CN111560430A

CN111560430A - Reagent for detecting rs1766 site polymorphism and application thereof

Info

Publication number: CN111560430A
Application number: CN202010555343.XA
Authority: CN
Inventors: 周智广; 谢志国; 黄干; 李霞; 罗说明; 林健; 肖扬; 夏影
Original assignee: Second Xiangya Hospital of Central South University
Current assignee: Second Xiangya Hospital of Central South University
Priority date: 2020-06-17
Filing date: 2020-06-17
Publication date: 2020-08-21
Anticipated expiration: 2040-06-17
Also published as: CN111560430B

Abstract

The invention belongs to the fields of molecular biology and medicine, and relates to a reagent for detecting rs1766 site polymorphism and application thereof. The detection result of the locus genotype is used for predicting the risk of the type 1 diabetes (T1DM), the Latent Autoimmune Diabetes of Adults (LADA) or the type 2 diabetes (T2 DM). The invention also discloses a corresponding detection kit, which contains a primer for amplifying the rs1766 locus and a sequencing primer for detecting the genotype of the locus. The method for detecting the genotype of the rs1766 locus is simple and easy to implement, quick and efficient, and low in cost, and provides a simple and new way for diagnosing and treating diabetes.

Description

Reagent for detecting rs1766 site polymorphism and application thereof

The technical field is as follows:

the invention relates to the fields of molecular biology and medicine, in particular to a detection reagent for a single nucleotide polymorphism site rs1766 of a human HLA gene and application thereof in preparing a diabetes related risk assessment reagent.

Background art:

diabetes is a heterogeneous group of diseases characterized by elevated blood glucose levels. Type 1 diabetes and type 2 diabetes exhibit distinct pathophysiological processes. Type 1 diabetes (T1DM) is an organ-specific autoimmune disease with an absolute deficiency of insulin caused by T lymphocyte-mediated destruction of the beta cells of the islets of langerhans, which leads not only to an overproduction of glucose and a decrease in glucose uptake by the cells, but also to an increase in lipolysis and fatty acid oxidation, leading to diabetic ketoacidosis. In contrast, type 2 diabetes (T2DM) is characterized by peripheral tissue insulin resistance, with relatively little or no insulin deficiency, although the specific cause is unknown, and T2DM is not associated with islet cell autoimmunity. However, in some studies, approximately 10% of patients with the T2DM phenotype have demonstrated islet autoimmunity at the time of diagnosis, a particular subtype known as latent autoimmune diabetes adult. Latent autoimmune diabetes mellitus (LADA) in adults is an autoimmune diabetes that is developed by adults, has autoantibodies associated with diabetes, and does not require insulin therapy for a certain period of time after diagnosis, and is one of the most common autoimmune diabetes types in adults.

Diabetes is considered to be a complex genetic disease caused by the combined action of genetic and environmental factors. More and more researchers have focused on the role of genetic factors in the development of diabetes. The HLA genes are also called human major histocompatibility complex, located on the short arm of the 6 th pair of chromosomes, and have nearly 60 loci throughout the complex, and the genes of the entire complex can be classified into three classes according to the characteristics of the encoding molecules: class I, class II, class III. The II type gene region is located at the near end of the centromere and is a region with the most complex structure, mainly comprising three subregions of DR, DQ and DP, each subregion is provided with a plurality of sites, wherein the rs1766 site researched by the invention is a site of the DQ subregion on the II type gene. To date, previous studies have supported the presence of the same susceptibility gene between LADA and T1DM, but the genetic susceptibility gene has less effect on LADA than T1 DM.

In recent years, the incidence of T1DM and LADA worldwide has increased year by year, and the incidence of diabetes in various countries around the world has greatly varied. The large population base, the increasing incidence, and the serious clinical outcome make diabetes one of the major public health problems in China. In order to finally realize the treatment of LADA and T1DM, the field urgently needs to search for susceptible genes of LADA and T1DM, and develop methods, kits and related therapeutic drugs for detecting the susceptible genes of LADA and T1DM so as to achieve the purposes of early diagnosis and treatment of LADA and T1 DM.

Disclosure of Invention

The invention mainly aims to provide an application of a reagent for detecting rs1766 site polymorphism in preparation of a preparation for predicting diabetes patient risk. The polymorphic locus is found to be related to the risk of diabetes for the first time, and the genotype of the polymorphic locus is used for judging the risk of LADA or T1DM, so that the prediction accuracy is high, and the credibility is high.

Further, the diabetes typing according to the present invention comprises: t1DM or LADA.

Further, the rs1766 site polymorphism is as follows: GG, AG or AA.

The invention finds that the number of normal people in people carrying rs1766 AA genotype is far higher than that of patients suffering from LADA or T1DM, which indicates that the risk of suffering from LADA or T1DM caused by AA genotype is low, and the GG and AG of the other two genotypes take AA genotype as reference.

The rs1766 genotype frequency comparison test carried out on about 500 cases of T1DM cases and normal control cases respectively shows that: people with rs1766 GG genotype have significantly increased risk of T1DM, and the ratio is 20.791, which is 20.791 times that of AA genotype; the odds ratio OR of AG genotypes is 2.366, which is 2.366 times the risk of AA genotypes, and the p values are all less than 0.05, with significant differences.

Similarly, an rs1766 genotype frequency comparison test is carried out on about 500 cases of LADA cases and normal controls respectively, and the rs1766 GG genotype carrying population is found to have a remarkably increased LADA risk, wherein the ratio of OR to 6.598 is 6.598 times of that of AA genotype; the odds ratio OR of AG genotypes is 1.944, which is 1.944 times the risk of AA genotypes, and the p values are all less than 0.05, with significant differences.

Further, the present invention concludes that the risk of diabetes is: GG > AG > AA, specifically the risk of LADA or T1 DM: GG > AG > AA.

The reagent for detecting rs1766 site polymorphism can predict the following situations:

(1) is used for predicting the risk of LADA or T1DM in common people without clinical symptoms of diabetes.

(2) For predicting the risk of LADA or T1DM in a person presenting with clinical symptoms of diabetes but not yet diagnosed with diabetes.

(3) For predicting the risk of LADA or T1DM in patients who have diagnosed diabetes, but not who have yet diagnosed which diabetes is the particular one.

The second purpose of the invention is to provide an application of the reagent for detecting rs1766 site polymorphism in preparation of a preparation for predicting diabetes typing disease risk. The polymorphic site is found for the first time and can be used for predicting and distinguishing LADA or T1DM and T2DM, and the standard of the site for judgment is genotype, so that the prediction accuracy is high, and the reliability is high.

Further, diabetes typing includes: t1DM, T2DM and LADA.

Further, the rs1766 site polymorphism is as follows: GG, AG or AA.

Because the number of T2DM patients is far higher than that of LADA or T1DM patients in the population carrying rs1766 AA genotype, the probability that the AA genotype is suffered from LADA or T1DM instead of T2DM is low, and the other two genotypes GG and AG are based on the AA genotype.

The invention uses about 500 cases of T1DM cases and T2DM cases to carry out genotype frequency comparison tests, and finds that:

the probability of the people carrying rs1766 GG genotype is obviously improved when the people suffer from T1DM but not T2DM, the ratio OR is 9.604, is 9.604 times higher than the probability of the people suffering from T1DM but not T2DM when the AA genotype is carried out, the p value is less than 0.05, and the obvious difference exists. However, the ratio of AG genotypes OR is 1.602, the P value is more than 0.05, and the difference is not significant, so rs1766 AG genotype is not enough to judge the probability of T1DM but not T2 DM.

The rs1766 genotype frequency comparison test is carried out on about 500 cases of T2DM cases and LADA cases respectively, and the results show that:

the probability of the people carrying rs1766 GG genotype is obviously improved, the ratio OR is 3.048, the probability is 3.048 times higher than that of the people carrying AA genotype and is not T2DM, and the p value is less than 0.05, so that the difference is obvious. However, the ratio OR of AG genotypes is 1.316, the P value is more than 0.05, and the difference is not significant, so rs1766 AG genotype is not enough to judge the probability of suffering from LADA rather than T2 DM. Further, the present invention concludes that: in distinguishing between LADA or T1DM and T2DM, the probability rs1766 site GG > AA genotype of having T1DM or LADA instead of T2 DM.

(1) for predicting the probability of LADA or T1DM instead of T2DM in normal persons who do not present with clinical symptoms of diabetes.

(2) For predicting the probability of a person presenting with clinical symptoms of diabetes but not yet diagnosed with diabetes to suffer from LADA or T1DM instead of T2 DM.

(3) For predicting the probability that a patient diagnosed with diabetes, but not yet diagnosed as being specifically of which diabetes, will have LADA or T1DM instead of T2 DM.

The third purpose of the invention is to provide a kit for predicting the risk of diabetes. The kit is designed based on the newly discovered SNP locus for predicting the diabetes patient risk, and has high prediction accuracy and high reliability.

The kit is a reagent for detecting rs1766 site polymorphism.

Further, the kit comprises:

comprises a primer for specifically amplifying the rs1766 locus and a sequencing primer.

Further, it is preferable that the amplification primer sequence is: f: GGTCATCTCCTTTCATCCCCA, see SEQ ID NO. 1; r: TTTTCATGTGCTTCTCTTGAGC, see SEQ ID NO. 2; however, the kit of the present invention is not limited to the amplification primer sequence.

The sequence of the sequencing primer is preferably as follows: TTTTCATGTGCTTCTCTTGAGC, see SEQ ID NO. 3. However, the kit of the present invention is not limited to this sequencing sequence.

The LADA and T1DM susceptibility genes detected by the invention are the genotypes of the rs1766 locus of the DQ subregion of the HLA class II gene, and the nucleotide sequence of the rs1766 can be seen in the website: http:// genome. ucsc. edu/.

The matched detection method comprises the following steps:

(a) extracting genomic DNA in a sample;

(b) PCR amplification is carried out to obtain a product containing rs1766 locus;

(c) sequencing the product and analyzing the genotype of the site.

The detection object of the invention is Asian race, especially Chinese.

The sequencing, amplification, extraction of genomic DNA and other techniques involved in the above methods can all be performed by methods conventional in the art.

Through years of research, the invention proves that the single nucleotide polymorphism of the rs1766 locus of the DQ subregion of the HLA class II gene is related to the morbidity risk of LADA and T1DM for the first time. An alteration in rs1766 genotype will lead to an increased risk of development of LADA and T1DM, wherein the results of association studies show a significant difference in the distribution of rs1766G → a between case and control (P < 0.05); and the standard of the locus for judgment is genotype, so that the prediction accuracy is higher. In addition, the invention also discovers that the polymorphic site can be used for predicting and distinguishing LADA or T1DM and T2DM for the first time, and the standard of the site for judgment is also genotype, so that the prediction accuracy is high, and the reliability is high; therefore, the LADA or T1DM can be simply and efficiently distinguished from the type 2 diabetes, and the method has great significance for more accurate treatment of the diabetes.

The invention can be used for early diagnosis of individual LADA and T1DM susceptibility, comprising the steps of: (1) extracting the genomic DNA of the sample. (2) And amplifying the genome DNA of the sample by PCR by using the specific amplification primer of rs1766 to obtain an amplification product. (3) Designing a sequencing primer, and sequencing the rs1766 locus of the amplification product. And detecting the genotype of the rs1766 locus of the HLA gene of the individual so as to judge whether the individual is higher in the risk of suffering from LADA or T1DM than that of the common population. The invention provides a simpler and more convenient method for diagnosing and treating LADA and T1 DM.

The invention also discloses a corresponding detection kit, and the kit comprises a specific primer for amplifying the site and a sequencing primer. The method for detecting the genotype of the rs1766 locus is simple, easy, rapid, efficient and low in cost, and provides a simple and new way for diagnosis and treatment of LADA and T1 DM.

Description of the drawings:

FIG. 1 shows the results of the genomic DNA concentration and quality measurements of the samples of example 1.

FIG. 2 shows that the genomic DNAs of the samples of example 1 were all longer than 10kb by agarose gel electrophoresis.

FIG. 3 shows the result of the rs1766 site amplification electrophoresis of a part of samples in example 2.

FIG. 4 is a screenshot of the result of the rs1766 site amplification sequencing in example 2; exemplary graphs of three genotypes; the upper diagram shows rs1766 GG genotype; middle panel is rs1766 AG genotype; the lower panel shows rs1766 AA genotype.

FIG. 5 is a screenshot of the result of the rs1766 site amplification sequencing in example 3; exemplary graphs of three genotypes; the upper diagram shows rs1766 GG genotype; middle panel is rs1766 AG genotype; the lower panel shows rs1766 AA genotype.

FIG. 6 is a screenshot of the result of the rs1766 site amplification sequencing in example 4; exemplary graphs of three genotypes; the upper diagram shows rs1766 GG genotype; middle panel is rs1766 AG genotype; the lower panel shows rs1766 AA genotype.

FIG. 7 is a screenshot of the result of the rs1766 site amplification sequencing in example 5; exemplary graphs of three genotypes; the upper diagram shows rs1766 GG genotype; middle panel is rs1766 AG genotype; the lower panel shows rs1766 AA genotype.

The specific implementation mode is as follows:

the invention is further illustrated below with reference to specific embodiments. These embodiments are merely illustrative of the present invention and do not limit the scope of the present invention. The experimental procedures, for which no specific conditions are indicated, are according to the usual conditions or according to the conditions recommended by the manufacturer.

Example 1: PCR amplification

First, experimental material

A PCR instrument: eppendorf, Germany; polymerase chain reaction solution: gold medal mix, Beijing Ongzhike Biotech Co.

Second, primer design and synthesis

A partial sequence of the HLA class II gene including the rs1766 site is taken as a template, primers are analyzed and designed by using Primer 3 software, and the sequence is synthesized by Beijing Enginko Biotechnology Ltd.

The sequence of the sequencing primer is as follows: TTTTCATGTGCTTCTCTTGAGC, respectively;

the sequence of the amplification primer is as follows: f: GGTCATCTCCTTTCATCCCCA, R: TTTTCATGTGCTTCTCTTGAGC

Third, sample detection

1. Experimental examination of LADA patients, T1DM patients, T2DM patients and normal control population, 5ml blood samples were collected from each case, genomic DNA was extracted, and the extraction results were examined using Nanodrop2000 from Saimer Feiche.

2. PCR amplification was performed as follows:

3.

TABLE 1 PCR reaction System

Adding a reagent	Amount of addition
		Gold medal PCRmix	27ul
F	1ul
		R	1ul
DNA	1ul

TABLE 2 PCR reaction procedure

Fourth, genotype test results

Detection results of genomic DNA extraction:

the genomic DNA of all samples met the detection requirements: 260/280>1.8, at a concentration >10ng/ul, as shown in FIG. 1. The length of the genomic DNA was found to be larger than 10kb by agarose gel electrophoresis, as shown in FIG. 2.

Direct sequencing is the most accurate method of genotyping and is the "gold standard" for HLA typing methods recommended by the world health organization HLA naming Committee. The PCR product can be directly used for sequencing, but some SNP polymorphic sites are deleted in some individuals, so that an amplification product cannot be obtained, and in addition, a double peak appears in a sequencing result and is difficult to distinguish. One approach is to clone the PCR product and then sequence it. However, the whole procedure of sequencing after cloning the PCR product is very troublesome, and the sequencing cost is very high, so that the PCR product is difficult to be widely used. Another method is amplification and sequencing with specific primers, which is relatively simple and low cost. The invention adopts the latter method, makes multiple attempts, uses multiple pairs of primers for amplification and sequencing, and designs specific primers aiming at consensus regions to solve the problem.

The primers used were as follows:

a first group:

and the amplification primer rs 1766-1F: GTGATTTCCTGCCTCTGCTC, see SEQ ID NO.4,

rs 1766-1R: AATTCCCAACTGCCTGTGTC, see SEQ ID NO.5,

sequencing primer rs1766-seq 1: GTGATTTCCTGCCTCTGCTC, respectively; see SEQ ID NO.6,

second group:

and the amplification primer rs 1766-2F: GATTTCCTGCCTCTGCTCAA, see SEQ ID NO.7,

rs 1766-2R: AATTCCCAACTGCCTGTGTC, see SEQ ID NO.8,

sequencing primer rs1766-seq 2: GATTTCCTGCCTCTGCTCAA, respectively; see SEQ ID NO.9,

third group:

and an amplification primer rs 1766-3F: GGTCATCTCCTTTCATCCCCA

rs1766-3R：TTTTCATGTGCTTCTCTTGAGC

Sequencing primer rs1766-seq 3: TTTTCATGTGCTTCTCTTGAGC, respectively;

finally, only the 3 rd group of primers can be well amplified and sequenced, and the rest groups of primers have double peaks and are difficult to distinguish.

Example 2

And detecting the rs1766 locus of the HLA class II gene by using a sequencing method. 503T 1DM patients and 514 normal control populations were selected for sequencing to determine the rs1766 genotype.

The T1DM patients had 503 total, 267 males, 236 females, 21(11-34) years of age, 514 normal controls, 265 males, 249 females, 42(33-53) years of age, and the age data were expressed as median (interquartile range).

T1DM patients included criteria:

inclusion criteria were: meeting the diabetes diagnosis standard established by WHO in 1999; ② acute onset, no obvious inducement to the diabetic ketosis or the tendency of diabetic ketosis acidosis within half a year of onset; thirdly, the insulin-dependent therapy is diagnosed within half a year; (iv) at least one islet autoantibody positive in serum: GADA, IA-2A or ZnT 8A. Exclusion criteria: firstly, secondary diabetes mellitus; gestational diabetes and other special types of diabetes; ③ combined with other types of autoimmune diseases; and fourthly, malignant tumors are combined.

Normal controls were included as standards: the Han nationality in Hunan without blood relation; ② Oral Glucose Tolerance Test (OGTT) shows fasting blood glucose <5.6mmol/L and blood glucose <7.8mmol/L after 2 hours. Exclusion criteria: chronic diseases of heart, brain, liver, kidney and the like and endocrine diseases; ② other types of autoimmune diseases are combined; ③ family history of diabetes; and fourthly, malignant tumors are combined.

First, experiment method

The sequence of the amplification primer is as follows:

F：GGTCATCTCCTTTCATCCCCA；R：TTTTCATGTGCTTCTCTTGAGC；

the sequencing primer is as follows: TTTTCATGTGCTTCTCTTGAGC are provided. The amplified product is detected by agarose gel electrophoresis, and the amplified product is sent to Beijing Optimalaceae biology, Inc. for sequencing. Analysis was performed using Lasergene software.

Secondly, the detection result schematic diagram of the HLA class II gene rs1766 locus genotype is shown in figure 4.

Third, correlation analysis of HLA class II gene rs1766 genotype and T1DM and normal susceptibility

The distribution of HLA class II gene rs1766 in T1DM patients and normal control is compared by chi-square test and statistical analysis is carried out by SPSS software, and the normal population number in the population carrying rs1766 AA genotype is far higher than that of T1DM patients, so that the risk that the AA genotype suffers from T1DM is low, and the other two genotypes GG and AG use AA genotype as reference. The results of the tests and the results of the analysis by the SPSS software are shown in table 3 below: people with rs1766 GG genotype have significantly increased risk of T1DM, and the ratio is 20.791, which is 20.791 times that of AA genotype; the odds ratio OR of AG genotypes is 2.366, which is 2.366 times the risk of AA genotypes, and the p values are all less than 0.05, with significant differences.

TABLE 3 comparison of rs1766 genotype frequencies for T1DM patients and normal controls

Note: OR is the ratio; 95% CI: 95% confidence interval, representing significant difference.

Example 3

And detecting the rs1766 locus of the HLA class II gene by using a sequencing method. 491 LADA patients and 514 normal control populations were selected for sequencing to determine rs1766 genotype.

In 491 total patients with LADA, 289 male patients, 202 female patients, age of 49(38-58), 514 normal control patients, 265 male patients, 249 female patients, age of 42(33-53), and the age data are expressed by median (interquartile range).

LADA patients received criteria: firstly, diabetes is confirmed; positive for one or more islet autoantibodies: the antibody detection adopts a radioligand method, and the positive judgment standard is as follows: the 99 th percentile of the indexes of 405 healthy human antibodies is used as a positive judgment threshold: GADA is more than or equal to 0.05, IA-2A is more than or equal to 0.0078, ZnT8A is more than or equal to 0.011; ③ the treatment without insulin within 6 months after the diabetes is confirmed; fourthly, the age is more than or equal to 18 years old. Exclusion criteria: gestational diabetes mellitus and other special diabetes mellitus; stress conditions such as severe infection, trauma, surgery, etc.; ③ merging other autoimmune diseases; fourthly, malignant tumor; severe cardiovascular and cerebrovascular diseases; sixthly, the pregnant or nursing women; seventhly, incomplete liver and kidney functions and the like; other cases are not suitable for inclusion in the case group.

First, experiment method

The sequence of the amplification primer is as follows:

F：GGTCATCTCCTTTCATCCCCA；R：TTTTCATGTGCTTCTCTTGAGC；

Secondly, the detection result schematic diagram of the HLA class II gene rs1766 locus genotype is shown in figure 5.

Third, correlation analysis of HLA class II gene rs1766 genotype and LADA and normal

The distribution of HLA class II gene rs1766 in LADA patients and normal control is compared by chi-square test and statistical analysis is carried out by SPSS software, and as the number of normal people in the population carrying rs1766 AA genotype is far higher than that of the population carrying the LADA patients, the risk of suffering from LADA in AA genotype is prompted to be low, and the GG and AG of the other two genotypes take the AA genotype as reference. The results of the tests and the results of the SPSS software analysis are shown in the following table: people with rs1766 GG genotype, which have significantly increased risk of LADA, have a ratio OR of 6.598, which is 6.598 times that of AA genotype; the odds ratio OR of AG genotypes is 1.944, which is 1.944 times the risk of AA genotypes, and the p values are all less than 0.05, with significant differences.

TABLE 4 comparison of rs1766 genotype frequencies for LADA patients and normal controls

Example 4

And detecting the rs1766 locus of the HLA class II gene by using a sequencing method. 503 patients with T1DM and 504 patients with T2DM were selected for sequencing to determine the genotype of rs 1766.

503 of T1DM patients, 267 men, 236 women, 21(11-34) years of age, 504 of T2DM patients, 258 men, 246 women, 52(44-60) years of age, wherein the age data are all expressed by median (interquartile distance).

T1DM patients included criteria:

T2DM patients included criteria: firstly, diabetes is confirmed; ② insulin treatment was not relied on since onset, islet autoantibodies were negative. Exclusion criteria: gestational diabetes mellitus and other special diabetes mellitus; stress conditions such as severe infection, trauma, surgery, etc.; ③ merging other autoimmune diseases; fourthly, malignant tumor; severe cardiovascular and cerebrovascular diseases; sixthly, the pregnant or nursing women; seventhly, incomplete liver and kidney functions and the like; other cases are not suitable for inclusion in the case group.

First, experiment method

The sequence of the amplification primer is as follows:

F：GGTCATCTCCTTTCATCCCCA；R：TTTTCATGTGCTTCTCTTGAGC；

Secondly, the detection result schematic diagram of the HLA class II gene rs1766 locus genotype is shown in figure 6.

Third, correlation analysis of HLA class II gene rs1766 genotype and T1DM and T2DM susceptibility

The distribution of HLA class II genes rs1766 in T1DM patients and T2DM is compared by adopting chi-square test and SPSS software for statistical analysis, and the number of T2DM patients in the population carrying the rs1766 AA genotype is far higher than that of T1DM patients, so that the probability that the AA genotype suffers from T1DM but not T2DM is low, and the other two genotypes GG and AG use the AA genotype as reference; the results of the tests and the results of the analysis by the SPSS software are shown in table 5 below: the probability of the people carrying rs1766 GG genotype is obviously improved when the people suffer from T1DM but not T2DM, the ratio OR is 9.604, is 9.604 times higher than the probability of the people suffering from T1DM but not T2DM when the AA genotype is carried out, the p value is less than 0.05, and the obvious difference exists. However, the AG genotype ratio OR is 1.602, the P value is more than 0.05, and the difference is not significant.

TABLE 5 frequency comparison of rs1766 genotypes between T1DM patients and T2DM

Example 5

And detecting the rs1766 locus of the HLA class II gene by using a sequencing method. 491 LADA patients and 504T 2DM patients were selected for sequencing to determine rs1766 genotype.

In total 491 patients with LADA, 289 men and 202 women aged 49(38-58) years. The T2DM patients had 504 cases, 258 men and 246 women, the ages were 52(44-60), and the age data were expressed as median (interquartile range).

First, experiment method

The sequence of the amplification primer is as follows:

F：GGTCATCTCCTTTCATCCCCA；R：TTTTCATGTGCTTCTCTTGAGC；

II, HLA class II gene rs1766 locus genotype test result sketch map 7

Third, correlation analysis of HLA class II gene rs1766 genotype and LADA and T2DM susceptibility

The distribution of HLA class II gene rs1766 in LADA patients and T2DM is compared by chi-square test and statistical analysis is carried out by SPSS software, and the number of T2DM patients in the population carrying rs1766 AA genotype is far higher than that of LADA patients, so that the probability that the AA genotype suffers from LADA but not T2DM is low, and the other two genotypes GG and AG use the AA genotype as reference. The results of the tests and the results of the analysis by the SPSS software are shown in table 6 below: the probability of the people carrying rs1766 GG genotype is obviously improved, the ratio OR is 3.048, the probability of the people carrying the AA genotype is 3.048 times higher than that of the people carrying the genotype of LADA but not T2DM, and the p values are all less than 0.05, so that the obvious difference exists. However, the AG genotype ratio OR is 1.316, the P value is more than 0.05, and the difference is not significant.

TABLE 6 comparison of frequency of rs1766 genotypes in LADA patients and T2DM

Sequence listing

<110> Xiangya II Hospital of Zhongnan university

<120> reagent for detecting rs1766 site polymorphism and application thereof

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ggtcatctcc tttcatcccc a 21

<210>2

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ttttcatgtg cttctcttga gc 22

<210>3

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ttttcatgtg cttctcttga gc 22

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gtgatttcct gcctctgctc 20

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

aattcccaac tgcctgtgtc 20

<210>6

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gtgatttcct gcctctgctc 20

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gatttcctgc ctctgctcaa 20

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aattcccaac tgcctgtgtc 20

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gatttcctgc ctctgctcaa 20

Claims

1. Application of the reagent for detecting rs1766 site polymorphism in preparation of a preparation for predicting diabetes patient risk.

2. The use of claim 1, wherein said diabetes typing comprises: t1DM or LADA.

3. The use as claimed in claim 1, wherein the rs1766 site polymorphism is: GG, AG or AA.

4. Use according to claim 1 or 2 or 3, characterized in that the risk of diabetes is: GG > AG > AA.

5. Application of the reagent for detecting rs1766 site polymorphism in preparation of a preparation for predicting diabetes typing disease risk.

6. The use of claim 5, wherein diabetes typing comprises: t1DM, T2DM and LADA.

7. The use as claimed in claim 5, wherein the rs1766 site polymorphism is: GG, AG or AA.

8. The use of claim 5 or 6 or 7, wherein the probability of having T1DM or LADA instead of T2DM is rs1766 site GG > AA genotype.

9. The kit for predicting the diabetes patient risk is characterized by being a reagent for detecting rs1766 site polymorphism.

10. The kit of claim 9, wherein:

a primer containing a specific amplification rs1766 site and a sequencing primer;

preferably, the amplification primer sequence is: f: GGTCATCTCCTTTCATCCCCA, respectively; r: TTTTCATGTGCTTCTCTTGAGC, respectively;

the sequence of the sequencing primer is preferably as follows: TTTTCATGTGCTTCTCTTGAGC are provided.