CN109810997B - Construction method of fusarium graminearum single-stranded circular DNA virus FgGMTV1/HB58 infectious clone - Google Patents

Abstract

The invention discloses a construction method of fusarium graminearum single-stranded DNA virus FgGMTV1/HB58 infectious clone, wherein the virus genome comprises two single-stranded circular DNA molecules DNA-A and DNA-B, and the genome sequence is shown as SEQ ID NO 1-2; and does not contain a single-stranded circular DNA molecule DNA-C, and the genome sequence of the DNA-C is shown as SEQ ID NO. 3. The construction method comprises the steps of DNA-A infectious clone construction, DNA-B infectious clone construction and DNA-C infectious clone construction. The construction of the infectious clone can be successful only by cloning and transfecting fungi by using one bacterial cloning vector pBluescript II SK (+), thereby simplifying the steps of cloning and transfecting, not needing multiple PCR cloning, a plurality of cloning vectors and transfecting vectors, and not needing to clone to a binary expression vector to finish the transfection.

Description

Construction method of fusarium graminearum single-stranded circular DNA virus FgGMTV1/HB58 infectious clone

Technical Field

The invention relates to the technical field of fusarium graminearum prevention and treatment, in particular to a construction method of fusarium graminearum DNA virus infectious clone.

Background

Fusarium graminearum (Fusarium graminearum Schw.) is an important species of Fusarium, and can cause diseases in field gramineous crops. Such as wheat scab. After wheat grains or corns are infected, white flocculent or villous hyphae grow, and then the hyphae are white to rose color, white to pink color or white to brick red color. The active state is Gibberella zeae Schw.Petch fungus of Deuteromycotina. The apomorphic genus is Ascomycotina fungus. In the culture medium, white aerial hyphae are dense, and the hyphae in the medium secrete a reddish-brown pigment. The life history includes sexual and asexual generations. Sexual generations produce an ascocarp, pear-shaped, mouthed. The rod-shaped ascospores are clustered with ascospores in eight ascospores per ascocarp, and the ascospores are spindle-shaped, and usually have three septa. Asexual generations produce conidia in the shape of sickles, usually with three to five septa.

Fusarium graminearum has a wide host range, can infect cereal crops such as wheat, barley and corn, can secrete some toxin substances such as Trichothecenes (Trichothecenes), estrogenic mycotoxins (oestrogermycitoxins) and zearalenone (zearalenone), and can cause obvious toxic symptoms including nausea, vomiting, even abortion and the like after the cereals containing certain levels of toxins are used by human beings and livestock. In recent years, Fusarium graminearum (Fusarium graminearum Schw) is the dominant species causing wheat scab in different regions and varieties, and at present, the prevention and treatment of wheat scab caused by Fusarium graminearum mainly takes chemical prevention and treatment as a main part, and broad-spectrum bactericides such as amiloride, thiabendazole, carbendazim and the like are mostly used. The chemical agent has poor prevention and treatment effect on the gibberellic disease and is difficult to recover loss. In the fields with serious diseases, a great deal of yield reduction can be caused. The frequent use of large amounts of chemical pesticides can cause serious pollution to the natural environment including soil, underground water and the like. Drug residues are gradually accumulated in the human body along with the food chain. The pollution of soil and underground water can cause the continuous deterioration of natural environment and influence the living conditions of human beings. The second control method is mainly agricultural management. If crop rotation cultivation is needed, the accumulation of pathogenic bacteria caused by continuous cropping is prevented. Sterilizing soil and culture medium; when the plants are cultivated, the plants are timely pulled out and destroyed, so that further diffusion of germs is reduced. The cultivation density of plants is well mastered, ventilation is enhanced, humidity is reduced, the water content of soil or a substrate is well controlled, and the substrate with good drainage is preferably selected. These measures can prevent and cure the outbreak and prevalence of gibberellic disease to some extent.

The method for effectively preventing and controlling wheat scab is used for cultivating disease-resistant varieties. However, no commercial wheat variety with complete disease resistance or complete immunity exists up to now. The resistance of wheat to gibberellic disease is divided into five types, namely a type I anti-invasion type, a type II anti-expansion type, a type III antitoxin accumulation type, a type IV seed anti-infection type and a type V disease-resistant type. At present, the technology for cultivating transgenic wheat varieties by single-gene transformation of wheat can be realized. The resistance to the gibberellic disease can be effectively improved by transferring some identified gibberellic disease resistant genes into excellent wheat varieties. The limited identification quantity of wheat and other host scab resistant genes limits the cultivation of disease resistant varieties. The identified resistance genes comprise degrading enzymes such as glucanase and chitinase, and a plurality of sweet proteins and proteins blocking the aggregation of deoxynivalenol.

Fungal viruses are present in all major groups of fungi. Since the first fungal virus reported in 1962, a large number of fungal viruses were discovered and studied. However, studies of fungal viruses have not been paid sufficient attention and show some hysteresis. The main reasons include, firstly, that fungal virus infections do not show obvious symptoms, are not easily discovered and appreciated by scholars, and most mycologists often ignore when they come into contact with abnormal bacterial strains of colonies due to fungal virus infections. Second, there are fewer virologists studying fungal viruses. The current research focus is mainly on fungal viruses that can attenuate the pathogenicity of hosts, exploring the replication mechanisms, protein functions and applications of these viruses in the biological control of agricultural fungal diseases. In the fungal virus systems up to now, only chestnut blight low-virus CHV1/EP713 is successfully used for biological control, and is found and applied in Italy, so that the Chinese chestnut forests which are endangered to be extinct due to chestnut blight are saved, and in addition, DNA virus 1 (SshHDV-1) related to low-virus decay of sclerotinia sclerotiorum is also successfully applied to biological control, so that the pathogenic degree of sclerotinia sclerotiorum can be effectively reduced, and the obvious disease prevention effect is achieved. The prevention and control of plant fungal diseases at the present stage is a difficult problem, and with the large-scale application of chemical pesticides, huge pollution is caused to the environment while the diseases are prevented and controlled, wherein the pollution comprises soil pollution, food pollution, air pollution and water pollution. The mycovirus is used as a biological control resource, and a new way is provided for controlling fungal diseases.

Disclosure of Invention

The invention aims to provide a fusarium graminearum single-stranded circular DNA virus FgGMTV1 and application thereof in weakening pathogenicity of fusarium graminearum

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

fusarium graminearum strain HB58, containing the above Fusarium graminearum single-stranded circular DNA virus FgGMTV 1. The strain is separated from wheat ears with gibberellic disease in Hebei province, and is sent to China general microbiological culture Collection center (CGMCC) for preservation in 2019, 1 month and 15 days, wherein the preservation number is CGMCC No.17181, and the preservation address is as follows: xilu No.1, Beijing, Chaoyang, Beijing, and institute for microbiology, China academy of sciences.

A construction method of fusarium graminearum single-stranded DNA virus FgGMTV1/HB58 infectious clone is disclosed, wherein the virus FgGMTV1/HB58 comprises two single-stranded circular DNA molecules DNA-A and DNA-B, and the genome sequence is shown as SEQ ID NO 1-2; and does not contain a single-chain circular DNA molecule DNA-C, and the genome sequence of the DNA-C is shown as SEQ ID NO. 3;

the construction method comprises the steps of DNA-A infectious clone construction, DNA-B infectious clone construction and DNA-C infectious clone construction.

Wherein the specific steps of the construction of the DNA-A infectious clone comprise: extracting FgGMTV1/HB58 virus particles in fusarium graminearum strain HB58, extracting nucleic acid from the virus particles, carrying out RCA rolling circle amplification reaction on the extracted nucleic acid, digesting the nucleic acid by EcoRI and KpnI restriction enzymes to obtain a fragment which is about 1.3kb long and has EcoRI digestion sites at two ends, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by EcoRI to form a recombinant vector pSK-1A with a copy of DNA-A molecules, sequencing the positive clone by a company, and confirming that no mutation is introduced in the RCA reaction; then, the correct pSK-1A recombinant vector was sequenced, digested with EcoRI restriction enzyme and then ligated to the EcoRI-digested pSK vector to form a recombinant vector pSK-2A with two copies of DNA-A, and the positive recombinant vector was digested with restriction enzyme to verify the orientation of the insert.

Wherein the specific steps of the construction of the DNA-B infectious clone comprise: extracting virus particles of FgGMTV1/HB58 in fusarium graminearum strain HB58, extracting nucleic acid from the virus particles, carrying out RCA rolling circle amplification reaction on the extracted nucleic acid, digesting the nucleic acid by EcoRI and SpeI restriction enzymes to obtain a fragment which is about 1.3kb long and has EcoRI digestion sites at two ends, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by EcoRI to form a recombinant vector pSK-1B with a copy of DNA-B molecules, sequencing the positive clone by a company, and confirming that no mutation is introduced in the RCA reaction; then, the correct pSK-1B recombinant vector was sequenced, digested with EcoRI restriction enzyme, and then re-ligated to the EcoRI-digested pSK vector to form a recombinant vector pSK-2B with two copies of DNA-B, and the positive recombinant vector was digested with restriction enzyme to verify the orientation of the insert.

The specific steps for constructing the DNA-C infectious clone are as follows: extracting FgGMTV1/HB58 virus particles in fusarium graminearum strain HB58, extracting nucleic acid from the virus particles, carrying out RCA rolling circle amplification reaction on the extracted nucleic acid, digesting the nucleic acid by using XbaI restriction endonuclease to obtain a fragment with the XbaI restriction site at two ends and the length of about 1.3kb, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by XbaI to form a recombinant vector pSK-1C with a copy of DNA-C molecules, and sending a positive clone to a company for sequencing to confirm that no mutation is introduced in the RCA reaction; then, the correct pSK-1C recombinant vector was sequenced, digested with XbaI and ClaI restriction enzymes, and then religated to the pSK vector digested with XbaI and ClaI to form a recombinant vector pSK-0.6C with 0.6 copies of DNA-C, then the pSK-1C recombinant vector was digested with XbaI to obtain a single copy of DNA-C, and religated to the XbaI site of the pSK-0.6C recombinant vector to obtain a recombinant vector pSK-1.6C with 1.6 copies of DNA-C, and the positive recombinant vector was digested with restriction enzymes to verify the orientation of the insert.

The construction method of the fusarium graminearum single-stranded DNA virus FgGMTV1/HB58 infectious clone has the advantages that: the construction of the infectious clone can be successful only by cloning and transfecting fungi by using one bacterial cloning vector pBluescript II SK (+), thereby simplifying the steps of cloning and transfecting, not needing multiple PCR cloning, a plurality of cloning vectors and transfecting vectors, and not needing to clone to a binary expression vector to finish the transfection. Meanwhile, the method is the first infectious clone construction of the fungal DNA virus internationally, and provides important reference for the research of DNA fungal viruses by international colleagues in the future.

The construction method of the Fusarium graminearum single-stranded DNA virus FgGMTV1/HB58 infectious clone of the present invention is further described below with reference to the accompanying drawings and specific examples.

Drawings

FIG. 1 is a colony morphology of Fusarium graminearum strain HB58 of the present invention; culturing at 25 deg.C in dark and inverted for 3 days;

FIG. 2 is an electron microscope observation of FgGMTV1/HB58 virions of virus extracted from strain HB58 in accordance with the present invention; the diameter of each virus particle is 19-21 nm, and the scale in the figure is 50 nm;

FIG. 3 is an electrophoresis observation of FgGMTV1/HB58 virion-extracted nucleic acid extracted from strain HB58 in the present invention; lane 1, DNA marker; lane 2, nucleic acid extracted from FgGMTV1/HB58 virions with a bright band at 1.3 kb;

FIG. 4 is an electrophoretic observation of nucleic acid extracted from FgGMTV1/HB58 virions extracted from strain HB58 in the present invention digested with nuclease; lane 1, DNA marker; lane 2, product after DNase I digestion; lane 3, product after Exonuclease iii digestion; lane 4, product after S1 nuclease digestion; lane 5, product after Exonuclease i digestion;

FIG. 5 is an electrophoresis observation of FgGMTV1/HB58 virion extraction structural protein extracted from strain HB58 in the present invention; lane 1, Protein marker; lane 2, structural proteins extracted from FgGMTV1/HB58 virions, for a total of three protein bands;

FIG. 6 shows the genomic structure of the virus FgGMTV1/HB58 extracted from strain HB58 of the present invention, which virus comprises a total of three single-stranded circular DNA molecule fragments (DNA-A, DNA-B and DNA-C), DNA-A comprising an ORF encoding a Replication initiation protein (Rep), DNA-B comprising an ORF encoding a Coat Protein (CP), DNA-C comprising an ORF encoding an unknown functional protein p26, DNA-A and DNA-B comprising the same stem-loop structure, DNA-C comprising a different stem-loop structure, and three single-stranded circular DNA molecules comprising two common regions (CR-M and CR-S L);

FIG. 7 shows the Southern hybridization results of nucleic acids extracted from virions of strains HB58 and FgGMTV1/HB58 of the invention; probe A is a 359bp DNA Probe which is marked by digoxin and is specific to a DNA-A Circular molecule, Probe B is a 335bp DNA Probe which is marked by digoxin and is specific to a DNA-B Circular molecule, Probe C is a 326bp DNA Probe which is marked by digoxin and is specific to a DNA-C Circular molecule, OC dsDNA refers to a double-strand open loop configuration of DNA, SC dsDNA refers to a supercoiled configuration of DNA, and Circular ssDNA refers to a single-strand Circular DNA configuration;

FIG. 8 shows the construction strategy of the infectious clone of three genome segments of the virus FgGMTV1/HB58 extracted from strain HB58 in the present invention; pSK-2A is a pBluescript II SK (+) (pSK) recombinant vector comprising two copies of a DNA-A molecule, pSK-2B is a pBluescript II SK (+) recombinant vector comprising two copies of a DNA-B molecule, and pSK-1.6C is a pBluescript II SK (+) recombinant vector comprising 1.6 copies of a DNA-C molecule;

FIG. 9 shows Southern hybridization results of wild strain PH-1 and transfectant strains S, A, B, C, A + B, A + C, B + C, A + B + C and Virion; the strain S is a transfectant of an empty vector pBluescript II SK (+), the strain A is a transfectant of a recombinant vector pSK-2A, the strain B is a transfectant of a recombinant vector pSK-2B, the strain C is a transfectant of a recombinant vector pSK-2C, the strain A + B is a transfectant of the recombinant vectors pSK-2A and pSK-2B, the strain A + C is a transfectant of the recombinant vectors pSK-2A and pSK-1.6C, the strain B + C is a transfectant of the recombinant vectors pSK-2B and pSK-1.6C, the strain B + C is a transfectant of the recombinant vectors pSK-2A, pSK-2B and pSK-1.6C, the strain Virion is a transfectant of FgGMTV1/HB58 virus particles, the Probe A is a 359bp DNA Probe which is marked by digoxin and is specific to DNA molecules of the DNA-A, and the Probe B is marked by digoxin and specific to DNA molecules of the circular molecules of the DNA-A, probe C is a digoxin-labeled 326bp DNA Probe specific to a DNA-C Circular molecule, OC dsDNA refers to a double-strand open-loop configuration of DNA, SC dsDNA refers to a supercoiled configuration of DNA, and Circular ssDNA refers to a single-strand Circular DNA configuration;

FIG. 10 shows the results of virion extraction for transfectant strains A + B and A + B + C; the diameter of the virus particles of the two viruses is 19-21 nm, and the scale in the figure is 50 nm;

FIG. 11 shows the structural protein extraction results for transfectant strains A + B and A + B + C; lane 1, Protein marker; lane 2, structural protein extracted from transfectant strain S, as negative control; lane 3, structural proteins extracted from transfectant strain a + B; lane 4, structural proteins extracted from transfectant strains a + B + C; lane 5, structural protein extracted from strain HB58 of the present invention as a positive control;

FIG. 12 shows the results of nucleic acid extraction for transfectant strains A + B and A + B + C; lane 1, DNA marker; lane 2, nucleic acid extracted from transfectant strain S as a negative control; lane 3, nucleic acid extracted from transfectant strain a + B; lane 4, nucleic acid extracted from transfectant strains a + B + C; lane 5, nucleic acid extracted from strain HB58 of the present invention as a positive control;

FIG. 13 shows the Southern hybridization results of transfectant strains A + B and A + B + C; lane 1, nucleic acid extracted from transfectant strain S as a negative control; lane 2, nucleic acid extracted from transfectant strain a + B; lane 3, nucleic acid extracted from transfectant strains a + B + C; lane 4, lanes 4, nucleic acid extracted from strain HB58 of the present invention, as a positive control, Probe A was a 359bp DNA Probe specific to the DNA-A circular molecule labeled with digoxin, Probe B was a 335bp DNA Probe specific to the DNA-B circular molecule labeled with digoxin, and Probe C was a 326bp DNA Probe specific to the DNA-C circular molecule labeled with digoxin;

FIG. 14 is a comparison of colony morphology of wild strain PH-1, strain HB58 of the invention, and transfectant strains S, A + B, A + B + C and Virion on PDA medium;

FIG. 15 is a comparison of colony diameter (A) and growth rate (B) on PDA medium for wild strain PH-1, strain HB58 of the present invention, and transfectant strains S, A + B, A + B + C and Virion;

FIG. 16 is a comparison of conidiophore yields of wild strain PH-1, strain HB58 of the present invention and transfectant strain S, A + B, A + B + C and Virion;

FIG. 17 is a Southern hybridization of transfectant strains S, A + B and A + B + C for their ability to transmit virus through conidia; lane 1, nucleic acid extracted from hyphae collected after 5 days of conidia of transfectant strain S growth in PDB medium as negative control; lane 2, nucleic acid extracted from hyphae collected after 5 days of conidia of transfectant strains a + B growth in PDB medium; lane 3, nucleic acid extracted from hyphae collected after 5 days of conidia of transfectant strains a + B + C grown in PDB medium; probe A is a DNA Probe of 359bp marked by digoxin and specific to DNA-A circular molecules;

FIG. 18 shows a comparison of the pathogenicity of wheat after inoculation with conidia of wild strain PH-1, strain HB58 of the invention and transfectant strain S, A + B, A + B + C and Virion; a is the statistics of the number of spikelets per spike, and B is the incidence condition of the spike;

FIG. 19 is a comparison of pathogenicity of wheat inoculated with hyphal masses of wild strain PH-1, strain HB58 of the invention, and transfectant strains S, A + B, A + B + C and Virion; a is the number of spikelets per ear of wheat, and B is the ear of wheat.

Detailed Description

Example 1 extraction and Observation of virions from Fusarium graminearum strain HB58

Separating fusarium graminearum strain HB58 from wheat ears with gibberellic disease in Hebei province, culturing fusarium graminearum strain HB58 carrying FgGMTV1 in a PDB culture medium for 1 week, collecting mycelia, drying multiple layers of filter paper, grinding the dried mycelia in liquid nitrogen to powder, adding a buffer solution according to the proportion of 1g of mycelia dry powder into 5M L sodium phosphate buffer solution (0.1M), placing the buffer solution into a shaking table for incubation for 1-2 h (100rpm, 4 ℃) to release virus particles, centrifuging at low speed for 20min to remove large impurities (5000rpm,4 ℃), taking the supernatant into a new centrifugal tube, adding chloroform with the same volume to the mixed solution, mixing the mixture gently, centrifuging for 20min (12000rpm, 4 ℃), taking the supernatant into an ultra-speed centrifugal tube (35M L), balancing each centrifugal tube, ultracentrifuging for 3h (32000rpm, 4 ℃), carefully pouring the supernatant, adding 1M L buffer solution (0.01M) into the bottom precipitate, dissolving the supernatant at 4 ℃, and transferring the supernatant to an ultra-speed centrifugal tube for standby after full precipitation, dissolving the supernatant at the temperature of 1.5M, 5M, and placing the centrifugal tube at 594 ℃, and centrifuging the temperature;

sucrose gradient centrifugation, namely preparing a sucrose solution by using 0.01M sodium phosphate buffer solution, wherein W/V is respectively 10%, 20%, 25%, 30% and 40%, adding the sucrose solution into a gradient centrifuge tube (13M L), starting from a low-concentration sucrose solution, penetrating into the bottom of the tube along the tube wall by using a pipette, slowly dripping, adding 2M L at each concentration, keeping the balance among the concentrations, marking the position of each sucrose gradient by using a marker pen, finally adding the virus particle solution at the top, if the centrifuge tube is not full, filling the centrifuge tube with 0.01M sodium phosphate buffer solution, and carrying out ultracentrifugation for more than 3h (35000rpm, 4 ℃), after centrifugation, carefully taking out each gradient sucrose solution from top to bottom by using the pipette, and subpackaging each milliliter with 13 tubes, wherein the virus particles of FgTV GM 1 are mainly concentrated between 25% and 30% sucrose solutions, namely, an 8 th tube and a 9 th tube;

the two tubes were selected for desugarization and purification, 2M L of sucrose solution containing virus was added to an ultracentrifuge tube (35M L), filled with sodium phosphate buffer (0.01M), ultracentrifuged for 3 hours or more (35000rpm, 4 ℃), the supernatant was carefully decanted (or pipetted slowly, the viral particles at this time were easily decanted with the supernatant), 500. mu. L of sodium phosphate buffer (0.01M) was added to ice and dissolved overnight, the extracted viral particle solution was added to DMSO to a final concentration of 10%, and stored at-80 ℃ for further use.

Negative staining observation of FgGMTV1 virus particles comprises taking 10 mu L virus particle suspension, carefully dropping on a copper mesh, standing at room temperature for l-2 min, absorbing excess virus solution with filter paper after the virus particle is fully adsorbed on the copper mesh, dropping a drop of 1% sodium phosphotungstate solution, reacting for 1min, absorbing excess solution with filter paper, and observing with a transmission electron microscope after the copper mesh is dried.

As a result: the strain HB58 is a strain separated from Hebei province, and the strain is confirmed to be a fusarium graminearum strain through morphological identification and molecular identification (figure 1); the virus particles are purified by a sucrose gradient centrifugation method, and the virus particles are mainly distributed in a sucrose gradient with the concentration of 25% -30%. By observing the negatively stained sample of virions using transmission electron microscopy, it was observed that the virions of FgGMTV1 were equiaxed spherical with diameters of 19-21 nm (FIG. 2).

The strain HB58 with the toxin is already preserved in China general microbiological culture Collection center (CGMCC) in 2019, 1 month and 15 days, and the registration number is CGMCC NO. 17181.

Example 2 extraction and Observation of nucleic acids from virions in Fusarium graminearum strain HB58

Collecting appropriate amount of virus purified solution 20-100 μ L, adding sterile distilled water to 200 μ L, adding equal volume (200 μ L) of extraction buffer (20mM Tris-HCl pH8.0; 1% SDS; 200mM NaCl; 5mM EDTA), adding equal volume of saturated phenol/chloroform (400 μ L), slightly shaking and mixing for 2-5 min, centrifuging at 12000rpm for 2min, collecting supernatant, adding equal volume of saturated phenol/chloroform, mixing and extracting, centrifuging at 12000rpm for 2min, extracting with equal volume of chloroform/isoamyl alcohol (24:1), collecting supernatant, adding 2.5 times volume of anhydrous cold ethanol, mixing, standing at-80 deg.C for 1 hr, centrifuging at 12000rpm for 15min, removing ethanol, washing precipitate with 70% cold ethanol (0.5m L) for 2 times, vacuum drying, standing for 2-5 min, precipitating in 30 μ L of sterile distilled water, detecting with 1% agarose gel electrophoresis, and storing at-20 deg.C.

As a result: the viral particle is split by a phenol-mimetic extraction method and nucleic acid is extracted for detection, and the result shows that the viral particle is wrapped with a nucleic acid fragment with the size of 1.3kb (figure 3).

Example 3 nuclease digestion and Observation of nucleic acids in virions in Fusarium graminearum strain HB58

DNase I, S1 nuclease, exonuclease I and exonuclease III were selected to treat 2-5. mu.g of virus particle nucleic acid extract, respectively, and the reaction system and reaction time were performed according to the respective kit enzyme instructions.

As a result: to further characterize the nucleic acid in the virions, treatment was performed using dnase I, S1 nuclease, exonuclease I, and exonuclease III (fig. 4). As a result, no DNA band was present in the DNase I treated lane, indicating that the nucleic acid was DNA; the DNA exonuclease III is a specific exonuclease for processing double-stranded nucleic acid, and a DNA band processed by the exonuclease is not changed, so that the nucleic acid is proved to be not double-stranded linear DNA; the S1 nuclease is a single-strand specific endonuclease, and the DNA band treated with the nuclease disappears, thus proving that the nucleic acid is single-strand DNA; exonuclease I is a single-stranded exonuclease in which the DNA band treated with this enzyme is unchanged, demonstrating that the fragment may not be single-stranded linear DNA or have a protective structure at the end. From the above results, it is assumed that the nucleic acid extracted from the viral particle is a single-stranded circular DNA or a single-stranded linear molecule having a specific protective structure at both ends.

Example 4 cloning and sequence analysis of Fusarium graminearum Single Strand circular DNA Virus FgGMTV1 genome

Extracting FgGMTV1/HB58 virus particles in strain HB58, extracting nucleic acid from the virus particles by phenol-copy extraction, performing Rolling Circle Amplification (RCA) on the extracted nucleic acid by using a Kit Illustra Templiphi Amplification Kit (GE Healthcare, USA), mixing 1 mu L nucleic acid with 5 mu L sample solution uniformly, incubating at 95 ℃ for 3min, immediately inserting into ice for cooling for 2min, adding 5 mu L reaction solution and 0.2 mu L Phi 29DNA polymerase, incubating at 30 ℃ for 3h, inactivating at 65 ℃ for 10min, storing at-20 ℃, digesting RCA samples by BamH I, EcoR I, Sal I, Bgl II and Kpn I respectively, connecting the digested product to pET30a vector (Novagens) treated by corresponding restriction endonuclease, transforming into Trans recombinant cell (Gen 32), performing PCR on-sensitive cell analysis, performing BI on the result by using NCM software, and performing biological assay on the DNA and website information by using NCH 5 α;

in order to obtain a full-length sequence, back-to-back primers DNA-A-1F (5'-ggttctggtgacaacttcg-3')/1R (5'-ccacacactgtcgtcaattacg-3') are arranged for amplifying DNA-A, DNA-B-1F (5'-ttgatccggcggtgtgcaagg-3')/1R (5'-acatcgtgtccatcacattc-3') for amplifying DNA-B and DNA-C-1F (5'-ctttagactggatgctctcg-3')/1R (5'-aggtgcttgtggctcagtt-3') for amplifying DNA-C, the sequences are shown as SEQ ID NO:4-9, nucleic acid extracted from virus particles is used as a template, PCR, connection, transformation and sequencing are carried out, and the obtained sequences are spliced by using the sequence splicing function of DNAMAN software to form a complete virus genome sequence.

As a result, the genome of the virus carried by strain HB58 contains three fragments, DNA-A, DNA-B and DNA-C, respectively, whose genome sequences are shown in SEQ ID NO: 1-3. DANMAN software prediction and NCBI bioinformatics website analysis, DNA-A contains an ORF, encodes a Replication initiation protein (Rep), DNA-B contains an ORF, encodes a Coat Protein (CP), DNA-C contains an ORF, encodes an unknown functional protein p26, DNA-A and DNA-B contain the same stem-loop structure, DNA-C contains a different stem-loop structure, and three circular single-stranded DNA molecules contain two common regions (CR-M and CR-S L) (FIG. 6). after sequence analysis and phylogenetic analysis, the virus is a new virus of the newly established single-stranded circular DNA family Genomoviridae, and therefore, the three obtained fragments are circular DNA molecules.

Example 5 Southern hybridization

Electrophoresis: after extracting the genomic DNA of the fusarium graminearum strain, carrying out electrophoresis in 1% agarose gel for 30min, and setting the voltage to be 120V/cm. After electrophoresis, the spotting wells and any excess gel were cut off.

Transferring the membrane, namely, the method refers to the standard operation steps in molecular cloning, immersing the gel in 0.25 mol/L HC1 for 10min, washing the gel twice by using a steam house, immersing the gel in 0.1 mol/L NaOH solution for 20min, transferring the gel to 0.1 mol/L Tris-HCl (pH 8.0) for 20min, then treating the gel for 15min by using 20 × SSC, using an organic glass sheet with the area larger than that of the gel as a platform, putting the organic glass sheet into a large tray, pouring 20 × SSC to ensure that the liquid level is slightly lower than the surface of the filter paper, spreading a new piece of filter paper on the organic glass platform to ensure that both ends are immersed in 20 × SSC, spreading a layer of filter paper slightly larger than the gel to uniformly wet the filter paper, placing the gel with the front side downwards on the wet filter paper on the platform, placing a nylon membrane with the size same as that of the gel above the gel, immersing the nylon membrane in 20 × SSC for 5min in advance, placing the same size as the gel on the membrane, using 500g of filter paper, removing 12 g of agarose, carefully removing the nylon membrane, and removing the piece of the nylon membrane, and carefully removing the piece of filter paper.

UV-Cross-linking by wetting Whatman filter paper with 10 × SSC, placing the hybrid membrane on Whatman filter paper, UV-cross-linking with UV-cross-linking instrument, and placing the hybrid membrane in ddH₂Slightly swinging in O, and airing in a fume hood;

hybridization, namely gently sandwiching the hybridization membrane into a hybridization tube (front facing inward) with tweezers, making the front facing the inside of the tube, adding an appropriate amount of prehybridization solution into a hybridization oven at 42 ℃ for 45min, boiling the prepared digoxin-labeled DNA probe in boiling water, removing 4 mu L hybridization probe, and supplementing ddH₂O to 50 mu L, boiling in boiling water for 5min, cooling rapidly on ice, adding the denatured probe to the hybridization solution, mixing gently, contacting the hybridization solution with the hybridization membrane, hybridizing overnight in a hybridization oven at 42 ℃, adding enough low stringency Washing solution (2 × SSC, 0.1% SDS solution) to the hybridization bottle, slightly rotating, Washing for 2 times, pouring the solution at room temperature for 15min, adding enough high stringency Washing solution (0.5 × SSC, 0.1% SDS solution), slightly rotating, Washing for 2 times, 15min each time, discarding the high stringency Washing solution, adding enough Washing buffer, Washing for 1-5 min (cooling the hybridization oven with ice to room temperature), discarding the Washing buffer, adding 100m L Blocking buffer, Washing for 30min at room temperature, discarding the buffer, adding 20m L Antibody solution, Washing for 30min at room temperature, rinsing for 100m L Blocking buffer, rinsing for twice, adding enough Washing for 5202 min, Washing the hybridization membrane with a fluorescence Detection instrument, adding homogeneous hybridization solution, Washing for 5202 min, and Washing for twice, and detecting hybridization signals on a hybridization Detection bag at room temperature, adding a fluorescence Detection bag, Washing for 2min, and adding a fluorescence Detection.

As a result: in order to verify that the three molecular fragments obtained were indeed present in the virions, Southern blot analysis was performed on the genomic DNA extracted from strain HB58 and on the nucleic acids extracted from the virions. Using digoxin Probe labeling reagent box to prepare 359bp DNA Probe A specific to DNA-A circular molecule, 335bp DNA Probe B specific to DNA-B circular molecule and 326bp DNA Probe C specific to DNA-C circular molecule; these probes hybridized with strain HB58 and the viral fragment carried by the virion, showed significant hybridization signals, and exhibited three molecular forms of double-stranded open loop (OC), double-stranded Supercoiled (SC) and single-stranded circular (FIG. 7). The three molecular fragments obtained are indeed present in strain HB58 and in the virion.

Example 6 extraction and Observation of structural proteins in virions from Fusarium graminearum strain HB58

Preparing separation gel, carefully pouring the separation gel into a pre-assembled mould, flowing out the space required by the concentrated gel, and adding a layer of sterile ddH on the separation gel₂And O. Preparing concentrated gel after polymerizing the separation gel, pouring the concentrated gel into a mould to ensure that the ddH₂C, allowing the concentrated glue to flow out, carefully filling the concentrated glue on the upper layer of the separation glue, and immediately inserting a comb to wait for the glue to be completely condensed; finally, carefully pulling out the comb, placing the gel in an electrophoresis tank, adding electrophoresis buffer solution into the inner electrophoresis tank and the outer electrophoresis tank, and filling the sample loading holes with the buffer solution.

The virion suspension was treated with 4 μ L loading buffer in boiling water for 5min at 10 μ L, immediately cooled on ice, mixed and carefully added to the wells, electrophoresis was performed at 80V constant voltage when the sample was in the gel concentrate, protein samples were compressed into a band when the sample was at the interface between the gel concentrate and the gel isolate, electrophoresis was performed at 100V constant voltage, and stopped when bromophenol blue reached the bottom of the gel.

Carefully peeling the gel after electrophoresis from the mold, cutting off the concentrated gel, and washing the separated gel with distilled feed water several times. The cells were stained in Coomassie brilliant blue R-250 staining solution for 1 h. And pouring off the staining solution, and decoloring for more than 3 hours by using a decoloring solution until clear protein bands can be observed.

As a result: the obtained purified virus particles are subjected to SDS-PAGE electrophoresis, three obvious protein bands can be seen, the larger two bands are between 25 and 35kDa, and the smallest band is about 10kDa (figure 5); through mass spectrometric identification of the proteins of the three bands, the obtained amino acid sequences of the three proteins are found to be consistent with the predicted coat protein sequence, so that it can be confirmed that the protein encoded by DNA-B is indeed the coat protein, and the three protein bands are probably the products of CP protein degradation.

Example 7 infectious clone construction of three genomic fragments of Fusarium graminearum single-stranded circular DNA Virus FgGMTV1

The specific steps for constructing the DNA-A infectious clone are as follows: extracting virus particles of FgGMTV1/HB58 in a strain HB58, extracting nucleic acid from the virus particles by a phenol-mimetic extraction method, performing Rolling Circle Amplification (RCA) on the extracted nucleic acid by using a Kit Illustra Templiphilamplification Kit (GE Healthcare, USA), digesting the extracted nucleic acid by using EcoRI and Kpn I restriction enzymes to obtain a fragment with the length of about 1.3kb and with EcoRI digestion sites at both ends, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by EcoRI to form a recombinant vector pSK-1A with a copy DNA-A molecule, sequencing by a positive cloning company, and confirming that no mutation is introduced in the RCA reaction; then, sequencing the correct pSK-1A recombinant vector, digesting the vector by using an EcoRI restriction enzyme, then re-connecting the vector to the pSK vector digested by the EcoRI to form a recombinant vector pSK-2A with two copies of DNA-A, and verifying the direction of the inserted fragment by using the positive recombinant vector through digestion by using the restriction enzyme;

the specific steps for constructing the DNA-B infectious clone are as follows: extracting FgGMTV1/HB58 virus particles in a strain HB58, extracting nucleic acid from the virus particles by a phenol-mimetic extraction method, performing Rolling Circle Amplification (RCA) on the extracted nucleic acid by using a Kit Illustra Templiphilamplification Kit (GE Healthcare, USA), digesting the extracted nucleic acid by using EcoRI and SpeI restriction enzymes to obtain a fragment with the length of about 1.3kb and the fragment with EcoRI digestion sites at both ends, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by EcoRI to form a recombinant vector pSK-1B with a copy DNA-B molecule, sequencing the positive clone company and confirming that no mutation is introduced in the RCA reaction; then, sequencing the correct pSK-1B recombinant vector, digesting the vector by using an EcoRI restriction enzyme, then re-connecting the vector to the pSK vector digested by the EcoRI to form a recombinant vector pSK-2B with two copies of DNA-B, and verifying the direction of the inserted fragment by using the positive recombinant vector digested by using the restriction enzyme;

the specific steps for constructing the DNA-C infectious clone are as follows: extracting FgGMTV1/HB58 virus particles in a strain HB58, extracting nucleic acid from the virus particles by a phenol-copy extraction method, carrying out rolling circle amplification Reaction (RCA) on the extracted nucleic acid by using a Kit Illustra Templiphiamplification Kit (GE Healthcare, USA), digesting by using XbaI restriction endonuclease to obtain a fragment with the XbaI restriction site at two ends of the fragment being about 1.3kb in length, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by XbaI to form a recombinant vector pSK-1C with a copy DNA-C molecule, and sequencing by a positive clone company to confirm that no mutation is introduced in the RCA reaction; then, after the correct pSK-1C recombinant vector is sequenced and digested by XbaI and ClaI restriction enzymes, the vector is reconnected to the pSK vector digested by XbaI and ClaI to form a recombinant vector pSK-0.6C with 0.6 copy DNA-C, then the pSK-1C recombinant vector is digested by XbaI to obtain a single copy DNA-C and then is reconnected to the XbaI site of the pSK-0.6C recombinant vector to obtain a recombinant vector pSK-1.6C with 1.6 copy DNA-C, and the direction of the inserted fragment is verified by digesting the positive recombinant vector by the restriction enzymes;

as a result: the specific construction strategy is shown in fig. 8. The infectious clone was successfully constructed as shown by the infectious experiments (FIG. 9) and the virion re-extraction experiments (FIGS. 10-13). The construction of the infectious clone can be successful only by cloning and transfecting fungi by using one bacterial cloning vector pBluescript II SK (+), thereby simplifying the steps of cloning and transfecting, not needing multiple PCR cloning, a plurality of cloning vectors and transfection vectors, and not needing to clone to a binary expression vector to complete the transformation. Meanwhile, the method is the first infectious clone construction of the fungal DNA virus internationally, and provides important reference for the research of DNA fungal viruses by international colleagues in the future.

Example 8 Fusarium graminearum protoplast preparation, transfection and regeneration

Protoplast preparation by inoculating gibberellin on PDA plate to 100m L CMC liquid cultureCulturing in 250m L triangular flask at 25 deg.C and 180rpm for 3-5 days, filtering the culture medium with sterilized three-layer mirror paper, centrifuging at 4000rpm at room temperature for 5min, discarding supernatant, adding sterilized water, resuspending conidium precipitate, and diluting to 10%⁸Spore concentration/m L, 3 × 10⁸Transferring spores into 250M L triangular flask containing 100M L YEPD liquid culture medium, shaking at 25 deg.C and 180rpm for 12-14 hr, filtering overnight culture medium with three layers of sterilized mirror-wiping paper, washing with sterile water for 2-3 times, washing with 1M sucrose for 1-2 times, draining with sterile filter paper, collecting mycelia, transferring mycelia into 20M L protoplast enzymatic hydrolysate with sterile forceps, shaking at 90rpm and 28 deg.C for 2-3 hr, examining protoplast plasmid and quantity every 0.5 hr (enzymolysis digestion time is required in protoplast preparation process, protoplast is released after 1 hr, enzymolysis is completed about 2 hr, and protoplast viability is easily reduced and transfection efficiency is reduced due to overlong enzymolysis time), filtering the mixture with two layers of sterilized mirror-wiping paper, washing with 1M sucrose solution for 2 times, washing as much protoplast as possible, centrifuging at 2600rpm and 4 deg.C for 1min, discarding supernatant, resuspending supernatant, washing with STC buffer solution, centrifuging and washing with 2-10 STC, and centrifuging to obtain protoplast with 2M sucrose buffer solution, and washing⁷Loading into 200 μ L/tube, adding 7% dimethyl sulfoxide (DMSO), mixing, and storing at-80 deg.C;

PEG-mediated transfection by taking protoplasts out of a centrifuge tube of 2m L and thawing them on ice, adding 200. mu. L PH-1 protoplasts and 30ug (about 30. mu. L) of plasmid or virus particles to the centrifuge tube of 2m L, gently flicking the bottom of the tube and mixing them together, standing on ice for 20min, adding 1.25m L PTC one drop at a time to a centrifuge tube of 2m L, pipetting and mixing them with a tip (decapper head) and standing at room temperature for 20min, transferring the protoplasts in a centrifuge tube of 2m L to a centrifuge tube of 15m L, repeatedly washing the centrifuge tube of 2m L with 5m L TB3 (containing 50. mu.g/m L ampicillin) and then to the centrifuge tube of 15m L, shaking them gently overnight (16h) at 25 ℃, centrifuging the protoplast regenerants at 4000rpm for 5min, discarding the supernatant, adding 600. mu. 36 precipitate, placing the protoplasts in the center of a 200. mu. L cm petri dish, adding 20m mycelia, adding the mycelia of the protoplasts and standing on the surface of the culture medium, slowly and continuously shaking the culture medium from the center of the culture dish, and observing the culture medium, and continuously, and observing the culture medium, after shaking the culture medium, the culture is changed from the medium, the medium is left and the medium, and the medium is further, and the medium is left and the medium is moved to the.

As a result: after protoplast preparation, transfection and regeneration, 9 transfectant strains (S, A, B, C, A + B, A + C, B + C, A + B + C and Virion) were obtained, and only three transfectant strains A + B, A + B + C and Virion existed in the presence of virus by Southern blot analysis (FIG. 9). It was shown that DNA-A and DNA-B are required for replication and proliferation of each other, and that DNA-C requires the presence of DNA-A and DNA-B for replication and proliferation.

Example 9 biological Functions of Fusarium graminearum Single Strand circular DNA Virus FgGMTV1

(1) Determination of colony morphology and growth rate of the Strain

Punching a bacterial cake with the virulent strain HB58 and each transfectant strain by using a 5mm puncher, placing the bacterial cake in the center of a PDA culture medium flat plate, and activating the bacterial strain; using a 5mm puncher to punch bacterial colony edge bacterial cakes of the activated strains, transferring the bacterial cakes to the center of a PDA culture medium flat plate, and repeating five times respectively; after dark culture at 25 ℃ for 4 days, the colony morphology was observed and the colony diameter was measured and statistically analyzed.

(2) Conidium morphology observation and yield determination of strain

The bacterial cake with the virulent strain HB58 and each transfectant strain is punched by a 5mm puncher and placed in the center of a PDA culture medium plate to activate the strains, the bacterial colony edge bacterial cake of the activated strains is punched by the 5mm puncher, one bacterial cake is transferred into a triangular flask filled with a 50m L CMC culture medium and is subjected to shaking table culture at 25 ℃ and 180rpm/min for 5 days, a spore suspension is filtered by three layers of mirror paper, a filtrate is taken to observe the spore morphology under a microscope, the spore concentration is measured by a blood counting plate, and each treatment is repeated five times.

(3) Virulence determination of strains

The wheat variety Annong 8455 is planted and used for wheat ear inoculation when the wheat grows to the blooming stage. At this time, the seeds are not grown yetPreparing conidia of the strain HB58 with virus and each transfectant strain according to the above method, and regulating the spore concentration to 3 × 10 after the spore concentration is measured by a blood counting chamber⁵And/m L for standby use, preparing the hypha blocks with the virulent strain HB58 and each transfectant strain according to the method, selecting wheat ears with basically consistent growth vigor, separating the inner glumes and the outer glumes of the wheat ears by fingers when the fifth wheat ear is detected from bottom to top, paying attention to avoid damaging the wheat ears, sucking 10 mu L of prepared spore solution by using a liquid transfer gun, injecting or placing the hypha blocks with consistent size at the root between the inner glumes and the outer glumes, slightly closing and keeping the natural state, marking the inoculated wheat ears by a marker pen, hanging a label on a wheat straw, recording the inoculated strains, the inoculation method, the inoculation date, the inoculators and other information, inoculating at least 15 wheat ears for each strain, spraying water into the interior of the freshness protection package by using a spray can, sleeving the freshness protection package on the inoculated wheat ears, slightly photographing the inoculated wheat ears, keeping the ears in darkness, alternately illuminating at 25 ℃ (16h/18h) for moisture preservation and culturing for 48h, taking down the freshness protection package and continuously culturing for 14d disease, observing the condition of the wheat ears, and cutting down and counting the number of each ear.

As a result: through detection of colony diameter, growth rate, spore yield and pathogenicity, the A + B strain is found to be capable of obviously inhibiting growth, spore yield and pathogenicity of a fungal host, and has potential biological control potential. (FIGS. 14-19)

The above-mentioned embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solution of the present invention by those skilled in the art should fall within the protection scope defined by the claims of the present invention without departing from the spirit of the present invention.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> construction method of fusarium graminearum single-stranded circular DNA virus FgGMTV1/HB58 infectious clone

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>1316

<212>DNA

<213> Fusarium graminearum DNA virus FgGMTV1 DNA-A (Genomoviridae FgGMTV1)

<400>1

ttcttctctt tcttagattt gtgaccgtga cccaagtttg atttatatac tagttatgtg 60

ttgactaagg tacagagagg ggtagtgatc tccacaataa tggcgttagc gtccatccat 120

ttccaatcaa tatcagtgca ggtacggcgt ggatcttcat tggctatgta gatgcacggc 180

ttaccccaca tgacccgctg ttttcctttg tacttgtcgg tagctacgaa ttctcgttgg 240

ccgaaccatt gtttgtaatt tggaaaagag gagaacccac caatcaagtc atcaaacacc 300

gcgtagttta cgttagggtg aaagtcagag agcatgaaca tgcctgggaa gtaggcgtga 360

ttggctagac ttcgcgccca tagagtttta ccgaggcggg aagcgccgaa taaaatgaga 420

cttatgggtc ggtatgatgt gttgttcgtg acgtaattgt caacccagtc tttgagttcg 480

ggatagtcag agtaattgac agtaatttgt ggagattcgt atgtgctctg tggtggaccg 540

aatttccatt cagcaaatga cttgatgttg ttccagcatt tgatggattg gttaggtagt 600

tcggtggcag ccaagtgtaa aaattctttt gcggaagttg attggtcgat gatacgcaac 660

cattctttat ccatgttctt ttggttcaag gatggttggt gtgggggtgt accctcttcc 720

cattggatgt cgttatcttt ttttacgtaa ttgacgacag tgtgtggggt tctggtgaca 780

acttcgatgt tggggtgaac accacagaaa tcgaagtccc gtgcgttgtt tgaagtgtga 840

atagtttcaa cttcccaata cacgtgatgg tggaatccgc catctttgtg ttgttctttt 900

gagatgacga gatagacaag aagtggactt ttttctttga acatttcggc gagtttagtt 960

gcgtcgaact catcaggtgt ttgggaataa gtgaaaagcc attttttaca tcggagtcgg 1020

tatctgtgat cactagttag ttagttggga atagcttcac tttttggcaa ttgagttaag 1080

taagggtcat tgcaccatca tgggggaggg acctccgggg gggccccatg tggggctgta 1140

cccgcgtcag aagcccaagc tctggaataa aaaaaataaa aaatacgtac tggttgcgtt 1200

gtcgtttttg tggctgaggt gtttctgagt cacatgattc ggaagcgcgt ttggacattg 1260

tggctgaaga gtggctttgc ggaggtcaag aaatctaaga aagagaggat ttaaga 1316

<210>2

<211>1320

<212>DNA

<213> Fusarium graminearum DNA virus FgGMTV1 DNA-B (Genomoviridae FgGMTV1)

<400>2

ttcttctctt tcttagattt gtgaccgtga cccaggtttg attttgggta tataagggag 60

gggtagccac catttttgct agtctgtttt tggacttaaa aaatttattt tttaacacaa 120

aacattatta cgtcgacaaa aatggcttct acaaagaaga aatcatacaa caacaagaag 180

gcttataaaa aaaaagaatg gaagtcgaag aagacttggg acaagtctag ttattacgac 240

aattaccagt cgaagatgaa tatttcgaat atgcagacga agagggacaa catgatgtgt 300

gtgacgtcac attgtggtgt tccgaatgcg gcgttactgg agaattctgt tgtgggtgaa 360

attccagcca atatgggagt tcattatatt atgtggtctc ctacgtatcg agaggcggta 420

ccaccgaatc gagcggcaca gttggatcgg caatccgcaa acacattttt tactggttgg 480

aaggataatt tgtcctatca atttaaggga cagattacag ggattcacct gagggttgtg 540

atatctaccc gaagagaagt ggagtccgcg cagcctttta ttgggccggg gaatacgctg 600

tgcagaaact tggcggttcg tgatatgtcg gatgagacat tggaccagtt tttgtcgggt 660

acccgggatg ttgattggac gttggtgaat gtgatggaca cgatgtttga tccggcggtg 720

tgcaaggtgt tgtttcggca gaggaagatt ttaggtgcag ctgatgcgtt gttgaagacg 780

gaggagtttt atcaccgtat ccgtcggcct atggtgtacg gcgataggca ggatggtttg 840

gagtttgtgt ctagtggttg ggctggaagg gagtcggaga acatatacgt cattgatatg 900

tactctttga tttcggcagc cccaccgtta ggtaatttgt tggatggaga gggaaatatt 960

gttttggatg acaagaaacg gcctattccc gtatatgcga agttaaatat tagtggaaat 1020

agtatagtgt attggaggga gtagggtaat tttagtgtag caaaattgag ttggtgatag 1080

cttcattttt ttggatccac tttgtgacaa ttgagttgaa gtaagggtca ttgcaccatc 1140

atgggggagg gacctccggg ggggccccat gtggggctgt acccgcgtca gaagcccaag 1200

ctccggaata aaaaaaaatc aaaagtagac tgtcggttaa agttcggttg ggtaggatta 1260

gtcagcaaat tttcaaccaa tagcggaggt caagaaatct aagaaagaga ggatttaaga 1320

<210>3

<211>1309

<212>DNA

<213> Fusarium graminearum DNA virus FgGMTV1 DNA-C (Genomoviridae FgGMTV1)

<400>3

ttctctttcc taaaagtctg accgtgactc cctttggcct tgacgacgtt attggtggag 60

gattggaatg ttacccgcaa tttcacgtga catgtggaaa tgtggtgaca tgaagaattg 120

tgggacggca caattttaat tgggtggaac acagcagggt aggattaggc agaatgaggc 180

agatttaggc agcggaaatt tatttttaaa ttggagcatt gtctaaatct agaagtacat 240

ggtaccagtc atcatcgttt ggttgatgat ctggtatgtc cacccaatca ggatcattta 300

aattatgtac aattgaattg ttatgatttg taaaaaaaaa agataggtaa tcgcataacg 360

tgtttttgtt gaataaaata atacacgtgt ttgcgtattg ttgtaccatg tcatgtgggt 420

cgggattgtt gtggagatga cacgtgttag tgctggtatg aactcgcagg agtgtagtac 480

cagtcgacaa aggcttggat gtgttggcgg tgtcgttgga gtagtgtagg gtgagtttcc 540

tcgaaacgac taagaaacgc cccttgattt ggctcggaga aaagttgttg ccagaagggg 600

tcagatgtggctgagcaaag atctgcatcc ccgaactgag ccacaagcac ctctttagac 660

tggatgctct cgtataccgg gcctgcatgt gtgtatattg gcagaataga aggcataact 720

ccgctgtaag cgagttgtag gcttcgttgg aggggaatgt ttccagtatc gatgtagata 780

tcgagatcac agttcccatt agttcttgta ttgtaaccgg cgatgaatct ctttggattg 840

atgtccattt ggagttgaga agtgaaatta tctgattgtt ttgggtcgac atctttatat 900

tgtaaaaaat atttgtaact gtaaataatt agttggtgat agcttcattt tttttactcc 960

actttgtgac aattgagtta agtaagggtc attgcaccat catgggggag ggacctccgg 1020

gggggcccca tgtggggctg tacccgcgtc agaagcccaa gctctttgtt gagccgagcg 1080

cagcggtaat ttggagtcac gtgaggtaaa ataaaatgtg gacttacgtt cttggaattg 1140

atgattgaga cattttgaaa aagtgttgga gtggttgggg tatttatggt caaggacatg 1200

tttggtggtg tcattggtta atataggtac tgtcggtaga tagttgttgc ggttgaagta 1260

taatgcgtgg agcaccgagg tcagaacttt taggaaagac gatttaaga 1309

<210>4

<211>19

<212>DNA

<213> primer DNA-A-1F (Artificial sequence)

<400>4

ggttctggtg acaacttcg 19

<210>5

<211>22

<212>DNA

<213> primer DNA-A-1R (Artificial sequence)

<400>5

ccacacactg tcgtcaatta cg 22

<210>6

<211>21

<212>DNA

<213> primer DNA-B-1F (Artificial sequence)

<400>6

ttgatccggc ggtgtgcaag g 21

<210>7

<211>20

<212>DNA

<213> primer DNA-B-1R (Artificial sequence)

<400>7

acatcgtgtc catcacattc 20

<210>8

<211>20

<212>DNA

<213> primer DNA-C-1F (Artificial sequence)

<400>8

ctttagactg gatgctctcg 20

<210>9

<211>19

<212>DNA

<213> primer DNA-C-1R (Artificial sequence)

<400>9

aggtgcttgt ggctcagtt 19

Claims (4)

1. A construction method of Fusarium graminearum single-stranded DNA virus FgGMTV1/HB58 infectious clone is characterized in that: the virus FgGMTV1/HB58 is present in Fusarium graminearum strain (Fusarium graminearum Schw.) HB58, and the deposit number of the Fusarium graminearum strain HB58 is as follows: CGMCC No. 17181;

the virus FgGMTV1/HB58 consists of 3 single-stranded circular DNA molecules DNA-A, DNA-B and DNA-C;

the derivative virus of the virus FgGMTV1/HB58 only comprises two single-stranded circular DNA molecules, namely DNA-A and DNA-B, and the genome sequence of the virus is shown as SEQ ID NO: 1-2; and does not contain a single-chain circular DNA molecule DNA-C, and the genome sequence of the DNA-C is shown as SEQ ID NO. 3;

the construction method comprises the steps of DNA-A infectious clone construction, DNA-B infectious clone construction and DNA-C infectious clone construction.

2. The method of constructing an invasive clone according to claim 1, wherein: the specific steps of the construction of the DNA-A infectious clone comprise: extracting FgGMTV1/HB58 virus particles in fusarium graminearum strain HB58, extracting nucleic acid from the virus particles, carrying out RCA rolling circle amplification reaction on the extracted nucleic acid, digesting the nucleic acid by EcoRI and KpnI restriction enzymes to obtain a fragment which is about 1.3kb long and has EcoRI digestion sites at two ends, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by EcoRI to form a recombinant vector pSK-1A with a copy of DNA-A molecules, sequencing the positive clone by a company, and confirming that no mutation is introduced in the RCA reaction; then, the correct pSK-1A recombinant vector was sequenced, digested with EcoRI restriction enzyme and then ligated to the EcoRI-digested pSK vector to form a recombinant vector pSK-2A with two copies of DNA-A, and the positive recombinant vector was digested with restriction enzyme to verify the orientation of the insert.

3. The method of constructing an invasive clone according to claim 1, wherein: the specific steps of the construction of the DNA-B infectious clone comprise: extracting virus particles of FgGMTV1/HB58 in fusarium graminearum strain HB58, extracting nucleic acid from the virus particles, carrying out RCA rolling circle amplification reaction on the extracted nucleic acid, digesting the nucleic acid by EcoRI and SpeI restriction enzymes to obtain a fragment which is about 1.3kb long and has EcoRI digestion sites at two ends, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by EcoRI to form a recombinant vector pSK-1B with a copy of DNA-B molecules, sequencing the positive clone by a company, and confirming that no mutation is introduced in the RCA reaction; then, the correct pSK-1B recombinant vector was sequenced, digested with EcoRI restriction enzyme, and then re-ligated to the EcoRI-digested pSK vector to form a recombinant vector pSK-2B with two copies of DNA-B, and the positive recombinant vector was digested with restriction enzyme to verify the orientation of the insert.

4. The method of constructing an invasive clone according to claim 1, wherein: the specific steps for constructing the DNA-C infectious clone are as follows: extracting FgGMTV1/HB58 virus particles in fusarium graminearum strain HB58, extracting nucleic acid from the virus particles, carrying out RCA rolling circle amplification reaction on the extracted nucleic acid, digesting the nucleic acid by using XbaI restriction endonuclease to obtain a fragment with the XbaI restriction site at two ends and the length of about 1.3kb, then connecting the fragment to a pBluescript II SK (+) (pSK) vector digested by XbaI to form a recombinant vector pSK-1C with a copy of DNA-C molecules, and sending a positive clone to a company for sequencing to confirm that no mutation is introduced in the RCA reaction; then, the correct pSK-1C recombinant vector was sequenced, digested with XbaI and ClaI restriction enzymes, and then religated to the pSK vector digested with XbaI and ClaI to form a recombinant vector pSK-0.6C with 0.6 copies of DNA-C, then the pSK-1C recombinant vector was digested with XbaI to obtain a single copy of DNA-C, and religated to the XbaI site of the pSK-0.6C recombinant vector to obtain a recombinant vector pSK-1.6C with 1.6 copies of DNA-C, and the positive recombinant vector was digested with restriction enzymes to verify the orientation of the insert.

Images