CN111560459B - Molecular marker linked with capsicum fruit stratum corneum deficiency gene and application thereof - Google Patents
Molecular marker linked with capsicum fruit stratum corneum deficiency gene and application thereof Download PDFInfo
- Publication number
- CN111560459B CN111560459B CN202010480619.2A CN202010480619A CN111560459B CN 111560459 B CN111560459 B CN 111560459B CN 202010480619 A CN202010480619 A CN 202010480619A CN 111560459 B CN111560459 B CN 111560459B
- Authority
- CN
- China
- Prior art keywords
- fruit
- cuticle
- capsicum
- molecular marker
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a molecular marker linked with a capsicum fruit cuticle synthesis gene and application thereof. Construction of F Using wild-type and mutant Capsici fructus Material 2 A population. Acquisition by means of BSA population localizationA chromosome region closely linked to the capsicum fruit cuticle synthesis gene, and developing a molecular marker in the candidate region. 1 KASP molecular marker was designed based on single base mutation, and the marker pair F was used 2 The genotype identification is carried out on 182 single plants in the population, and the coincidence rate reaches 100%. The research result is not only helpful for the identification and auxiliary breeding of the capsicum lacking the fruit cuticle, but also provides a basis for the map cloning of the fruit cuticle synthesis gene and the analysis of the molecular mechanism of cuticle synthesis, and has wide popularization value.
Description
Technical Field
The invention belongs to the field of pepper breeding molecular biology, and relates to a molecular marker linked with a pepper (Capsicum annuum L) fruit cuticle synthesis gene and application of the molecular marker in pepper fruit cuticle identification and breeding.
Background
In the ancient times, about 4.5 hundred million years ago, plants began to colonise arid habitats, where the greatest challenge for terrestrial plants was desiccation, so the most critical evolutionary innovation that allowed plants to colonize the land was the development of specialized epidermal cell walls in the form of hydrophobic skin or stratum corneum to limit transpiration moisture loss. Thus, the stratum corneum is present on the outer surface of almost all terrestrial plant ground organs. In addition to preventing water loss, the cuticle layer, which is the primary protective barrier of plants, also plays other important physiological roles, such as resistance to biotic stresses such as insect pests, protection against abiotic stresses such as osmotic stress and radiation, and the like. The plant cuticle is complex in structure and contains a number of components, which in general consist essentially of two lipid components: a predominantly aliphatic organic solvent-soluble compound, known as a wax; the other is a structurally complex esterified oxygen-containing fatty acid polymer, known as cutin. Together, these components form an elastic barrier against environmental stresses, such as desiccation, pests and pathogens.
The current research reports on the stratum corneum related genes are relatively few, and most of the research reports are focused on two mode plants of arabidopsis and tomato. The most waxy mutants of the horny layer in Arabidopsis are cer mutants. The cer1, cer2 and cer6 mutants are gloss type, the gene pleiotropic results of both the cer1 mutant and the cer6 mutant are reduced fertility, but one gene function is related to the transportation (or secretion) of waxy components, and the other is encoding fatty acid metabolizing enzyme; gene pleiotropic outcome of cer2 variants is blocking C 28 Is related to the growth regulation of Arabidopsis thaliana; the cer3 and cer10 mutants show micro powdery wax, and the gene pleiotropic results are that the carbon chain elongation and flower organ fusion are blocked so as to reduce fertility; cer13 mutant presents semi-powdery wax, which also causes fusion of flower organs and reduces fertility. In tomatoes, the SlSHN3 gene belongs to the AP2 (APETALA 2) family and is effectively expressed in the outer epidermis of tomato fruits in the green ripening stage, and the SlSHN3 silencing expression can reduce the content of wax and cutin in the cuticle of tomatoes; the CD2 cutin mutant gene of the HD-Zip IV family member plays a key regulatory role in biosynthesis of tomato fruit cutin; the FUL1/2 and TAGL1 genes belong to MADS-box families, the metabolism of lipid and stratum corneum of tomato fruits is changed after the FUL1/2 is silenced, and the number and components of the stratum corneum are increased by the overexpression of the TAGL1 genes.
The Capsicum (Capsicum Annuum l.) belongs to the genus Capsicum of the family solanaceae, is a perennial herb for one year or a limited number, is one of the main vegetable crops worldwide and favorite vegetables of people, and occupies an important position in the whole vegetable production, and is ranked fourth in the family solanaceae, and is next to tomatoes, potatoes and eggplants, particularly in China, because of the ultrahigh planting benefit, the Capsicum becomes a main crop for farmers to bring about enrichment, so the planting area of the Capsicum is still expanding continuously. At present, the capsicum has more researches on fruit development, new variety breeding, disease and insect resistance research, facility cultivation, capsorubin, capsaicin and extract antioxidation, but the research on fruit cuticle is still lacking, so that the capsicum fruit cuticle lack mutant as an important germplasm resource is favored by future breeders. Through developing molecular markers linked with pepper fruit cuticle synthesis genes, the cuticle synthesis genes and other excellent character genes are rapidly introduced into plants by adopting technologies such as hybridization, backcrossing and the like, so that gene resources are provided for breeding high-quality new varieties. The development of molecular markers linked with the cuticle synthesis genes is beneficial to the breeding of capsicum with optimal thickness of fruit cuticle, and lays a foundation for cloning capsicum fruit cuticle synthesis genes and researching the molecular mechanism of cuticle synthesis.
Disclosure of Invention
The primary aim of the invention is to provide a molecular marker paper_200104484 linked to a capsicum fruit cuticle synthesis gene aiming at the phenomenon of cuticle deficiency occurring in the surface of capsicum fruits. Provides a new way for screening, identifying and assisting in screening the capsicum fruit cuticle deficiency character, breeding the capsicum fruit cuticle deficiency and the like.
A molecular marker linked with capsicum fruit cuticle synthesis gene specifically comprises mutation of G to A at 200104484bp of capsicum whole genome chromosome 12.
Genotype corresponding to the molecular marker: g is the genotype with fruit cuticle, A is the genotype without fruit cuticle.
The primer designed aiming at the mutation of capsicum fruit cuticle synthesis comprises two forward primers and one reverse primer,
forward primer X: CTTAGAAGGAGAGGCTGACAAGTG, shown in SEQ ID No. 1;
forward primer Y: CTTAGAAGGAGAGGCTGACAAGTA, SEQ ID No. 2.
The two forward primers were each ligated to a different fluorescent linker sequence (FAM or HEX linker sequence from LGC Co.)
Preferably:
FAM: GAAGGTGACCAAGTTCATGCT, shown in SEQ ID No. 3;
HEX: GAAGGTCGGAGTCAACGGATT, SEQ ID No. 4.
The primer sequences after the different fluorescent linker sequences were ligated respectively were as follows:
Paper_200104484F-1：
GAAGGTGACCAAGTTCATGCTCTTAGAAGGAGAGGCTGACAAGTG, see
SEQ ID No. 5;
Paper_200104484F-2：
GAAGGTCGGAGTCAACGGATTCTTAGAAGGAGAGGCTGACAAGTA, see
SEQ ID No. 6;
paper_200104484C (reverse primer):
CGCTGACGAGAACTAGACATCTG, SEQ ID No. 7.
The second purpose of the invention is to provide the application of the molecular marker, which is favorable for breeding of capsicum fruit cuticle, and lays a foundation for cloning cuticle synthesis genes and researching molecular mechanisms of capsicum with deficiency of fruit cuticle. The method comprises the following steps:
1. the molecular markers are used for identifying and assisting in screening the capsicum annuum with deficient fruit cuticle.
2. The molecular marker is used for breeding capsicum with deficient fruit cuticle.
3. When the molecular marker is applied, the detection is carried out by adopting a PCR reaction.
When the molecular marker is applied, the method specifically comprises the following steps: (1) Taking genomic DNA of a sample to be detected as a template, and carrying out PCR (polymerase chain reaction) amplification by using a molecular marked amplification primer to obtain an amplification product; (2) detecting and analyzing the amplified product.
When the amplified product is subjected to fluorescence detection, if the sample PCR product only detects a fluorescence signal corresponding to the primer paper_200104484F-1, the detection site is G genotype, and the single plant of the capsicum fruit with the cuticle phenotype is judged; if the sample PCR product only detects a fluorescent signal corresponding to the primer paper_200104484F-2, the detection site is A, the genotype is A, and the single plant with the pepper fruit cuticle lack phenotype is judged; if two fluorescent signals are detected simultaneously, the detection site is A G genotype, and the single plant of the capsicum fruit with the cuticle phenotype is judged.
When the molecular marker is applied, the TouchDown PCR is adopted, and the amplification program is as follows: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s;57 ℃ 60s,26 cycles.
The invention utilizes a BSA positioning method to position a gene for controlling the synthesis of capsicum fruit cuticle, and develops a KASP molecular marker related to the capsicum fruit cuticle synthesis gene according to the mutation site of the gene. Can be directly used for identifying the horny layer of the capsicum fruit and the corresponding genotype, and further relies on the molecular marker for auxiliary breeding, so that the problems of long conventional breeding period and easiness in environmental influence can be effectively solved. The molecular marker can be used for rapidly screening satisfactory plants in early stage, so that the planting scale is effectively reduced, and the workload of later stage identification is reduced. The efficiency and the accuracy of selection are improved. The method can be used for identifying various types of capsicum, so that the method has great significance in researching the formation mechanism of capsicum fruit cuticle and theoretical research.
Drawings
FIG. 1 is a diagram of 2 parents for BSA population localization: 8214 (A), 228 (B).
FIG. 2 shows BSA localization results for 8214 and 228 constructed populations;
chr01-Chr12 represents chromosome number, and the fruit cuticle synthesis gene is located between 178188036 and 213115045 on chromosome 12 of capsicum annuum.
FIG. 3 shows F of the paper_200104484 molecular marker constructed by WT and MT 2 Partial results of genotyping in the population;
the A represents: the PCR product is a fluorescent signal corresponding to a primer paper_200104484F-2, and is a homozygous single plant without a cuticle on the surface of the fruit;
and B represents: the PCR product is a fluorescent signal corresponding to the primer paper_200104484F-1, and is a homozygous single plant with a cuticle on the surface of the fruit;
and C represents: the PCR product has two fluorescence signals of primer paper_200104484F-1 and F-2, and is a heterozygous single plant with a cuticle on the surface of the fruit;
FIG. 4 shows the fine localization of mutation in fruit cuticle genes according to the present invention.
Detailed Description
The invention will be further illustrated with reference to specific examples, but the invention is not limited to the examples. The materials, reagents, instruments and methods used in the examples below, without any particular description, are conventional in the art and are commercially available. The capsicum germplasm related to the invention is provided by Hunan province vegetable institute, and can be sold for at least 20 years.
Example 1 acquisition of molecular marker BSA molecular marker linked to the Capsicum fruit cuticle synthetic Gene
BSA positioning method
1. Construction of populations
The backbone pepper parent 8214 (shown in figure 1A) obtained by multi-generation selfing and the stable fruit cuticle deficiency mutant material 228 'obtained by subjecting the backbone pepper parent 8214' to EMS mutagenesis screening and continuous selfing for multiple generations are used as parents (shown in figure 1B), and the backbone parent and the fruit cuticle deficiency parent are hybridized to obtain F 1 Instead of F 1 F is obtained after the selfing of the generation 2 A population.
2. Identification of fruit cuticle
Wait F 2 And (5) observing and identifying whether the cuticle on the surface of the fruit exists or not in the green mature period of the fruit of the generation group so as to determine the cuticle of the single plant fruit in the group.
3. Initial localization of stratum corneum synthetic gene
F at 8214X 228 2 And selecting 25 wild plant leaves with fruits and 25 mutant plant leaves without horny layer from the population, respectively constructing two DNA pools, and carrying out pool mixing sequencing to generate 120Gb sequence data. Reads were aligned to the capsicum reference genome by bwa software and SNP sites of the whole genome were found using SAMtools software. Analysis revealed that the sequencing depths of the wild-type pool and the mutant pool were 19.51×, and 18.78×, respectively, each covering 88% or more of the whole genome. The base matrix value is greater than or equal to 20, the mapping mass value is greater than or equal to 20, and the base depth is greater than or equal to twoF (F) 2 And 2 or more and 60 or less in the mixed pool, and simultaneously 2 or more and 60 or less in the two parents, 4713 different SNP are obtained in total. The SNP data obtained in the mutants were filtered. Finally 3553 differential SNPs were obtained, 10 SNPs were used as windows, 4 SNPs were used as steps, and as shown in FIG. 2, SNPindex differences between the recessive pool and the dominant pool should be above 0.5 or close to 1, and SNPindex showed random distribution above and below 0.5 in the genomic region without trait association, since SNPs associated with the target trait are inherited in linkage with SNPs around the chromosome. The distribution of SNPicdex values was observed, and it was found that there were two regions of SNPicdex values above 0.5 and close to 1 on the whole genome, lying between 178188036 and 213115045 on chromosome 12, i.e. locating genes controlling the synthesis of the stratum corneum within the interval 178188036 to 213115045 on chromosome 12.
4. Fine localization of stratum corneum synthetic genes
Obtaining a chromosomal region for controlling the synthesis of the horny layer by the step 3, analyzing DNA sequence variation in the region to further narrow down a candidate region for controlling the synthesis of the horny layer, developing a KASP marker, and using the developed KSAP molecular marker pair F 2 Genotyping the individual plants of the population, and determining the exchange individual plants. Based on the phenotypic survey data of the fruits and the determined genotype of the crossover individual, we mapped the cutin synthesis gene in the interval 199129445 to 201017286.
Finally, mutation from the position G to the position A at 200104484bp on the genome 12 of the capsicum annuum is obtained through sequencing, and is shown in fig. 4.
F constructed by using paper_200104484 to mark pair 8214 and 228 2 The 182 individuals of the population were genotyped. There are 3 fluorescent signals, 46 individuals for A, 96 individuals for A and 40 individuals for G. The phenotype investigation data are combined to find that the genotype is highly consistent with the phenotype of the fruit cuticle, and the coincidence rate reaches 100%. The result fully shows that the paper_200104484 marker has universality and accuracy and can be applied to prediction, identification and screening of pepper fruit cuticle deficiency plants.
When the molecular marker is applied, the method specifically comprises the following steps: (1) Taking genomic DNA of a sample to be detected as a template, and carrying out Touchdo-wnPCR amplification by using a molecular marked amplification primer to obtain an amplification product; (2) detecting and analyzing the amplified product.
Paper_200104484F-1
GAAGGTGACCAAGTTCATGCTCTTAGAAGGAGAGGCTGACAAGTG
Paper_200104484F-2
GAAGGTCGGAGTCAACGGATTCTTAGAAGGAGAGGCTGACAAGTA
Paper_200104484C
CGCTGACGAGAACTAGACATCTG。
The primer has specificity through sequencing verification of the whole genome sequence of the capsicum.
When the amplified product is subjected to fluorescence detection, if the sample PCR product only detects a fluorescence signal corresponding to the primer paper_200104484F-1, the detection site is G genotype, and the single plant of the capsicum fruit with the cuticle phenotype is judged; if the sample PCR product only detects a fluorescent signal corresponding to the primer paper_200104484F-2, the detection site is A, the genotype is A, and the single plant with the pepper fruit cuticle lack phenotype is judged; if two fluorescent signals are detected simultaneously, the detection site is A G genotype, and the single plant of the capsicum fruit with the cuticle phenotype is judged.
When the molecular marker is applied, the TouchDown PCR is adopted, and the amplification program is as follows: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s;57 ℃ 60s,26 cycles.
The sample to be measured is a blade.
Table 1 shows F constructed by paper_200104484 marked 8214 and 228 2 Part of the group is the type and genotype of the cuticle of the single plant fruit.
The identification result shows that the materials (marked by letter A in figure 3) of A fluorescent signals corresponding to the primer paper_200104484F-2 are reserved and detected through molecular marker identification and screening in breeding, so that the materials lacking the horny layer of the capsicum fruits can be bred. The material (the region corresponding to the letter B in figure 3) of the G:G fluorescent signal corresponding to the primer paper_200104484F-1 is remained, so that the fruit can be bred to have the stratum corneum homozygous material. The heterozygote material with the horny layer of the fruits can be bred by reserving materials (corresponding to the letter C in figure 3) with the detected A: G fluorescent signals corresponding to the paper_200104484F-1 and F-2, and the workload of later screening and identification can be reduced by screening of the early molecular markers, so that the breeding process is accelerated.
Sequence listing
<110> Hunan province vegetable institute
<120> molecular marker linked with capsicum fruit stratum corneum deficient gene and application thereof
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cttagaagga gaggctgaca agtg 24
<210> 2
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
cttagaagga gaggctgaca agta 24
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gaaggtgacc aagttcatgc t 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gaaggtgacc aagttcatgc tcttagaagg agaggctgac aagtg 45
<210> 6
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
gaaggtcgga gtcaacggat tcttagaagg agaggctgac aagta 45
<210> 7
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
cgctgacgag aactagacat ctg 23
Claims (8)
1. A molecular marker linked with a capsicum fruit cuticle synthesis gene is characterized in that the primer of the molecular marker comprises two forward primers and one reverse primer for the mutation of G to A at a 200104484bp position on a capsicum genome 12,
forward primer X: CTTAGAAGGAGAGGCTGACAAGTG
Forward primer Y: CTTAGAAGGAGAGGCTGACAAGTA;
reverse primer: CGCTGACGAGAACTAGACATCTG;
genotype corresponding to the molecular marker: g is the genotype with fruit cuticle, A is the genotype without fruit cuticle.
2. The molecular marker of claim 1, wherein: the two forward primers are respectively connected with different fluorescent joint sequences:
FAM：GAAGGTGACCAAGTTCATGCT；
HEX：GAAGGTCGGAGTCAACGGATT。
3. use of a molecular marker according to any one of claims 1-2, characterized in that: is used for identifying and assisting in screening the capsicum with deficient fruit cuticle.
4. A use according to claim 3, characterized in that: is used for breeding the capsicum mutant with deficient fruit cuticle.
5. The use according to claim 4, characterized in that: detection was performed using a PCR reaction.
6. The use according to claim 5, characterized in that: the method specifically comprises the following steps:
(1) Taking genomic DNA of a sample to be detected as a template, and carrying out touch-hDown PCR amplification by using a molecular marked amplification primer to obtain an amplification product;
(2) And detecting and analyzing the amplified product.
7. The use according to claim 6, characterized in that: when the amplified product is subjected to fluorescent detection, if the amplified product is G, judging that the wild homozygous single plant has a cuticle on the surface of the fruit; if the genotype A is A, determining that the fruit surface does not have a mutation homozygous single plant of a horny layer; if the genotype A is G, the heterozygous individual plant with the cuticle on the surface of the fruit is judged.
8. The use according to claim 7, using Touchdown PCR;
the Touchdown PCR amplification procedure was: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s;57 ℃ 60s,26 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010480619.2A CN111560459B (en) | 2020-05-30 | 2020-05-30 | Molecular marker linked with capsicum fruit stratum corneum deficiency gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010480619.2A CN111560459B (en) | 2020-05-30 | 2020-05-30 | Molecular marker linked with capsicum fruit stratum corneum deficiency gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111560459A CN111560459A (en) | 2020-08-21 |
| CN111560459B true CN111560459B (en) | 2023-05-02 |
Family
ID=72069437
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010480619.2A Active CN111560459B (en) | 2020-05-30 | 2020-05-30 | Molecular marker linked with capsicum fruit stratum corneum deficiency gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111560459B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113981126B (en) * | 2021-11-10 | 2022-09-02 | 北京市农林科学院 | SNP molecular marker KQ8-4472 linked with gene for controlling Vc content of pepper fruits, application and special primer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108697752A (en) * | 2015-12-16 | 2018-10-23 | 先正达参股股份有限公司 | With the relevant genetic region of the increased yield of plant and gene |
| CN109207622A (en) * | 2018-10-24 | 2019-01-15 | 湖南省蔬菜研究所 | A kind of molecular labeling and application with the stagnant green gene linkage of capsicum |
-
2020
- 2020-05-30 CN CN202010480619.2A patent/CN111560459B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108697752A (en) * | 2015-12-16 | 2018-10-23 | 先正达参股股份有限公司 | With the relevant genetic region of the increased yield of plant and gene |
| CN109207622A (en) * | 2018-10-24 | 2019-01-15 | 湖南省蔬菜研究所 | A kind of molecular labeling and application with the stagnant green gene linkage of capsicum |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111560459A (en) | 2020-08-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Louarn et al. | Sunflower resistance to broomrape (Orobanche cumana) is controlled by specific QTLs for different parasitism stages | |
| US7288386B2 (en) | Method of determining soybean sudden death syndrome resistance in a soybean plant | |
| US20220000063A1 (en) | Anthracnose Resistant Alfalfa Plants | |
| CN111394508B (en) | Molecular marker linked with capsicum frutescens gene and application thereof | |
| US8030561B2 (en) | Rice plant and method for producing the same | |
| Zhang et al. | Bulked-segregant analysis identified a putative region related to short internode length in melon | |
| Gogorcena et al. | Genomic-based breeding for climate-smart peach varieties | |
| CN113736910B (en) | Linkage molecular marker of peanut single plant pod number major QTL locus qPN and application thereof | |
| NL2002357C2 (en) | Methods for improving the yield of cucumber plants. | |
| CN111560459B (en) | Molecular marker linked with capsicum fruit stratum corneum deficiency gene and application thereof | |
| CN110305980A (en) | A kind of selection of anti-clubroot high oleic acid rape and its application | |
| CN102149274A (en) | CVYV-resistant plants of the species cucumis melo | |
| CN110167339A (en) | Fecund is bloomed watermelon | |
| CN113943732A (en) | SNP (Single nucleotide polymorphism) marker related to heat resistance of cucumber in adult stage, primer group, kit and application | |
| JP4298538B2 (en) | Genetic markers linked to loci involved in dormancy and their use | |
| CN111763764B (en) | CAPS marker for detecting melon epidemic disease resistance and application thereof | |
| WO2023074911A1 (en) | Spinach plant having novel downy mildew resistance gene | |
| CN106480061A (en) | Recombinant nucleic acid fragment RecCR023411 and its detection method | |
| JP2005229854A (en) | Gene marker connected to gene locus controlling efflorescent or cleistogamic property and its utilization | |
| Rauf et al. | GENETIC ENHANCEMENT OF SOYBEAN (GLYCINE MAX L.) GERMPLASM FOR ADAPTABILITY AND PRODUCTIVITY. | |
| KAMAU | IDENTIFICATION OF NEW MOLECULAR MARKERS FOR DIVERSITY ANALYSIS AND BREEDING FOR EARLY MATURITY AND DETERMINATE LABLAB (LABLAB PURPUREUS) VARIETIES | |
| Borjas et al. | Phenotypic and genotypic characterization of awns in elite US rice breeding germplasm | |
| CN115811936A (en) | Cucumis melo plants with resistance to scab, aphids and powdery mildew | |
| JP4326981B2 (en) | Genetic markers linked to loci controlling spikelet loss and their use | |
| JP2005229847A (en) | Gene marker connected to gene locus participating on number of ears and its utilization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230201 Address after: 410128, No. 1, Nongda Road, Furong district, Hunan, Changsha Applicant after: Hunan Agricultural University Address before: 410125 Hunan province Changsha Furong District academy of Agricultural Sciences Applicant before: HUNAN VEGETABLE Research Institute |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |