CN111558034A

CN111558034A - Haemonchus contortus nano-material subunit vaccine and application thereof

Info

Publication number: CN111558034A
Application number: CN202010297744.XA
Authority: CN
Inventors: 李祥瑞; 徐立新; 宋小凯; 严若峰; 王强强
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2020-04-16
Filing date: 2020-04-16
Publication date: 2020-08-21
Anticipated expiration: 2040-04-16
Also published as: CN111558034B

Abstract

The invention discloses a haemonchus contortus nano-material subunit vaccine and application thereof. A nanometer material subunit vaccine of Haemonchus contortus is prepared by wrapping Haemonchus contortus recombinant protein HCA59 with nanometer material PLGA; the recombinant HCA59 protein has an amino acid sequence shown in SEQ ID NO. 1. The subunit vaccine can be used for preventing Haemonchus contortus infection of sheep. The particle size of the nanometer subunit vaccine is 75-402 nm; has better biocompatibility and unique physicochemical property, has the advantages of targeting property, slow release, safety, high efficiency and the like, and can be decomposed and metabolized in animal bodies; the vaccine has the effect of stimulating the stimulating antigen of the dendritic cells, can promote the capacity of transforming the monocytes into the dendritic cells, has strong immune protection capacity, and can remarkably reduce the egg discharge rate and the adult reduction rate of goats infected with the haemonchus contortus clinically.

Description

Haemonchus contortus nano-material subunit vaccine and application thereof

Technical Field

The invention relates to the technical field of biological veterinary drugs, and relates to a sheep haemonchus contortus nano subunit vaccine.

Background

Haemonchus contortus is mainly parasitized in abomasums of ruminants such as camels, cows, sheep, deer and the like, and is fed by host blood. Investigations have found that the annual costs for controlling haemonchus contortus have reached several million dollars in some european countries. Currently, chemical medicines are mainly used in the market for preventing and controlling the infection of the haemonchus contortus, but due to excessive dependence on the chemical medicines, the haemonchus contortus drug-resistant strains appear, so that the effect of the medicines is not ideal. In addition, due to the wide concern of drug residues and some biological safety factors, some anti-nematode drugs are difficult to be widely applied to the prevention and control of the haemonchus contortus disease.

Therefore, means for controlling haemonchus contortus by some immunological means are becoming increasingly favored, such as the development of vaccines for preventing haemonchus contortus, but to date there are still a few effective commercial vaccines. There may be some causes for this, such as some body surface antigens, insect cryptic antigens (e.g., cysteine proteases) and some immunoprotection by excreting secretory antigens. In addition, the complex reaction mechanism between the polypide and the host also makes the development of the vaccine difficult.

The excretory secretions (HcESPs) produced by haemonchus contortus during the parasitic process play an important role in the parasite-host relationship, and comprise a variety of proteins that can directly contact the host's immune system, playing an important role in both eliciting a protective immune response in the body and assisting the insect in escaping the host's immune system attack. In previous studies in this laboratory, the protein rHCA59 derived from Haemonchus contortus HcESPs was demonstrated to bind to PBMC in vitro, and related studies have demonstrated that this protein has stimulatory antigenic effects on dendritic cells.

Polylactic-co-glycolic acid (PLGA) nano materials can accelerate, prolong or enhance antigen specific immune reaction, often form a vaccine preparation together with a vaccine, have better biocompatibility and unique physicochemical property, and have the advantages of targeting property, slow release property, safety, high efficiency and the like. PLGA is polymerized from two monomers, lactic acid and glycolic acid, and is decomposable and metabolized in the body. PLGA has been approved by the FDA in the united states for use as a carrier for drugs, and technical indices regarding PLGA are included in the pharmacopoeia of the people's republic of china, 2015 edition. Therefore, PLGA is expected to be used in the development of vaccines.

Disclosure of Invention

The invention aims to provide a nano subunit vaccine capable of preventing the infection of the goat blood twill line.

The purpose of the invention can be realized by the following technical scheme:

a nanometer material subunit vaccine of Haemonchus contortus is prepared by wrapping Haemonchus contortus recombinant protein HCA59 with nanometer material PLGA; the recombinant HCA59 protein has an amino acid sequence shown in SEQ ID NO. 1.

The haemonchus contortus nano-material subunit vaccine is preferably prepared by the following steps:

1) preparing 6% polyvinyl alcohol;

2) preparing 0.05g/mL PLGA dichloromethane solution as an organic phase;

3) dropwise adding 1mg/mL of recombinant HCA59 solution into an equal volume of 6% polyvinyl alcohol solution to form an internal water phase;

4) mixing the internal water phase and the organic phase, carrying out ultrasonic crushing at 4 ℃ to finally form a w/o mixed solution, dropwise adding the w/o mixed solution into 6% polyvinyl alcohol with the same volume under a vortex condition, continuing vortex after the dropwise adding is finished, and carrying out ultrasonic crushing to finally form a w/o/w mixed solution;

5) volatilizing to remove the organic solvent in the w/o/w mixed solution, centrifugally separating and precipitating, and freeze-drying after heavy suspension to obtain the haemonchus contortus nano-material subunit vaccine freeze-dried powder.

The particle size of the nanometer material subunit vaccine of the haemonchus contortus is 75-402 nm.

The preparation method of the haemonchus contortus nano-material subunit vaccine comprises the following steps:

1) preparing 6% polyvinyl alcohol;

2) preparing 0.05g/mL PLGA dichloromethane solution as an organic phase;

3) dropwise adding 1mg/mL of recombinant protein HCA59 solution into 6% polyvinyl alcohol solution with the same volume to form an internal water phase;

In a preferred embodiment of the present invention, in step 4), the power of the ultrasonic crusher is set to 40W, the ultrasonic treatment is performed for 5s, the interval is 5s, and the ultrasonic treatment time is 4 min.

As a preferred embodiment of the present invention, in step 5), the centrifugation is carried out at 4 ℃ for 40min at 40,000 r/min.

As a preferred embodiment of the present invention, the recombinant protein HCA59 is prepared by the following method: extracting total RNA of haemonchus contortus, carrying out reverse transcription on the extracted RNA to obtain cDNA, designing PCR primers SEQID NO.2 and SEQ ID NO.3 according to the sequence of SEQ ID NO.1 to amplify an open reading frame of an HCA59 protein coding gene, and connecting the amplified PCR product with a cloning vector pMD-19T by using DNA ligase to obtain a sequencing vector pMD-19T-HCA59 recombinant plasmid; extracting a large amount of recombinant plasmids and expression vectors pET-32a (+) which are sequenced correctly, selecting the same endonuclease for double digestion, and connecting target genes with the pET-32a (+) vectors by using T4 ligase to obtain recombinant plasmids pET-32a-HCA 59; amplifying the recombinant plasmid in a large quantity, and transforming the recombinant plasmid into escherichia coli BL21(DE3) to obtain escherichia coli containing pET-32a-HCA59 recombinant plasmid; and (2) placing the escherichia coli in an LB liquid culture medium for large-scale amplification, adding IPTG (isopropyl-beta-thiogalactoside), continuing to culture to induce the expression of the recombinant protein H2A1, recovering the thalli through centrifugation, carrying out ultrasonic crushing, carrying out centrifugal separation on the thalli subjected to ultrasonic treatment, precipitating, dissolving in a Bindingbuffer, filtering through a 0.22 mu m filter membrane, and purifying the recombinant protein through a His-tagged protein purification column to obtain the recombinant protein HCA 59.

As a preferred mode of the invention, the preparation method of the Haemonchus contortus nanomaterial subunit vaccine comprises the following steps: (1) cloning and expressing and purifying genes of recombinant HCA59 protein of haemonchus contortus: extracting total RNA of Haemonchus contortus adults, synthesizing cDNA, amplifying HCA59 gene (SEQ ID NO.4) by using primers SEQ ID NO.2 and SEQ ID NO.3 through PCR, cutting a target band of 426bp through 1% agarose gel electrophoresis, recovering and purifying, connecting with a cloning vector pMD-32a to construct an expression vector, transforming into BL21(DE3) competent cells, culturing by LB liquid culture solution containing aminobenzyl resistance, inducing expression by IPTG, purifying inclusion body protein by a nickel column, and then renaturing.

(2) Preparing a haemonchus contortus recombinant HCA59 protein nano-material subunit vaccine: in a fume hood, dropwise adding dichloromethane into a centrifugal tube containing PLGA, covering and shaking uniformly, adding into 6% polyvinyl alcohol (PVA) and placing on a vortex vibration instrument, dropwise adding 1mg/mL HCA59 and 2mL of target protein into a new centrifugal tube at a dropwise adding speed of 1s for 1 drop, and continuing to vortex for 2min after the dropwise adding is finished. Eventually forming an internal aqueous phase. Carrying out ultrasonic crushing at 4 ℃ for 5s at an interval of 5s for 4min under 40W to form a mixed solution. Dropwise adding into 6% polyvinyl alcohol (PVA) with the same volume under a vortex condition, and continuing to vortex for 2min after the dropwise adding is finished. And then carrying out ultrasonic crushing at the temperature of 4 ℃ to form a mixed solution. Volatilizing with magnetic stirrer for 4 hr while stirring, centrifuging the liquid at 4 deg.C for 40min at 40,000r/min, and separating the liquid into supernatant and precipitate. Resuspend the pellet with deionized water, transfer the liquid to a vial and store at-80 ℃ for at least 2 h. And freeze-drying the frozen sample in a freeze dryer for 24 hours, and flicking the sample to obtain freeze-dried powder. The packaged vaccine can be stored at 4 ℃.

The application of the nanometer material subunit vaccine of the haemonchus contortus in preparing the medicine for preventing the haemonchus contortus disease of sheep is provided.

The invention has the following advantages and effects:

1. according to the invention, the PLGA nano material is used for wrapping recombinant HCA59 protein of haemonchus contortus to prepare the nano material subunit vaccine, so that the specific immune reaction of the recombinant HCA59 protein can be accelerated, prolonged or enhanced, the vaccine has good biocompatibility and unique physicochemical property, and has the advantages of targeting property, slow release property, safety, high efficiency and the like, and the vaccine can be decomposed and metabolized in an animal body.

2. The haemonchus contortus HCA59 protein used in the invention has the stimulation antigen effect of dendritic cells, can promote the capability of transforming monocytes into dendritic cells, and has stronger immune protection capability.

3. The subunit nano-material vaccine for the haemonchus contortus can obviously reduce the egg discharge rate and the adult reduction rate of goats infected with the haemonchus contortus, thereby resisting the infection of the haemonchus contortus and having higher application value clinically.

Drawings

FIG. 1 agarose gel electrophoresis of the RT-PCR product of HCA 59.

FIG. 2 double restriction enzyme identification of recombinant plasmid pMD-19T-HCA 59.

FIG. 3 double restriction enzyme identification of recombinant plasmid pET-32a-HCA 59.

FIG. 4 SDS-PAGE results of recombinant protein HCA59 expression and purification.

FIG. 5 shows the recombinant protein HCA59-PLGA nanoparticles observed by electron microscopy (4000 times).

FIG. 6 shows the recombinant protein HCA59-PLGA nano-particle electron microscope observation (10000 times).

FIG. 7 egg discharge dynamics.

Detailed Description

Base material:

1. parasite bodies: haemonchus contortus strains were stored for a long period by the parasite laboratory of the animal medical college of Nanjing university of agriculture.

2. Experimental animals: goats (3-6 months old) purchased from the experimental animal center of animal medical college of Nanjing university of agriculture have excellent physical health condition and are checked to have no parasite infection; the animal treatment method involved in the whole experimental process strictly follows relevant regulations such as animal welfare protection regulations of science and technology hall of Jiangsu province of the people's republic of China and animal welfare of Nanjing agriculture university.

3. Plasmid and strain: coli DH5 alpha, BL21 and expression vector pET-32a (+) were stored in the laboratory, and cloning vector pMD-19T vector was purchased from Dalianbao organism (TaKaRa) engineering Co., Ltd.

4. Major tools enzymes and reagents:

reagent is available from ThermoFisher technologies, Inc.; PrimeScript^TM1st Strand cDNA Synthesis Kit, LA Taq DNA polymerase, dNTP, MgCl2, 10 × PCR Buffer, restriction endonuclease, cloning vector pMD-19T, T4 DNA ligase were purchased from TaKaRa engineering Co., Ltd;

Plasmid DNA Mini kitⅠ、

gel extraction kit was purchased from OMEGA; the HisTrpTM FF protein affinity chromatographic column is a product of GE company in America; the BCA protein quantitative analysis kit is a product of Thermo Scientific company in the United states.

5. Main apparatus and equipment: the common PCR instrument is a product of TaKaRa company of Japan; the desktop constant temperature oscillator (THZ-C) is a product of Suzhou peying experimental facilities, Inc.; the desktop normal temperature centrifuge (5418) and the desktop refrigerated centrifuge (5417R) are all products of Eppendorf company of Germany; the horizontal nucleic acid electrophoresis apparatus is a product of Shanghai Tanon company; the falling high-speed centrifuge is a product of Backman Coulter company in the United states; protein electrophoresis System (Mini-PROTEAN) and transfer System (Mini Trans-Blot) were purchased from Bio-Rad; the gel image analysis system (ImageQuant300) is a product of GE company of America; a vertical pressure steam sterilizer (MLS-3870) is a product of Sanyo corporation of Japan; the water-proof constant-temperature incubator at 37 ℃ is a product of Shanghai Senxin experiment instrument Co., Ltd; the ultrasonication instrument was from Scientz Biotechnology (China); cold field emission JEOLIT-100 scanning electron microscope (japan); ultracentrifuge (beckmann coulter co., usa); lyophilizer (Labconco, USA).

Example 1 preparation of a nanomaterial subunit vaccine to Haemonchus contortus

1. Extraction of total RNA of haemonchus contortus polyprens

Total RNA extraction was performed according to the Inviotgen TRIzol protocol, with the following specific steps:

(1) adding 1mL of TRIzol reagent into a centrifuge tube filled with adult haemonchus contortus, transferring the centrifuge tube into a homogenizer soaked by 0.1% DEPC, fully grinding the mixture on ice, and transferring the mixture into a new centrifuge tube to stand at room temperature for 5 min;

(2) adding 200 mu L of chloroform into the centrifuge tube, shaking the centrifuge tube for 15s by hand, and standing for 3min at room temperature;

(3) centrifuging at 12000rpm for 15min at 4 deg.C, and carefully transferring the upper water phase to a new centrifuge tube;

(4) adding 500 mu L of isopropanol into the centrifuge tube, reversing, uniformly mixing, and standing at room temperature for 10 min;

(5) centrifuging at 12000rpm for 10min at 4 deg.C, and removing supernatant;

(6) adding 1mL of 75% ethanol (prepared by DEPC water) into a centrifuge tube, uniformly mixing by vortex, and washing an RNA precipitate;

(7) centrifuging at 7500rpm for 5min at 4 deg.C, and removing supernatant;

(8) repeating the washing step once, airing under a fan for 5min to volatilize residual ethanol, and dissolving RNA by 30 mu L of DEPC water;

(9) the RNA concentration and purity were determined and stored at-70 ℃ or immediately reverse transcribed.

Synthesis of cDNA template

(1) Reaction solutions were prepared in RNase-free PCR tubes as shown in the following table:

(2) lightly blowing, uniformly mixing, keeping the temperature at 65 ℃ for 5min, quickly cooling on ice, and preparing a reaction solution according to the following table:

(3) slowly mixing, and incubating at 42 deg.C for 60 min;

(4) keeping the temperature at 95 deg.C for 5min to inactivate enzyme, and standing on ice;

(5) immediately carrying out PCR amplification or freezing and storing at-20 ℃ for later use.

3. Primer synthesis

Based on the coding sequence of the corresponding open reading frame of Haemonchus contortus HCA59 protein, the software Primer5.0 was used to design the upstream Primer AAGGATCCATGACGGAATTCTTCTCGCG (SEQ ID NO.2) and the downstream Primer CCAAGCTTCCTCGAGAAGTATTCGATGAGCTTC (SEQ ID NO.3) synthesized by Jinzhi limited, Suzhou.

PCR amplification of HCA59

(1) Using the cDNA synthesized in 2 as a template, a PCR system was prepared as shown in the following table:

(2) gently pipetting and mixing the mixture by using a pipettor, performing instantaneous centrifugation, and performing PCR reaction according to the following procedures:

pre-denaturation at 94 ℃ for 5min,

the denaturation is carried out for 30s at the temperature of 94 ℃,

annealing at the temperature of 55 ℃ for 30s,

extension at 72 ℃ for 1min

The elongation is carried out for 10min at the temperature of 72 ℃,

for a total of 35 cycles.

Storing at 16 ℃.

5. Cloning of the Gene of interest

5.1 recovery and purification of PCR products

The PCR product was subjected to 1% agarose gel electrophoresis, the band of interest was excised, and the gene of interest was recovered and purified using Gelextraction kit from OMEGA, the specific procedures being described in the specification.

5.2 ligation of PCR products with cloning vectors

(1) The recovered PCR product was ligated with the cloning vector pMD-19T, as shown in the following table:

(2) gently pumping and mixing with a pipette, centrifuging instantaneously, standing at 4 deg.C overnight

5.3 preparation of competent cells

(1) Recovering glycerol bacteria, and performing shaking culture at 37 ℃ overnight;

(2) the following day is as follows: 100 transferring the bacterial liquid into LB liquid culture medium without antibiotics, culturing for 2-3h at 37 ℃ and 180r/min until the OD value of the bacterial liquid reaches 0.4-0.6;

(3) subpackaging the bacterial liquid in a 1.5ml centrifuge tube, carrying out ice bath for 10min, centrifuging at 4 ℃ and 5000rpm for 5 min;

(4) discarding the supernatant, placing the centrifuge tube on absorbent paper, removing the residual culture solution, adding 1mL of precooled 0.1mol/L calcium chloride solution into each tube, gently suspending the thalli, and carrying out ice bath for 30 min;

(5) centrifuging at 4 deg.C and 5000rpm for 5 min;

(6) discarding supernatant, placing the centrifuge tube on absorbent paper, removing residual culture solution, adding 200 μ L pre-cooled 0.1mol/L calcium chloride solution (containing 15% glycerol) into each tube, gently resuspending thallus, storing at 4 deg.C for 24-48h, and storing at-70 deg.C if temporarily not used.

5.4 transformation of the ligation product

(1) Adding 10 μ L of the ligation product in 5.2 to 200 μ L of DH5 α competent cells, and gently mixing;

(2) performing ice bath for 30min, performing heat shock in a water bath kettle at 42 ℃ for 90s, and performing ice bath for 2 min;

(3) adding 800 μ L of nonresistant LB liquid medium, and performing shake culture at 37 deg.C and 150rpm for 50-60 min;

(4) centrifuging at 4 ℃ with a centrifuge at 5000rpm for 5min, discarding 800 μ L of supernatant, gently blowing and resuspending the residual thallus precipitate with a pipette, dripping the suspended thallus precipitate on an LB solid plate containing Amp (100 μ g/mL), and then uniformly coating with a burned coating rod;

(5) sealing the plate with sealing film, and culturing in 37 deg.C incubator for 12-16 h.

5.5 recombinant plasmid double restriction enzyme identification

(1) Randomly picking several single colonies from the plate, inoculating the single colonies into 5ml of LB liquid culture medium added with ampicillin, and carrying out shaking culture at 37 ℃ and 180rpm for 12-16 h;

(2) extracting plasmids in bacterial liquid by using plasmid mini kit of OMEGA company, and referring to the specification for specific steps;

(3) double restriction enzyme digestion identification is carried out by using endonuclease, the enzyme digestion is carried out for 4h at 37 ℃, and the system is shown in the following table:

(4) after 1% agarose gel electrophoresis, positive clones with correct insert size were sequenced by Jinzhi Biopsis, Suzhou to obtain the correct positive plasmid pMD-19T-HCA 59.

6. Construction of prokaryotic expression vectors

(1) The recombinant plasmid and the expression vector pET-32a (+) which are sequenced correctly are extracted in a large quantity, the same endonuclease is selected for double enzyme digestion, and the system is shown as the following table:

(2) after enzyme digestion for 4h at 37 ℃, detecting by 1% agarose gel electrophoresis, respectively recovering a target gene fragment and a pET-32a (+) vector fragment by using gel extraction kit of an OMEGA company, and determining the concentration;

(3) the target gene was ligated to pET-32a (+) vector using T4 ligase, the ligation system is shown in the following table, and the corresponding volume was determined according to the concentration of the target gene and the vector fragment.

(4) Gently pumping and mixing by using a pipettor, instantly centrifuging, and standing overnight at 16 ℃;

(5) the ligation product was transformed into BL21(DE3) competent cells in the same manner as 5.4, ampicillin plates were inverted in a 37 ℃ incubator for 16h, single clones were randomly picked from the plates, plasmids were extracted, double-restriction enzyme identification was performed in the same manner as 5.5, and positive clones with correct insert size were sent to Jinzhi biology, Suzhou for sequencing to obtain the correct recombinant plasmid pET-32a-HCA 59.

7. Inducible expression of recombinant expression plasmids

7.1 time-phase expression analysis of recombinant proteins

Taking 100 mu L of the bacterial liquid containing the correct recombinant expression plasmid in 6, inoculating the bacterial liquid into 10mL of LB liquid culture medium containing the benzyl resistance, carrying out shaking culture at 37 ℃ and 180rpm for about 2h to enable the OD value of the bacterial liquid to reach 0.4-0.6, taking 1mL of the bacterial liquid, adding IPTG (final concentration is 1mM) for induction, taking 1mL of the bacterial liquid every 1h, 2h, 3h, 4h and 5h respectively during the induction, preparing samples, carrying out SDS-PAGE, and determining the optimal induction time of the recombinant protein.

7.2 distribution of recombinant proteins

Inducing the bacterial liquid in a large amount, centrifuging at 4500rpm for 15min, discarding supernatant, collecting thalli sediment, washing with PBS twice, resuspending the sediment with about 40mL of supernatant Binding Buffer, standing overnight at-20 ℃, crushing with an ultrasonic instrument the next day, centrifuging at 600W power for 20min at 2s working time and 5s interval, performing ultrasonic treatment for 30min at 4 ℃ and 8000rpm for 20min, respectively collecting supernatant and sediment, dissolving the sediment with inclusion Binding Buffer at 4 ℃ overnight, and performing SDS-PAGE to determine the distribution condition of recombinant protein.

8. Purification and renaturation of recombinant proteins

Dissolving the precipitate of the thallus after ultrasonic treatment and centrifugation by using an inclusion body Binding Buffer, centrifuging for 20min at 8000rpm at 4 ℃, collecting the supernatant, filtering for later use by using a 0.22 mu m filter, balancing a His protein affinity chromatographic column by using the inclusion body Binding Buffer with 8 times of the volume of resin, slowly passing the filtered protein sample through the chromatographic column, washing the hybrid protein by using the inclusion body Binding Buffer with 8 times of the volume of resin, and finally slowly eluting the target protein by using 30mL of the inclusion body Elution Buffer. SDS-PAGE detects the purification effect of the protein. Filling the well-purified inclusion body protein into a dialysis bag boiled in boiling water, immersing into a renaturation buffer solution containing urea with gradient concentration (6M, 4M, 2M and 0M) for renaturation, and finally dialyzing in potassium-free PBS. After dialysis, the mixture was concentrated to a suitable volume in PEG 20000, and the protein concentration was measured by BCA kit, filtered to remove bacteria, and packaged into protein bags, and stored at-70 ℃ for further use.

Preparation of rHCA59 PLGA nanoparticles

(1) Polymer nanoparticles were prepared under sterile conditions, and the recombinant protein HCA59(1mg/mL) was dissolved in a 6% (w/v) PVA solution to form an internal aqueous phase (2 mg of protein dissolved in 2mL of PVA solution).

(2) Methylene chloride (50mg PLGA in 1mL methylene chloride) dissolved 5% (w/v) PLGA to obtain an organic phase.

(3) To form a w/o emulsion, the internal aqueous and organic phases were combined and sonicated in an ice bath for 4min with a sonicator (40w, 5s, 5 s).

(4) The w/o emulsion was then transferred to an external aqueous phase containing 6% (w/v) PVA dissolved in deionized water and sonicated again for 4min (40w, 5s, 5s) to obtain the final w/o/w emulsion. Finally, the organic solvent was evaporated to form nanoparticles by stirring at room temperature for 4 h.

(5) The solution of nanoparticles was centrifuged at 40000rpm for 40min at 4 ℃ and then the supernatant was collected, the protein loading efficiency was calculated by measuring the amount of protein in the supernatant using the BCA protein assay kit, and then the precipitated nanoparticles were washed twice with ultrapure water and centrifuged.

(6) Thereafter, the nanoparticles were placed in a lyophilizer for 24h, and the vaccine was subsequently stored in a-80 degree refrigerator prior to use.

Example 2 immunoprotection assay for a nanomaterial subunit vaccine against Haemonchus contortus

1. Design of experiments

Mice were randomly assigned to 3 groups of 8 mice each and vaccinated only once on day 0. Mice were sacrificed on day 14. The 3 groups are PBS group, rHCA59 group, and rHCA59-PLGA group. Multiple Subcutaneous (SC) injections were performed using 1ml of vaccine (content 20. mu.g rHCA59 protein). .

2. Observation of immunoprotective Effect

2.1 detection of antibodies in serum

(1) Mouse antisera were collected on day 14 and sacrificed. Antibody testing was performed by ELISA. Serum samples were assayed for levels of IgG1, IgM, and IgG2a using a mouse ELISA kit according to the manufacturer's instructions (HengYuan, Shanghai, China).

(2) Briefly, wells of a 96-well microtiter plate were coated with purified antibodies (anti-mouse IgG1, IgG2a or IgM) and mouse serum samples diluted in PBS were added to the wells at 37 ℃ for 30 min.

(3) After washing with PBST, wells were incubated with HRP-conjugated anti-mouse antibody, which was used to determine antibody levels and isotype analysis, respectively.

(4) After addition of 200. mu.l of substrate solution, use 2M H₂SO₄The reaction was terminated. Each plate included positive and negative controls. Finally, the results were observed at an absorbance of 450 nm.

2.2 detection of cytokines in serum

The content of cytokines IL-4, IL-12, IL-17, IFN-. gamma.and TGF-. beta.contained in sera from the different groups was measured with a commercial ELISA kit (HengYuan, Shanghai, China) according to the manufacturer's instructions and the results are shown in Table 1.

2.3 analysis of lymphocyte phenotype

Splenic lymphocyte proliferation assay for assessing rHCA 59-specific lymphocyte activation^[15]On day 14, spleens were lethally harvested from 8 mice per group, and splenic lymphocytes were isolated under sterile conditions using a mouse splenic lymphocyte isolation kit, adjusting the cell concentration to 1 × 10⁷cells/mL, then cultured overnight in 6-well cell plates after which cell supernatants (T cells and B cells) were collected and adjusted to a concentration of 1 × 10⁶cells/mL. then, 100ul of RPMI-1640 medium (1 × 10) containing 10% heat-inactivated fetal bovine serum, 100U/ml penicillin and 100mg/ml streptomycin in the corresponding proportions was added to each well of the 96-well culture plate⁷Individual cells). And stimulated with 2. mu.g/mL rHCA59 for 72 h. In addition, medium without rHCA59 protein was used as a blank. Then, T cell typing changes were detected by flow cytometry. Detecting CD4⁺T cell percentages were determined using antibodies anti-CD3e-APC and anti-CD 4-FITC. Detecting CD8⁺Percentage of T cells antibodies anti-CD3e-APC and anti-CD8a-FITC were used and the results are shown in Table 2.

2.5 analysis of dendritic cell phenotype

Splenocytes were isolated using a mouse spleen lymphocyte isolation kit, and the cells of the mixture were cultured overnight. Then, the cell supernatant was discarded and washed with PBS. After that, adherent cells were gently blasted and collected by centrifugation, washed 2 times with PBS and finally observed by FACS Calibur flow cytometer. The content of CD83 on DC was determined using anti-CD11c-APC and anti-CD 83-PE. The CD86 content on DC was determined using anti-CD11c-APC and anti-CD86-PE, and the results are shown in Table 2.

TABLE 1

TABLE 2

The results show that rHCA59-PLGA can stimulate mice to secrete higher-level IgG2a, IgM, IL-4, IL-12, IL-17, TGF- β and IFN-gamma and can induce spleenSignificant proliferation of visceral T cells, CD4 in splenic lymphocytes⁺And CD8⁺Significantly increased, expression of CD83 and CD86 on DC cells was significantly increased. The rHCA59-PLGA is proved to be capable of obviously improving the immunoprotection.

Example 3 immunoprotection assay for A nanomaterial subunit vaccine against Haemonchus contortus

1. Design of experiments

15 goats (3-6 months old) are divided into 3 groups, and each group comprises 5 goats, namely a Haemonchus contortus nano-material subunit vaccine rHCA59-PLGA group (immune and insect attack), a positive control group (only insect attack and no immune), and a negative control group (no insect attack and no immune).

The experimental groups were first and second immunizations with 500. mu.g of the subunit vaccine of Haemonchus contortus nanomaterial in 1mL of PBS on days 0 and 14, respectively. On day 28, the goats in the experimental and positive control groups were infected with 8000 third-stage larvae of Haemonchus contortus. Goats were slaughtered on day 63. After attacking the insects, the feeding condition, the fur and the mental state of the sheep are closely observed.

2. Observation of immunoprotective Effect

2.1 reduction rate of egg discharge

On the 50 th, 52 th, 54 th, 56 th, 58 th, 60 th and 62 th days of the experiment, the excrement of the goat rectum is collected, the collected excrement is counted by a McLeod counting method, and the egg discharge dynamic is counted.

The egg reduction rate is (average number of eggs per gram of fecal insects in the positive control group-average number of eggs per gram of fecal insects in the rHCA59 experimental group)/average number of eggs per gram of fecal insects in the positive control group is multiplied by 100%.

The results (fig. 7) show that the immunization group of the nanomaterial subunit vaccine of haemonchus contortus began to shed eggs at 50 days of the experiment, then increased all the time, reached the peak of egg shedding at 54 days, and then began to fall back. The average egg output of the haemonchus contortus nanomaterial subunit vaccine immunized group was reduced by 44.1% (P <0.001) compared to the positive control group throughout the entire experiment.

2.2 adult reduction rate

The goats were sacrificed on day 63 of the experiment and the adults in the abomasum were picked and counted for total number of males and females.

The male worm reduction rate is (average male worm number of positive control group-average male worm number of rHCA59 experimental group)/average male worm number of positive control group is multiplied by 100%.

The reduction rate of the female insects is (average female insect number of the positive control group-average female insect number of the rHCA59 experimental group)/the average female insect number of the positive control group is multiplied by 100%.

The reduction rate of the imagoes is (average imagoes number of the positive control group-average imagoes number of the rHCA59 experiment group)/the average imagoes number of the positive control group is multiplied by 100%.

The results show that compared with the positive control group, the number of female worms in crinkles and stomachs of the goats of the rHCA59-PLGA group is reduced by 52.5 percent (P <0.01), the number of male worms is reduced by 58.6 percent (P <0.01), and the total number of adults is reduced by 54.6 percent (P < 0.01).

Amount of epizoon gomphrena

Note: the experimental results represent the amount of the 5 goat epizoon in the rHCA59-PLGA and positive control group.

Data are shown as mean ± SD, with differences between groups expressed as (./P <0.05) from the positive control group.

Sequence listing

<110> Nanjing university of agriculture

<120> haemonchus contortus nano-material subunit vaccine and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>141

<212>PRT

<213>Haemonchus contortus

<400>1

Met Thr Glu Phe Phe Ser Arg Glu Gln Ile Asn Glu Ile Arg Glu Cys

1 5 10 15

Phe Asn Val Tyr Ser Gln Asp Gly Ile Val His Ser Ala Pro Gln Leu

20 25 30

Arg Cys Ile Leu Arg Ser Leu Gly Tyr Ser Pro Thr Ala Ala Lys Thr

35 40 45

Ala Ala Tyr Phe Ser Lys Ile Lys Gln Pro Met Asn Phe Ala Ala Phe

50 55 60

Leu Glu Ile Ala Lys Glu Glu His Asn Ser Gly Asp Glu Leu Thr Glu

65 70 75 80

Ile Ile Lys Ala Leu Lys Gly Leu Asp Arg Ser Gly Thr Arg Ser Ile

85 90 95

Pro Val Gln Glu Leu Arg Ser Ile Leu Ala Ser Ile Gly Glu Arg Met

100 105 110

Ser His Gln Glu Ile Asp Leu Val Leu Lys Gln Val Ala Val Gly Gly

115 120 125

Ile Val Pro His Gln Lys Leu Ile Glu Tyr Phe Ser Arg

130 135 140

<210>2

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

aaggatccat gacggaattc ttctcgcg 28

<210>3

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ccaagcttcc tcgagaagta ttcgatgagc ttc 33

<210>4

<211>426

<212>DNA

<213> Haemonchus contortus (Haemonchus contortus)

<400>4

atgacggaat tcttctcgcg tgagcagatc aatgagatcc gtgaatgttt caatgtgtac 60

agccaagatg ggatcgtaca ctcggcacct cagctgaggt gcatcctgcg aagccttggc 120

tactcgccaa ctgctgccaa gaccgcagcg tacttctcca aaatcaagca gccaatgaac 180

ttcgcagcat ttctcgaaat tgccaaagag gaacataaca gcggtgacga gcttacggaa 240

atcatcaagg ccttaaaagg actggacaga tctggcactc gttcgatacc tgtgcaagaa 300

cttcgctcta tactagcatc aattggggaa cgtatgagcc accaggagat agatttagtg 360

ctgaagcagg ttgctgtcgg tggtatagtt ccgcaccaga agctcatcga atacttctcg 420

aggtag 426

Claims

1. A nanometer material subunit vaccine of Haemonchus contortus is prepared by wrapping Haemonchus contortus recombinant protein HCA59 with nanometer material PLGA; the recombinant HCA59 protein has an amino acid sequence shown in SEQ ID NO. 1.

2. The nanomaterial subunit vaccine of haemonchus contortus according to claim 1, prepared by the following steps:

1) preparing 6% polyvinyl alcohol;

2) preparing 0.05g/mL PLGA dichloromethane solution as an organic phase;

3. The method of preparing a nanomaterial subunit vaccine for haemonchus contortus according to claim 1, comprising the steps of:

1) preparing 6% polyvinyl alcohol;

2) preparing 0.05g/mL PLGA dichloromethane solution as an organic phase;

4. The method according to claim 3, wherein in step 4), the power of the ultrasonic crusher is set to 40W, the ultrasonic treatment is carried out for 5s, the interval is 5s, and the ultrasonic treatment time is 4 min.

5. The method according to claim 3, wherein the centrifugation is carried out at 40,000r/min at 4 ℃ for 40min in step 5).

6. The method according to claim 3, wherein the recombinant protein HCA59 is produced by: extracting total RNA of haemonchus contortus, carrying out reverse transcription on the extracted RNA to obtain cDNA, designing open reading frames of PCR primers SEQ ID NO.2 and SEQ ID NO.3 amplification HCA59 protein coding genes according to the sequence of SEQ ID NO.1, and connecting the amplified PCR product with a cloning vector pMD-19T by using DNA ligase to obtain a sequencing vector pMD-19T-HCA59 recombinant plasmid; extracting a large amount of recombinant plasmids and expression vectors pET-32a (+) which are sequenced correctly, selecting the same endonuclease for double digestion, and connecting target genes with the pET-32a (+) vectors by using T4 ligase to obtain recombinant plasmids pET-32a-HCA 59; amplifying the recombinant plasmid in a large quantity, and transforming the recombinant plasmid into escherichia coli BL21(DE3) to obtain escherichia coli containing pET-32a-HCA59 recombinant plasmid; and (2) placing the escherichia coli in an LB liquid culture medium for large-scale amplification, adding IPTG (isopropyl-beta-thiogalactoside), continuing to culture to induce the expression of the recombinant protein H2A1, recovering the thalli through centrifugation, carrying out ultrasonic crushing, carrying out centrifugal separation on the thalli subjected to ultrasonic treatment, precipitating, dissolving in a Binding Buffer, filtering through a 0.22-micron filter membrane, and purifying the recombinant protein through a His-labeled protein purification column to obtain the recombinant protein HCA 59.

7. Use of the nanomaterial subunit vaccine of haemonchus contortus according to claim 1 in the manufacture of a medicament for the prevention of haemonchus contortus disease in sheep.