLAST alignment function in the NCBI database. In order to examine the expression of AMEP412 protein in each strain, and also to find strains with higher expression levels, we analyzed AMEP412 gene and protein expression levels of various Bacillus species deposited in the laboratory. By analyzing the coding gene of AMEP412 protein, universal primers (forward primer F: CGCGGATCCTTGTTCGGACCAATTTTA; reverse primer R: CCGCTCGAGTTAGCCAAGAATCATTTT) are designed for PCR bacterial liquid amplification, and whether each strain contains AMEP412 gene or not is tested. Then, the expression level of AMEP412 protein is detected by strain liquid culture, protein expression and purification.

Among the various bacillus deposited in this laboratory, a total of 4 were found by PCR amplification to have the AMEP genes BU108, b.subtilis 168, BU396 and BU412, respectively (fig. 1). Next, these four strains were subjected to shake flask fermentation culture using YME liquid medium at 28 ℃ and 160rpm for 24 hours. The AMEP412 protein is subjected to ion exchange chromatography and molecular sieve chromatography, and the protein concentration is detected by using NanoDrop for rapid determination. The content of AMEP412 protein in the culture solution of each strain was converted, and the results are shown in Table 1. This revealed that the expression level of the AMEP412 protein was highest in the BU396 strain, and the strain BU396 was used as an expression strain in the future.

TABLE 1 expression level of AMEP412 protein in each strain

Example 2

This example illustrates the selection of carbon and nitrogen sources in BU396 medium.

(1) One-factor analysis of optimal carbon source and dosage

Since the carbon source used in YME medium was maltose, we selected different carbon sources including glucose, lactose, maltose, sucrose for optimal screening. The other factors of this one-factor experiment were kept consistent with previous YME medium, and each level was repeated 5 times, and the amount of AMEP412 protein produced was measured to determine the appropriate carbon source type.

The data obtained by purification and concentration determination were made up with the software Origin 8.5 as a bar graph as shown in FIG. 2. It was found from the analysis of variance that when mannitol was used as a carbon source, the difference between groups was small and significant (P < 0.05) difference was observed with other carbon sources. The expression level of AMEP412 protein is the highest under the condition of using mannitol as a carbon source, and the protein is the best carbon source.

After determining mannitol as the optimum carbon source, the amounts of mannitol were set to 0.6g, 1.0g, 1.4g, 1.8g, and 2.2g, respectively (100 mL system), and the AMEP412 protein concentration was measured using an ultraviolet microspectrophotometer, and the data obtained was plotted using the software Origin 8.5, as shown in FIG. 3. It was found from the analysis of variance that the intra-group difference was small at the mannitol dose of 1.4g, and that there was a significant difference (P < 0.05) from the other doses at the mannitol dose of 1.4 g. It is demonstrated that the expression yield of AMEP412 protein is the highest when the amount of mannitol is 1.4g, and the amount of mannitol is the most suitable amount, so that the amount of mannitol in the culture medium is suggested to be 14g/L.

(2) One-factor analysis of optimum nitrogen source and dosage

Since the nitrogen source used in the YME medium was yeast extract powder, we selected different nitrogen sources including peptone, tryptone, soybean peptone, yeast extract powder, beef powder for optimal screening. Carbon source selection for this one-factor experiment the results of the above optimization, with other factors unchanged, were repeated 5 times per level, and the amount of AMEP412 protein produced was determined to determine the appropriate nitrogen source type.

The data obtained by purification and concentration determination were made up with the software Origin 8.5 as a bar graph as shown in FIG. 4. It was found from the analysis of variance that when yeast extract was used as the nitrogen source, the difference between groups was small and the types of the nitrogen source were significantly different from those of yeast extract (P < 0.05). This indicates that the expression level of AMEP412 protein is the highest and is the best nitrogen source under the condition of using yeast extract powder as the nitrogen source.

After confirming that the yeast extract powder is the optimum nitrogen source, the amounts of the yeast extract powder were set to 0.4g, 0.7g, 1.0g, 1.3 g, and 1.6g (100 mL system), respectively, and the concentration of AMEP412 protein was measured using an ultraviolet microspectrophotometer, and the obtained data was plotted in a bar chart as shown in FIG. 5 using a software Origin 8.5. Finally, it was found from the analysis of variance that the differences between the groups were small when the yeast extract was used at 1.0g, and that the protein concentration was significantly different from the other amounts when the yeast extract was used at 1.0g (P < 0.05). It is shown that when the amount of the yeast extract is 1.0g, the expression yield of the AMEP412 protein is the highest, and the amount is the most suitable amount of the yeast extract as a nitrogen source, so that the amount of mannitol in the culture medium is suggested to be 10g/L.

Example 3

This example illustrates the optimization of BU396 culture conditions by the response surface method.

(1) Plackett-Burman test

The test takes protein yield as a response variable, and selects carbon source, nitrogen source, C/N, inorganic ion (KCl), pH, culture time and culture temperature as 7 factors of PB test on the basis of single-factor test. The factor having a large influence on the production of AMEP412 protein by strain BU396 was determined by designing a Plackett-Burman design scheme with 12 test times by software, adding 5 replicates each at two levels of 1 and-1, and then measuring the production of AMEP412 protein in each test time.

To determine the importance of 7 factors in the Plackett-Burman results, the SPSS software was used to analyze the main effects of each factor. As can be seen from Table 2, there are 3 factors with a confidence level of greater than 95% (confidence interval), respectively nitrogen source, pH and incubation time, where the smaller the P value, the more significant the factor. According to the sequence from large to small the influence on the protein yield: nitrogen source, pH, culture time, carbon source, culture time, inorganic ions, culture temperature and C/N. From this, it was confirmed that the factors most affecting the protein production were nitrogen source, pH and culture time.

TABLE 2 analysis of the major Effect of the factors

(2) Box-Benhnken test

On the basis of a Plackett-Burman test, 3 influence factors which have the largest influence on the protein yield are screened out, other factors are in the optimal level, each factor is in 3 levels (-1,0, + 1), 3 main factors are further optimized by a Box-Benhnken method designed by a response surface test (Table 3), a secondary polynomial mathematical model of the main influence factors and the protein yield is established, and the optimal value of the AMEP412 protein yield is found out. A total of 17 experimental analyses of 3 factors, 3 levels, were designed, of which 12 were test points and 5 were replicates. The AMEP412 protein yield determination is carried out, the protein yield is taken as a response value, after regression analysis, a function equation is determined, and the optimal level of the three factors is designed and optimized according to the Box-Benhnken test, so that the optimal culture condition of the AMEP412 protein yield of BU396 fermentation is obtained.

TABLE 3 Main factor design Table

Obtaining data by using Design Expert 7.0 software, and carrying out detailed analysis on the data to construct a secondary response surface regression equation as follows:

R1＝570.80+100.13×A+45.88×B+26.50×C-5.75×A×B+3.00×A×C-65.03×A ² -76.03×B ² -140.28×C ² (A represents a nitrogen source, B represents pH, and C represents incubation time).

The F value of the regression equation of the quadratic response surface obtained from the analysis result of the regression equation in the table 4 is 47.31, and the probability of P >. Determining the initial optimal culture conditions as nitrogen sources: yeast extract 15.2g/L, pH:6.89 and culture time: 23.84h. It is noted that the recommended dose of yeast extract in the single factor test was 10g/L, whereas the recommended dose obtained by response surface optimization was 15.2g/L, which may be due to the interaction effect between the factors.

TABLE 4 regression equation analysis results

Example 4

This example illustrates the effect of the content of inorganic salts in the medium on the expression of the AMEP412 protein by BU 396.

During the previous experiments, it was found that the AMEP412 was hardly expressed in the medium containing inorganic salts (such as LB medium). Thus, this example examined the effect of sodium chloride, potassium chloride, magnesium chloride, calcium phosphate, zinc sulfate, disodium hydrogen phosphate, and sodium dihydrogen phosphate as inorganic salts on the productivity of the AMEP412 protein. On the basis of the medium composition optimized in example 3, 0.5g/L of the above inorganic salts was added, respectively. And detecting the AMEP412 protein yield through fermentation culture and protein separation and purification.

As a result, it was found that the decrease in the expression level of the AMEP412 protein was most significant in the treatment group to which sodium chloride, calcium chloride and zinc sulfate were added, and the increase in the expression level of the AMEP412 protein was most significant in the treatment group to which calcium phosphate was added. Therefore, in the fermentation medium of the AMEP412 protein, attention should be paid to avoid the use of sodium chloride, calcium chloride and zinc sulfate, and the addition of calcium phosphate is recommended.

Subsequently, a concentration gradient is set for the content of calcium phosphate in the culture medium, and the optimal content of calcium phosphate is further determined. The result shows that when the concentration of the calcium phosphate is 2g/L, the yield of AMEP412 protein is the highest, and the content of the supernatant of the culture solution can reach 3mg/mL. Thus, it was determined that the appropriate amount of calcium phosphate in the medium was 2g/L.

Example 5

This example illustrates the recovery and purification of the AMEP412 protein.

(1) Sample pretreatment

Centrifuging the fermented culture solution for 15min at 12,000g, and taking the supernatant for subsequent purification.

(2) Ion exchange chromatography

A protein sample was collected by equilibrating DEAE anion exchange resin with a buffer containing 20mM Tris-HCl (pH 7.5), passing the supernatant of the centrifuged culture solution through DEAE anion exchange resin, washing the resin with a buffer containing 50mM NaCl to remove non-specifically bound hetero-proteins, followed by elution with a buffer containing 275mM NaCl.

(3) Ultrafiltration

And (3) passing the sample obtained by ion exchange chromatography through an ultrafiltration membrane with the interception aperture of 30kDa, and collecting a protein sample intercepted on the upper part of the ultrafiltration membrane.

(4) Protein concentration detection

And detecting the protein sample by using a NanoDrop ultramicro spectrophotometer to obtain a light absorption value under 280nm, and then converting the light absorption value into 2.864 corresponding to 1mg/mL AMEP412 protein to obtain the concentration of the protein sample.

Through the purification, the minimum recovery concentration of 3mg/mL AMEP412 protein is 2.5mg/mL, and the recovery rate is more than 83%.

Example 6

This example illustrates the effect of buffer pH on the anaphylactic activity elicited by AMEP412 protein.

The purified 0.5mg/mL AMEP412 is dispensed into 6 centrifuge tubes, and a certain amount of NaOH solution and HCL solution are added, and the pH value of the solution in the 6 centrifuge tubes is respectively 10, 9, 8, 7, 6 and 5 through measurement by a pH meter. And (3) respectively sucking the protein solution in the centrifugal tubes by using a needleless injector, and injecting the protein solution into the back of the tobacco leaf, wherein the diameter of the cover is 0.5cm-1cm. The injection site was examined 24 hours later for symptoms of anaphylaxis.

As a result, it was found that the symptoms of allergic reactions gradually became more pronounced with increasing pH, with allergic reactions being most pronounced at pH 8-9. While the symptoms of anaphylaxis still remained as the pH value is increased, the black necrosis phenomenon at the withered spots is increased (figure 8). It is speculated that this phenomenon may be due to the further destructive effect of the buffer at alkaline pH on the necrotic cells after the amap 412 caused the necrosis of the allergic cells. In the application context, the function of AMEP412 is focused on stimulating the plant to produce an immune response, rather than further destruction of plant cells, thereby suggesting that a buffer pH of 8-9 is most appropriate for application.

Example 7

This example illustrates the effect of ferrous sulfate concentration in buffer on the allergenic activity elicited by the AMEP412 protein.

And (3) subpackaging the purified 0.5mg/mL AMEP412 into 3 centrifuge tubes, adding a ferrous sulfate solution in a certain proportion to ensure that the ferrous sulfate concentration in the solution in the 3 centrifuge tubes is 0.1mM, 1mM and 10mM respectively, and taking the protein without the ferrous sulfate as a control. And respectively sucking the protein solution in the centrifugal tube by using a needleless injector, and injecting the protein solution into the back of the tobacco leaf, wherein the covering diameter is 0.5cm-1cm. The injection site was examined 24 hours later for symptoms of anaphylaxis.

As a result, it was found that the symptoms of allergic reactions were more pronounced in the treated groups having ferrous sulfate concentrations of 0.1mM and 1mM than in the control, while the symptoms of allergic reactions were not significantly different in the group treated with ferrous sulfate at 10mM than in the control (FIG. 9). It is presumed that ferrous ions increase the degree of polymerization of the AMEP412 protein and enhance the protein activity in the low polymerization degree range, and when the ferrous ion concentration is too high, the degree of polymerization of the AMEP412 protein becomes too large, which in turn hinders the interaction with plant cells. It is therefore recommended that the concentration of ferrous sulphate in the buffer at the time of administration be in the range 0.1 to 1 mM.

Example 8

This example illustrates the effect of urea concentration in the buffer on the allergenic activity elicited by the AMEP412 protein.

The purified 0.5mg/mL AMEP412 is subpackaged into 5 centrifuge tubes, urea solution with a certain proportion is added, the concentration of urea in the solution in the 5 centrifuge tubes is respectively 0.025, 0.05, 0.1, 0.2 and 0.4mg/mL, and protein without urea is used as a control. And respectively sucking the protein solution in the centrifugal tube by using a needleless injector, and injecting the protein solution into the back of the tobacco leaf, wherein the covering diameter is 0.5cm-1cm. The injection site was examined 24 hours later for symptoms of anaphylaxis.

As a result, it was found that the treated groups having urea concentrations of 0.1 and 0.2mg/mL exhibited more distinct symptoms of allergic reactions than the control, whereas the treated group having an excessively low urea concentration caused no significant difference in allergic reactions from the control, and an excessively high urea concentration (0.4 mg/mL) caused the disappearance of allergic reactions (FIG. 10). It is speculated that high concentrations of urea may cause the AMEP412 protein to denature, causing it to lose its ability to interact with plant cells. It is therefore recommended that the urea concentration in the buffer at the time of administration be 0.1-0.2mg/mL, most suitably.

Example 9

This example illustrates the effect of silicone concentration in buffer on the allergenic activity elicited by the AMEP412 protein.

The purified 0.5mg/mL AMEP412 is dispensed into 5 centrifuge tubes, and the organosilicon solution with the original concentration is diluted to ensure that the organosilicon concentration in the solution in the 5 centrifuge tubes is respectively 1/10000, 1/7500, 1/5000, 1/2500 and 1/1250, and the protein without organosilicon is used as a control. And respectively sucking the protein solution in the centrifugal tube by using a needleless injector, and injecting the protein solution into the back of the tobacco leaf, wherein the diameter of the cover is 0.5cm-1cm. The injection site was examined for symptoms of allergic reactions after 24 hours.

As a result, it was found that the treated groups having the concentrations of silicone of 1/10000, 1/7500 and 1/5000 exhibited more distinct symptoms of allergic reaction than the control, and that the increase in the concentration of silicone caused gradual decrease in the symptoms of allergic reaction, which was not significantly different from the control (FIG. 11). Since silicone is a surfactant, it is speculated that high concentrations of silicone cause the hydrophobic sites of the AMEP412 protein to become hydrophilic and to have reduced interactions with the hydrophobic phospholipid bilayer of the plant cell membrane. It is recommended that the dilution ratio of the silicone in the buffer solution is 1/10000-1/5000 for application.

The invention provides a method capable of improving the expression yield of AMEP412 protein, which can quickly and efficiently obtain a large number of protein samples, and apply the protein samples to the stimulation of plant immunity to improve the functional activity of the protein samples for inducing anaphylactic reaction, thereby improving the utilization efficiency of AMEP412 in practical application and laying a foundation for the development and utilization of AMEP412 protein.

Sequence listing

<110> university of eight agricultural reclamation of Heilongjiang

<120> a method for increasing the production of AMEP412 protein and its application in stimulating plant immunity

<130> B003

<141> 2020-06-05

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgcggatcct tgttcggacc aatttta 27

<210> 2

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccgctcgagt tagccaagaa tcatttt 27

Claims

1. A method for increasing the production of an AMEP412 protein, comprising increasing both the level of protein expression and the recovery yield, characterized in that: fermenting by using a high-efficiency expression strain of AMEP412 protein, namely Bacillus belezii BU396 to improve the protein expression level; the method for improving the recovery yield of the AMEP412 protein comprises 2 steps of purification by using ion exchange resin and ultrafiltration membrane to obtain the high-purity AMEP412 protein.

2. The method of claim 1, wherein: fermenting by using mannitol as a carbon source of a culture medium, wherein the dosage of mannitol is 14g/L; fermenting by using yeast powder as a nitrogen source of a culture medium, wherein the dosage of the yeast powder is 15.2g/L; the pH of the fermentation medium is maintained at 6.89, the fermentation time is 23.84 hours, the contents of sodium chloride, calcium chloride and zinc sulfate in the medium are respectively less than 0.5g/L, and Ca in the medium ₃ (PO ₄ ) ₂ The content of (B) is 2g/L.

3. The method of claim 1, wherein: the concentration of AMEP412 protein in the supernatant of the fermentation liquor is more than or equal to 3mg/mL.

4. The method of claim 1, wherein: the method comprises the following steps: firstly, carrying out first-step purification by using DEAE anion exchange resin, removing impurity proteins by using a buffer solution of 50mM NaCl, 50mM Tris-HCl and pH 8.0 after a culture solution supernatant passes through the anion exchange resin, eluting by using a buffer solution of 275mM NaCl, 50mM Tris-HCl and pH 8.0, and collecting a protein sample; and secondly, performing ultrafiltration by using an ultrafiltration membrane with the molecular weight cutoff of 30kDa, and collecting a protein sample which does not pass through the ultrafiltration membrane, namely AMEP412 protein.

5. The method of claim 1, wherein: recovering the purified AMEP412 protein in an amount of 2.5mg/mL or more and a recovery yield of 83% or more.