CN111560430B

CN111560430B - Reagent for detecting rs1766 site polymorphism and application thereof

Info

Publication number: CN111560430B
Application number: CN202010555343.XA
Authority: CN
Inventors: 周智广; 谢志国; 黄干; 李霞; 罗说明; 林健; 肖扬; 夏影
Original assignee: Second Xiangya Hospital of Central South University
Current assignee: Second Xiangya Hospital of Central South University
Priority date: 2020-06-17
Filing date: 2020-06-17
Publication date: 2023-05-23
Anticipated expiration: 2040-06-17
Also published as: CN111560430A

Abstract

The invention belongs to the fields of molecular biology and medicine, and relates to a reagent for detecting rs1766 site polymorphism and application thereof. The detection result of the locus genotype is used for predicting the disease risk of type 1 diabetes (T1 DM), latent Autoimmune Diabetes (LADA) of adults or type 2 diabetes (T2 DM). The invention also discloses a corresponding detection kit, which contains a primer for amplifying the rs1766 locus and a sequencing primer for detecting the locus genotype. The method for detecting the genotype of the rs1766 locus is simple, easy, quick and efficient, has low cost and provides a simple and novel approach for diagnosis and treatment of diabetes.

Description

Reagent for detecting rs1766 site polymorphism and application thereof

Technical field:

the invention relates to the field of molecular biology and medicine, in particular to a detection reagent for a single nucleotide polymorphism site rs1766 of a human HLA gene and application thereof in preparing a diabetes-related risk assessment reagent.

The background technology is as follows:

diabetes is a heterogeneous group of diseases characterized by elevated blood glucose levels. Type 1 diabetes and type 2 diabetes exhibit significantly different pathophysiological processes. Type 1 diabetes (T1 DM) is an organ-specific autoimmune disease mediated by T lymphocytes that destroys islet beta cells resulting in absolute deficiency of insulin, which not only results in excessive glucose production and reduced glucose uptake by cells, but also results in increased lipolysis and fatty acid oxidation, leading to diabetic ketoacidosis. In contrast, the characteristics of type 2 diabetes mellitus (T2 DM) include peripheral tissue insulin resistance, with relatively little or no insulin deficiency, and although its specific cause is unknown, T2DM is not associated with autoimmunity of islet cells. However, in some studies, around 10% of patients with T2DM phenotype have demonstrated islet autoimmunity at the time of diagnosis, a special subtype called latent autoimmune diabetes in adults. Latent autoimmune diabetes in adults (LADA) is an autoimmune diabetes that is developed by adults, has diabetes-related autoantibodies, and does not require insulin treatment for a period of time after diagnosis, and is one of the most common autoimmune diabetes in adults.

Diabetes is considered to be a complex genetic disease caused by the combined action of genetic factors and environmental factors. More and more researchers focus their eyes on the effects of genetic factors on the development of diabetes. HLA genes, also known as the major histocompatibility complex in humans, are located on the short arm of chromosome 6, with approximately 60 loci on the whole complex, and genes of the whole complex can be classified into three classes according to the nature of the coding molecule: class I, class II, class III. The II type gene region is located at the near end of the centromere and is a region with the most complex structure, and mainly comprises three subregions of DR, DQ and DP, each subregion is provided with a plurality of sites, wherein the rs1766 site studied by the invention is one site of the DQ subregion on the II type gene. So far, studies have supported the existence of the same susceptibility gene between LADA and T1DM, but the genetic susceptibility gene has less effect on LADA than T1 DM.

In recent years, the incidence rates of global T1DM and LADA are gradually increased year by year, and the incidence rates of diabetes mellitus are greatly different from country to country. The large population base, the increasing incidence rate and the serious clinical outcome make diabetes one of the major public health problems in China. In order to finally realize the treatment of LADA and T1DM, there is an urgent need in the art to find the susceptibility genes of LADA and T1DM and develop methods, kits and related therapeutic drugs for detecting LADA and T1DM susceptibility genes to achieve the purposes of early diagnosis and treatment of LADA and T1 DM.

Disclosure of Invention

The primary purpose of the invention is to provide an application of a reagent for detecting rs1766 locus polymorphism in preparation of a preparation for predicting diabetes risk. The polymorphic locus is found to be related to the risk of diabetes mellitus for the first time, and the locus genotype is used for judging the risk of LADA or T1DM, so that the prediction accuracy is high and the reliability is high.

Further, the diabetes typing method of the invention comprises the following steps: t1DM or LADA.

Further, the rs1766 locus polymorphism is: GG, AG or AA.

The invention discovers that the number of normal persons in the crowd carrying the rs1766 AA genotype is far higher than that of LADA or T1DM patients, and indicates that the risk of the AA genotype suffering from LADA or T1DM is low, and the other two genotypes GG and AG take the AA genotype as a reference.

The rs1766 genotype frequency comparison test is carried out on about 500 cases of T1DM cases and normal controls, and the invention finds that: the risk of suffering from T1DM is obviously increased for the crowd carrying the rs1766 GG genotype, and the ratio is 20.791 times of the AA genotype than OR= 20.791; the ratio of AG genotypes was or= 2.366, 2.366 times the risk of AA genotypes, and p values were all less than 0.05, with significant differences.

Similarly, the rs1766 genotype frequency comparison test is carried out on about 500 cases of LADA cases and normal controls respectively, so that the risk of developing LADA of people carrying the rs1766 GG genotype is obviously increased, and the ratio of the risk to the LADA is 6.598 times of the AA genotype than the ratio of OR= 6.598; the ratio of AG genotypes was or= 1.944, 1.944 times the risk of AA genotypes, and p values were all less than 0.05, with significant differences.

Further, the invention concludes that the risk of diabetes is: GG > AG > AA, specifically should be at risk of developing LADA or T1 DM: GG > AG > AA.

The reagent for detecting the rs1766 site polymorphism can predict the following situations:

(1) For predicting the risk of LADA or T1DM for an average person who does not develop clinical symptoms of diabetes.

(2) For predicting the risk of LADA or T1DM in a person who develops clinical symptoms of diabetes but has not yet been diagnosed with diabetes.

(3) For predicting the risk of diagnosing diabetes, but not specifically which diabetic patient is suffering from LADA or T1 DM.

The second object of the invention is to provide an application of a reagent for detecting rs1766 locus polymorphism in preparation of a reagent for predicting diabetes typing disease risk. The polymorphic site can be used for predicting and distinguishing LADA or T1DM and T2DM for the first time, and the standard for judging the site is genotype, so that the prediction accuracy is high and the reliability is high.

Further, the diabetic typing includes: t1DM, T2DM and LADA.

Further, the rs1766 locus polymorphism is: GG, AG or AA.

Because the number of T2DM patients in the crowd carrying rs1766 AA genotype is far higher than that of LADA or T1DM patients, the probability that the AA genotype suffers from LADA or T1DM but not T2DM is low, and the other two genotypes GG and AG take the AA genotype as a reference.

The genotype frequency comparison test is carried out on about 500 cases of the T1DM cases and the T2DM cases respectively, and the genotype frequency comparison test shows that:

the probability of suffering from T1DM instead of T2DM is obviously increased for the crowd carrying the rs1766 GG genotype, the ratio is 9.604, the probability of suffering from T1DM instead of T2DM is 9.604 times of that of the AA genotype, and the p value is smaller than 0.05, so that the difference is obvious. However, the AG genotype ratio OR is 1.602, the P value is larger than 0.05, and the difference is not significant, so that the rs1766 AG genotype is insufficient for judging the probability of suffering from T1DM rather than T2 DM.

According to the invention, about 500 cases of T2DM cases and LADA cases are subjected to rs1766 genotype frequency comparison experiments, and the comparison experiments show that:

the probability of the crowd carrying the rs1766 GG genotype of the crowd suffering from LADA instead of T2DM is obviously increased, the ratio is 3.048 than OR, the probability of the crowd suffering from LADA instead of T2DM in the AA genotype is 3.048 times, and the p value is smaller than 0.05, so that the crowd has obvious difference. However, the AG genotype ratio OR was 1.316, the P value was greater than 0.05, and the difference was not significant, so that the rs1766 AG genotype was insufficient to determine the probability of developing LADA rather than T2 DM. Further, the present invention concludes that: in differentiating LADA or T1DM from T2DM, the probability rs1766 locus GG > AA genotype for suffering from T1DM or LADA but not T2 DM.

The reagent for detecting the rs1766 locus polymorphism can predict the following situations:

(1) For predicting the probability that an average person who does not develop clinical symptoms of diabetes will suffer LADA or T1DM instead of T2 DM.

(2) For predicting the probability of a person who develops clinical symptoms of diabetes but has not yet diagnosed with diabetes, to develop LADA or T1DM but not T2 DM.

(3) For predicting the probability of diagnosing diabetes, but not specifically which diabetic patient suffers from LADA or T1DM but not T2 DM.

A third object of the invention is to provide a kit for predicting the risk of developing diabetes. The kit is designed based on the newly discovered SNP locus for predicting the diabetes risk, and has high prediction accuracy and high reliability.

The kit is specifically a reagent for detecting rs1766 locus polymorphism.

Further, the kit comprises:

comprising primers for specifically amplifying the rs1766 site and sequencing primers.

Further, it is preferable that the amplification primer sequences are: f: GGTCATCTCCTTTCATCCCCA, SEQ ID NO.1; r: TTTTCATGTGCTTCTCTTGAGC, SEQ ID NO.2; however, the kit of the present invention is not limited to the amplification primer sequence.

Preferred sequencing primer sequences are: TTTTCATGTGCTTCTCTTGAGC, SEQ ID NO.3. The kit of the present invention is not limited to this sequencing sequence.

The LADA and T1DM susceptibility genes detected by the invention are genotypes of the rs1766 locus of the DQ subregion of the HLA class II gene, and the nucleotide sequence of the rs1766 can be referred to as a website: http:// genome. Ucsc. Edu/.

The detection method matched with the invention comprises the following steps:

(a) Extracting genomic DNA from a sample;

(b) PCR amplification to obtain a product containing the rs1766 locus;

(c) The products were sequenced and the genotype of the site was analyzed.

The detection object of the invention is Asian race, especially Chinese race.

The techniques for sequencing, amplifying, extracting genomic DNA, etc., involved in the above methods may be conventional methods in the art.

Through many years of researches, the invention proves that the single nucleotide polymorphism of the rs1766 site of the DQ subregion of the HLA II gene is related to the incidence risk of LADA and T1DM for the first time. Alterations in rs1766 genotype will lead to increased risk of onset of LADA and T1DM, with correlation studies showing significant differences in rs1766g→a distribution in case and control groups (P < 0.05); and the standard for judging the locus is genotype, so that the prediction accuracy is higher. In addition, the polymorphic site is found to be capable of being used for predicting and distinguishing LADA or T1DM and T2DM for the first time, and the standard for judging the site is genotype, so that the prediction accuracy is high and the reliability is high; therefore, the LADA or T1DM can be simply and efficiently distinguished from the type 2 diabetes mellitus, and the method has great significance in more accurate treatment of the diabetes mellitus patients.

The invention can be used for early diagnosis of individual LADA and T1DM susceptibility, comprising the steps of: (1) extracting genomic DNA of the sample. (2) And amplifying the genomic DNA of the sample by PCR with specific amplification primers of rs1766 to obtain an amplification product. (3) Sequencing primers are designed to sequence the rs1766 locus of the amplified product. Detecting the genotype of the HLA gene rs1766 locus of the individual so as to judge whether the incidence risk of the individual for LADA or T1DM is higher than that of the common population. The invention provides a simpler and easier method for diagnosis and treatment of LADA and T1 DM.

The invention also discloses a corresponding detection kit, which comprises a specific primer for amplifying the locus and a sequencing primer. The method for detecting the genotype of the rs1766 locus is simple, easy, quick, efficient and low in cost, and provides a simple and novel approach for diagnosis and treatment of LADA and T1 DM.

Description of the drawings:

FIG. 1 shows the results of genomic DNA concentration and quality measurement of the sample of example 1.

FIG. 2 shows that the genomic DNA of the samples of example 1 were each greater than 10kb in length as determined by agarose gel electrophoresis.

FIG. 3 shows the result of rs1766 site amplification electrophoresis of a portion of the sample of example 2.

FIG. 4 is a screenshot of the result of rs1766 site amplification sequencing in example 2; three genotype example plots; the upper panel is rs1766 GG genotype; the middle panel is rs1766 AG genotype; the lower panel is rs1766 AA genotype.

FIG. 5 is a screenshot of the result of rs1766 site amplification sequencing in example 3; three genotype example plots; the upper panel is rs1766 GG genotype; the middle panel is rs1766 AG genotype; the lower panel is rs1766 AA genotype.

FIG. 6 is a screenshot of the result of rs1766 site amplification sequencing in example 4; three genotype example plots; the upper panel is rs1766 GG genotype; the middle panel is rs1766 AG genotype; the lower panel is rs1766 AA genotype.

FIG. 7 is a screenshot of the result of rs1766 site amplification sequencing in example 5; three genotype example plots; the upper panel is rs1766 GG genotype; the middle panel is rs1766 AG genotype; the lower panel is rs1766 AA genotype.

The specific embodiment is as follows:

the invention is further illustrated below in conjunction with specific embodiments. These examples are provided only to describe the present invention and do not limit the scope of the present invention. Experimental methods without specifying specific conditions were performed under conventional conditions or under conditions recommended by the manufacturer.

Example 1: PCR amplification

1. Experimental materials

PCR instrument: eppendorf, germany; polymerase chain reaction solution: gold medal mix, beijing Optimagin technologies Co.

2. Primer design and Synthesis

The Primer 3 software is used for analyzing and designing primers by taking a partial sequence of HLA class II genes including the rs1766 locus as a template, and the primers are synthesized by Beijing qing biological science and technology Co.

The sequencing primer sequences were: TTTTCATGTGCTTCTCTTGAGC;

the amplification primer sequences are: f: GGTCATCTCCTTTCATCCCCA, R: TTTTCATGTGCTTCTCTTGAGC

3. Sample detection

1. Experimental detection of LADA patients, T1DM patients, T2DM patients and normal control populations, 5ml of blood samples were collected for each case, genomic DNA was extracted, and the extraction results were detected by Nanodrop2000 from Siemens.

2. PCR amplification was performed as follows:

3.

TABLE 1 PCR reaction System

Adding reagents	Addition amount of
		Gold PCRmix	27ul
F	1ul
		R	1ul
DNA	1ul

TABLE 2 PCR reaction procedure

4. Genotype detection results

Detection results of genomic DNA extraction:

genomic DNA of all samples met the detection requirements: 260/280>1.8, at a concentration >10ng/ul, as shown in FIG. 1. The genomic DNA was detected to be greater than 10kb in length by agarose gel electrophoresis, as shown in FIG. 2.

Direct sequencing is the most accurate genotyping method recognized, and is also the "gold standard" of the HLA typing method recommended by the world health organization HLA Committee for naming. The PCR product can be directly used for sequencing, but certain SNP polymorphic sites are deleted in some individuals, so that amplification products cannot be obtained, and the sequencing result is bimodal and difficult to distinguish. One approach is to clone the PCR product and then sequence it. However, the whole process of sequencing after cloning the PCR product is very troublesome and the sequencing cost is high, so that the method is difficult to widely use. Another approach is amplification and sequencing with specific primers, which is relatively simple and low cost. The invention adopts the latter method, makes a plurality of attempts, uses a plurality of pairs of primers for amplification and sequencing, and designs specific primers aiming at a common region to solve the problem.

The primers used were as follows:

a first group:

amplification primer rs1766-1F: GTGATTTCCTGCCTCTGCTC, see SEQ ID NO.4,

rs1766-1R: AATTCCCAACTGCCTGTGTC, see SEQ ID NO.5,

sequencing primer rs1766-seq1: GTGATTTCCTGCCTCTGCTC; see SEQ ID NO.6,

second group:

amplification primer rs1766-2F: GATTTCCTGCCTCTGCTCAA, see SEQ ID NO.7,

rs1766-2R: AATTCCCAACTGCCTGTGTC, SEQ ID NO.8,

sequencing primer rs1766-seq2: GATTTCCTGCCTCTGCTCAA; see SEQ ID NO.9,

third group:

amplification primer rs1766-3F: GGTCATCTCCTTTCATCCCCA

rs1766-3R：TTTTCATGTGCTTCTCTTGAGC

Sequencing primer rs1766-seq3: TTTTCATGTGCTTCTCTTGAGC;

finally, only the 3 rd group of primers can be amplified and sequenced well, and the other groups of primers have double peaks, so that discrimination is difficult.

Example 2

The rs1766 locus of HLA class II gene was detected by sequencing. 503T 1DM patients and 514 normal control groups are selected for sequencing and judging the genotype of rs 1766.

T1DM patients were 503, 267, 236, 21 (11-34) years old, 514, 265, 249, 42 (33-53) years old, and median (quartile spacing) for all age data.

T1DM patient inclusion criteria:

inclusion criteria: (1) meets the diabetes diagnosis standard established by WHO in 1999; (2) acute onset, and no obvious cause of diabetic ketosis or diabetic ketoacidosis tendency within half a year of onset; (3) diagnosis is dependent on insulin treatment within half a year; (4) at least one islet autoantibody positive in serum: GADA, IA-2A or ZnT8A. Exclusion criteria: (1) secondary diabetes; (2) gestational diabetes and other special types of diabetes; (3) incorporating other types of autoimmune diseases; (4) malignant tumors are combined.

Normal control inclusion criteria: (1) hunan Han without blood relationship; (2) oral glucose tolerance test (Oral glucose tolerance test, OGTT) showed fasting blood glucose <5.6mmol/L, blood glucose <7.8mmol/L after 2 hours. Exclusion criteria: (1) chronic diseases and endocrine diseases such as heart, brain, liver, kidney, etc.; (2) incorporating other types of autoimmune diseases; (3) there is a family history of diabetes; (4) malignant tumors are combined.

1. Experimental method

The amplification primer sequences are:

F：GGTCATCTCCTTTCATCCCCA；R：TTTTCATGTGCTTCTCTTGAGC；

the sequencing primer is as follows: TTTTCATGTGCTTCTCTTGAGC. The amplified products were detected by agarose gel electrophoresis and sent to Beijing qing biological Co., ltd for sequencing. Analysis was performed using Lasergene software.

2. The detection result of the HLA class II gene rs1766 locus genotype is schematically shown in figure 4.

3. Correlation analysis of HLA class II Gene rs1766 genotype and T1DM and Normal susceptibility

Comparison of distribution of HLA II gene rs1766 in T1DM patients and normal controls adopts chi-square test, SPSS software is used for statistical analysis, and as the number of normal people in the population carrying rs1766 AA genotype is far higher than that of T1DM patients, the risk of the AA genotype for suffering from T1DM is low, and the other two genotypes GG and AG take the AA genotype as reference. The results of the detection and SPSS software analysis are shown in table 3 below: the risk of suffering from T1DM is obviously increased for the crowd carrying the rs1766 GG genotype, and the ratio is 20.791 times of the AA genotype than OR= 20.791; the ratio of AG genotypes was or= 2.366, 2.366 times the risk of AA genotypes, and p values were all less than 0.05, with significant differences.

TABLE 3 rs1766 genotype frequency comparison of T1DM patients and normal controls

Note that: OR is the ratio of the ratio; 95% ci:95% confidence interval, representing significant differences.

Example 3

The rs1766 locus of HLA class II gene was detected by sequencing. 491 LADA patients and 514 normal control groups were selected for sequencing to determine the genotype of rs 1766.

The total number of LADA patients was 491, men 289, 202, 49 (38-58) years old, normal control 514, 265, 249, 42 (33-53) years old, and median (quartile range) for all age data.

LADA patient inclusion criteria: (1) the diagnosis is diabetes; (2) one or more islet autoantibodies positive: the antibody detection adopts a radioligand method, and the positive judgment standard is as follows: 99 th percentile of 405 healthy human antibody indices was used as a positive judgment threshold: GADA is more than or equal to 0.05, IA-2A is more than or equal to 0.0078, znT8A is more than or equal to 0.011; (3) insulin independent treatment within 6 months after diagnosis of diabetes; (4) the age is more than or equal to 18 years old. Exclusion criteria: (1) gestational diabetes, other special types of diabetes; (2) severe infections, trauma, surgery and other stress conditions; (3) combining other autoimmune diseases; (4) malignant tumor; (5) severe barycenter cerebrovascular disease; (6) pregnant or lactating women; (7) liver and kidney dysfunction, etc.; (8) others are not suitable for inclusion in the case group.

1. Experimental method

The amplification primer sequences are:

F：GGTCATCTCCTTTCATCCCCA；R：TTTTCATGTGCTTCTCTTGAGC；

2. The detection result of the HLA class II gene rs1766 locus genotype is schematically shown in figure 5.

3. Correlation analysis of HLA class II gene rs1766 genotype and LADA and normal

Comparison of distribution of HLA II genes rs1766 in LADA patients and normal controls adopts chi-square test, and statistical analysis is carried out by SPSS software, and as the number of normal people in the population carrying rs1766 AA genotype is far higher than that of LADA patients, the risk of the AA genotype for LADA is low, and the other two genotypes GG and AG take the AA genotype as reference. The detection results and SPSS software analysis results are shown in the following table: the risk of LADA is obviously increased for the crowd carrying the rs1766 GG genotype, and the ratio is 6.598 times of the AA genotype than OR= 6.598; the ratio of AG genotypes was or= 1.944, 1.944 times the risk of AA genotypes, and p values were all less than 0.05, with significant differences.

TABLE 4 comparison of rs1766 genotype frequencies for LADA patients and normal controls

Example 4

The rs1766 locus of HLA class II gene was detected by sequencing. 503T 1DM patients and 504T 2DM patients are selected for sequencing to judge the genotype of rs 1766.

The total number of T1DM patients is 503, 267, 236, 21 (11-34) years old, 504, 258, 246, 52 (44-60) years old, and the age data are all expressed in median (quartile spacing).

T1DM patient inclusion criteria:

T2DM patient inclusion criteria: (1) the diagnosis is diabetes; (2) insulin therapy was not relied upon since onset of the disease, and islet autoantibodies were negative. Exclusion criteria: (1) gestational diabetes, other special types of diabetes; (2) severe infections, trauma, surgery and other stress conditions; (3) combining other autoimmune diseases; (4) malignant tumor; (5) severe barycenter cerebrovascular disease; (6) pregnant or lactating women; (7) liver and kidney dysfunction, etc.; (8) others are not suitable for inclusion in the case group.

1. Experimental method

The amplification primer sequences are:

F：GGTCATCTCCTTTCATCCCCA；R：TTTTCATGTGCTTCTCTTGAGC；

2. The detection result of the HLA class II gene rs1766 locus genotype is schematically shown in figure 6.

3. Correlation analysis of HLA class II gene rs1766 genotype and T1DM and T2DM susceptibility

Comparing the distribution of HLA II genes rs1766 in T1DM patients and T2DM, adopting chi-square test, and carrying out statistical analysis by using SPSS software, wherein the number of T2DM patients in the crowd carrying rs1766 AA genotype is far higher than that of T1DM patients, so that the probability of the AA genotype suffering from T1DM instead of T2DM is low, and the other two genotypes GG and AG take the AA genotype as a reference; the results of the detection and SPSS software analysis are shown in table 5 below: the probability of suffering from T1DM instead of T2DM is obviously increased for the crowd carrying the rs1766 GG genotype, the ratio is 9.604, the probability of suffering from T1DM instead of T2DM is 9.604 times of that of the AA genotype, and the p value is smaller than 0.05, so that the difference is obvious. But the AG genotype ratio OR was 1.602, the P value was greater than 0.05, and the difference was insignificant.

TABLE 5 rs1766 genotype frequency comparison of T1DM patients and T2DM

Example 5

The rs1766 locus of HLA class II gene was detected by sequencing. 491 LADA patients and 504T 2DM patients were selected for sequencing to determine the genotype of rs 1766.

The total number of LADA patients was 491, men 289, women 202, and ages 49 (38-58). The total of 504T 2DM patients, 258 men and 246 women, aged 52 (44-60) years, and the age data are each represented by median (quartile spacing).

1. Experimental method

The amplification primer sequences are:

F：GGTCATCTCCTTTCATCCCCA；R：TTTTCATGTGCTTCTCTTGAGC；

2. The detection result of HLA class II gene rs1766 locus genotype is schematically shown in FIG. 7

3. Correlation analysis of HLA class II Gene rs1766 genotype and LADA and T2DM susceptibility

Comparison of distribution of HLA II genes rs1766 in LADA patients and T2DM adopts chi-square test, and statistical analysis is carried out by SPSS software, because the number of T2DM patients in the crowd carrying rs1766 AA genotype is far higher than that of LADA patients, the probability of the AA genotype suffering from LADA instead of T2DM is low, and the other two genotypes GG and AG take the AA genotype as reference. The results of the detection and SPSS software analysis are shown in table 6 below: the probability of the crowd carrying the rs1766 GG genotype of the crowd suffering from LADA instead of T2DM is obviously increased, the ratio is 3.048 than OR, the probability of the crowd suffering from LADA instead of T2DM in the AA genotype is 3.048 times, the p value is less than 0.05, and the crowd has obvious difference. But the AG genotype ratio OR was 1.316, the P value was greater than 0.05, and the difference was insignificant.

TABLE 6 rs1766 genotype frequency comparison of LADA patients and T2DM

Sequence listing

<110> Xiangya two hospitals at university of south China

<120> reagent for detecting rs1766 site polymorphism and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ggtcatctcc tttcatcccc a 21

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ttttcatgtg cttctcttga gc 22

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ttttcatgtg cttctcttga gc 22

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gtgatttcct gcctctgctc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

aattcccaac tgcctgtgtc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gtgatttcct gcctctgctc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gatttcctgc ctctgctcaa 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

aattcccaac tgcctgtgtc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gatttcctgc ctctgctcaa 20

Claims

1. Application of a reagent for detecting rs1766 locus polymorphism in preparation of a preparation for predicting diabetes risk.

2. The use of claim 1, wherein said diabetes typing comprises: t1DM or LADA.

3. The use according to claim 1, wherein the rs1766 site polymorphism is: GG, AG or AA.

4. The use according to claim 1 or 2 or 3, wherein the risk of developing diabetes is: GG > AG > AA.

5. Application of a reagent for detecting rs1766 locus polymorphism in preparation of a reagent for predicting diabetes typing disease risk.

6. The use according to claim 5, wherein the diabetes typing comprises: t1DM, T2DM and LADA.

7. The use of claim 5, wherein the rs1766 site polymorphism is: GG, AG or AA.

8. The use according to claim 5 or 6 or 7, wherein the probability rs1766 locus GG > AA genotype of suffering from T1DM or LADA but not T2 DM.