CN113577261B

CN113577261B - Preparation and application of recombinant protein Bfra nano-particles

Info

Publication number: CN113577261B
Application number: CN202110882135.5A
Authority: CN
Inventors: 周向梅; 刘一朵; 梁正敏
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2021-08-02
Filing date: 2021-08-02
Publication date: 2023-10-31
Anticipated expiration: 2041-08-02
Also published as: CN113577261A

Abstract

The application provides a method for prokaryotic expression of mycobacterium paratuberculosis antigen protein Bfra, a method for preparing recombinant protein Bfra-PLGA nano particles and application thereof in preventing paratuberculosis. The recombinant protein Bfra was expressed by E.coli prokaryotic by amplifying the Mycobacterium paratuberculosis MAP1595 gene, ligating it to pET-30a (+). And encapsulating the obtained recombinant protein Bfra into a high polymer material PLGA by an improved multiple emulsion volatilization method to prepare the nano-particle Bfra-PLGA. The prepared Bfra-PLGA nano particles are used for immunizing mice, and have good protection effects at 8 weeks and 12 weeks after the infection of the mycobacterium paratuberculosis.

Description

Preparation and application of recombinant protein Bfra nano-particles

Technical Field

The application belongs to the field of vaccines, and particularly provides a method for prokaryotic expression of mycobacterium paratuberculosis antigen protein Bfra, a method for preparing recombinant protein Bfra-PLGA nano particles and application of the recombinant protein Bfra-PLGA nano particles in preventing paratuberculosis.

Background

The paratuberculosis is a ruminant irreversible and chronic consumable disease caused by mycobacterium paratuberculosis (Mycobacterium avium subspecies paratuberculosis, MAP) of mycobacterium avium subspecies, the incubation period of the disease is longer and can reach 2-5 years, the main symptoms are chronic proliferative enteritis, and symptoms such as fold, weight loss, milk yield and fertility decline are formed along with intractable diarrhea and intestinal mucosa thickening, and the animal can die due to chronic failure caused by serious illness. The paratuberculosis is considered as one of the most serious diseases affecting the dairy industry, and in recent years, the onset condition of the paratuberculosis in China is rapidly increased, and great impact is brought to the dairy industry and dairy industry in China. However, the whole-cell inactivated vaccine of MAP is only available in the market at present, but can not completely block the infection of paratuberculosis and has serious side effects, so that the injection site forms a lump. Therefore, the development of a novel subunit vaccine has important significance for the prevention and control of the mycobacterium paratuberculosis.

Bfra, also known as cytochrome b1, is the primary iron storage protein of bacteria. Antigen D of Mycobacterium paratuberculosis is identified as Bfra and is capable of enriching, managing and storing iron ions, maintaining the balance of intracellular iron ions of MAP and enhancing the survival ability of MAP. Bfra is currently widely reported as a T lymphocyte antigen that induces IFN-gamma to be expressed in large amounts and lymphocyte proliferation. In addition, the DNA vaccine for encoding Bfra and the recombinant Bfra protein can induce obvious humoral immune response when used for immunizing mice, and further has a certain protective effect on the mice.

PLGA is a degradable high molecular organic compound formed by randomly polymerizing two monomers of lactic acid and glycolic acid, and has the advantages of no toxicity, good biocompatibility and capability of forming capsules and films. PLGA has been approved by the food and drug administration (Food and Drug Administration, FDA) as a delivery vehicle for vaccines and drugs due to its excellent safety in the human and animal body.

Disclosure of Invention

The applicant tried to prepare PLGA particles with various antigens/vaccines, found that only a part of the antigens/vaccines was suitable to prepare the form (e.g., the preparation of the MAP antigen HBHA into PLGA particles was not effective), studied to prepare nanoparticles for preventing paratuberculosis using PLGA-entrapped recombinant mycobacterium paratuberculosis antigen protein Bfra, and confirmed that they can be used as a novel nano-subunit paratuberculosis vaccine.

In one aspect, the application provides a recombinant protein Bfra nanoparticle, which is characterized in that the recombinant protein Bfra nanoparticle is PLGA-entrapped recombinant antigen protein Bfra of mycobacterium paratuberculosis.

Further, the nucleic acid sequence of the mycobacterium paratuberculosis antigen protein Bfra is SEQ ID NO.1.

Further, the nanoparticle preparation process includes: the preparation method comprises the steps of protein recombinant expression and nanoparticle preparation, wherein the nanoparticle preparation step comprises the steps of dripping a protein solution into PLGA ethyl acetate solution, preparing colostrum, preparing pre-multiple emulsion, preparing multiple emulsion and freeze-drying.

Further, the concentration of the protein solution is 2-4mg/mL when the protein solution is added dropwise to the PLGA ethyl acetate solution.

Further, the nanoparticle preparation step specifically comprises:

1) Weighing 0.2g of PLGA, dissolving in 4.5mL of ethyl acetate, and shaking and mixing until the PLGA is completely dissolved;

2) Extracting 0.5mL of target protein solution with a syringe, dripping the target protein solution into the ethyl acetate solution prepared in the previous step to form micro-droplets, and then placing the micro-droplets into ice water;

3) Preparing colostrum: performing ultrasonic emulsification on the solution prepared in the second step under ice bath condition, wherein the ultrasonic condition is 300W, the total time is 4min, the working is 2s, and the operation is stopped for 3s;

4) Preparing pre-compound emulsion: pouring the prepared colostrum into 10mL of 1% PVA solution, performing ultrasonic emulsification under ice bath condition, wherein the ultrasonic condition is 300W, the total time is 6min, working is 2s, and stopping for 3s;

5) Pouring the prepared pre-compound emulsion into 10mL of 0.5% PVA solution to prepare compound emulsion; stirring at 300-400rpm at room temperature for 4h to volatilize the oil phase;

6) Centrifuging the obtained nanoparticle solution in a high-speed refrigerated centrifuge for 3min under 12000r/min, removing supernatant, adding distilled water, washing for 2 times, removing supernatant, and storing at 4deg.C for several days or vacuum lyophilizing at-80deg.C to obtain microsphere powder.

Further, the recombinant expression steps of the protein are as follows:

bfra was added with 5'EcoRI and 3' HindIII at both ends of the gene sequence, ligated to prokaryotic expression vector pET-30a (+) by double digestion, and transformed into E.coli competent cell BL21 (DE 3), the bacteria were cultured with LB medium containing kanamycin at a final concentration of 50. Mu.g/mL to a logarithmic growth phase of OD600nm of 0.6-0.8, IPTG at a final concentration of 1mM was added, shaking table at 30℃and 160rpm, induced expression was performed for 4h,4℃and centrifugation at 8000rpm for 3min to collect the cells, and washed twice with pre-chilled PBS, the cells were resuspended and sonicated with PBS, lysed, and centrifuged at 10000rpm for 10min to obtain a lysate. Purifying the cleavage supernatant by Ni column affinity chromatography to obtain recombinant protein Bfra.

On the other hand, the application provides application of the recombinant protein Bfra nano-particles in preparing paratuberculosis vaccines.

On the other hand, the application provides a paratuberculosis vaccine which is characterized by comprising the recombinant protein Bfra nano-particles and auxiliary materials.

Further, the vaccine can reduce the bacterial load of the vaccinated subjects after infection.

Further, the vaccine can promote TNF-alpha, IL-10, IFN-gamma and antibody IgG secretion after infection of an vaccinated subject.

The Bfra protein sequence in the present application is not limited to SEQ ID NO.1, and Bfra protein sequences having differences in nucleic acid sequence and even amino acid sequence of other MAP may be used.

The nanoparticles/vaccines of the present application are preferably used by injection, but it is not excluded that the nanoparticles/vaccines are administered orally, nasally, etc. after selection of the appropriate carrier and formulation.

Adjuvants of the present application may be selected from known or developed varieties according to conventional knowledge in the vaccine art by those skilled in the art, including but not limited to adjuvants, solvents, co-solvents, buffers, antioxidants, preservatives

Drawings

FIG. 1 shows purified recombinant protein Bfra by SDS-PAGE and Western blot;

FIG. 2 is a representation of Bfra-PLGA nanoparticles;

FIG. 3 is an immune evaluation of nanoparticles;

FIG. 4 shows liver load of mice.

Detailed Description

EXAMPLE 1 construction of prokaryotic expression vectors for Bfra protein

The MAP1595 gene of the K-10 standard strain of Mycobacterium paratuberculosis was amplified as follows:

ATGCAAGGGGATCCGGAAGTTTTGCGTCTGCTCAACGAGCAGCTGACCAGCGAACTCACCGCGATCAACCAATACTTCCTGCACTCCAAGATGCAGGACAACTGGGGGTTCACCGAGTTAGCTGAGCACACCCGGGCCGAGTCCTTCGACGAGATGCGCCACGCCGAGGCGATCACCGACCGCATCCTGCTGCTCGACGGGTTGCCGAACTATCAGCGCCTGTTCTCGCTGCGCATCGGCCAGACGCTGCGCGAGCAGTTCGAGGCCGACCTGGCCATCGAATACGAGGTGATGGACCGGCTCAAGCCGGCCATCATCCTGTGCCGGGAGAAGCAGGACTCCACCACCGCCACGCTTTTCGAGCAGATCGTCGCCGACGAGGAAAAGCACATCGACTACCTGGAGACGCAGCTGGAGTTGATGGACAAGCTGGGCGTGGAGCTCTACTCGGCGCAGTGCGTGTCGCGGCCACCGAGC(SEQ ID NO.1)。

the restriction sites 5 '(EcoRI) and 3' (HindIII) were added to both ends of the above gene sequence, ligated to the prokaryotic expression vector pET-30a (+) by double restriction, and transformed into E.coli competent cells BL21 (DE 3), the bacteria were cultured in LB medium containing kanamycin (final concentration of 50. Mu.g/mL) to logarithmic phase (OD 600nm of 0.6-0.8), IPTG (final concentration of 1 mM) was added, shaking table at 30℃and 160rpm, induced expression was performed for 4h, centrifugation at 8000rpm for 3min, and cells were collected by washing twice with pre-chilled PBS, resuspended and sonicated with PBS, lysed, and centrifuged at 10000rpm for 10min to obtain a lysate. Purifying the cleavage supernatant by Ni column affinity chromatography to obtain recombinant protein Bfra.

Purified Bfra protein was subjected to SDS-PAGE gel electrophoresis and coomassie blue staining, which showed that purified Bfra was more than 90% pure (fig. 1A), and Western blot identification was performed with MAP positive serum from mice infected, which showed that a single band was visible on NC membrane, conforming to the expected size (fig. 1B).

EXAMPLE 2 preparation of recombinant protein Bfra-PLGA nanoparticles

1) Weighing 0.2g of PLGA, dissolving in 4.5mL of ethyl acetate, shaking and mixing until the PLGA is completely dissolved, and filtering to remove precipitate;

2) Extracting 0.5mL of a protein solution (2-4 mg/mL, and a plurality of concentration experiments show that the excessive protein concentration is easy to cause the precipitation of nano particles) by using a syringe, dripping the solution into the ethyl acetate solution prepared in the previous step to form micro-droplets, and then placing the micro-droplets into ice water;

EXAMPLE 3 characterization of recombinant protein Bfra-PLGA nanoparticles

And dispersing a proper amount of microsphere powder with a small amount of deionized water, uniformly spreading on a corresponding metal plate of the instrument, drying at normal temperature, spraying gold, and observing the morphology of the microspheres under a scanning electron microscope. Taking a small amount of microsphere powder, re-dissolving with deionized water to uniformly disperse the microsphere powder, placing the microsphere powder into a dynamic optical particle analyzer according to the specification, and analyzing data by using Malvern Instrument software.

As shown in FIG. 2, the average particle size of the prepared Bfra-PLGA nanoparticles was about 230nm, and the potential was-21.2 mV. The nanoparticle encapsulation efficiency was calculated to be 81% after measurement using an ultraviolet spectrophotometer. The scanning electron microscope result shows that Bfra-PLGA nano particles have uniform size and are spherical with smoother surfaces.

EXAMPLE 4 evaluation of the immunogenicity and protective Properties of recombinant protein Bfra-PLGA nanoparticles

The C57BL/6 mice were randomly divided into 4 groups of 15 animals each, PBS group (PBS), bfra group (Bfra), blank pellet group (PBS-PLGA) and Bfra-PLGA nanoparticle group (Bfra-PLGA), respectively. The immunization mode is as follows: injecting 100 mu l PBS/1 into PBS group, injecting 100 mu l (100 mu g/1) of recombinant protein Bfra into Bfra group, injecting 100 mu l PBS-PLGA into blank particle group (PBS redissolution, 5 mg/1), injecting 100 mu l Bfra-PLGA into Bfra-PLGA group (PBS redissolution, 5 mg/1); each group was immunized three times, two weeks apart, and after the last immunization, 5 mice were randomly selected for detection of relevant immune indicators. The toxin attacking mode is as follows: two weeks after the last immunization, each group of mice was intraperitoneally injected with 100 μl of 10 ⁸ CFU/MAP only (2015 WD-1 strain); after 8 weeks of virus attack, 5 mice are randomly selected for each group to carry out subsequent detection by taking section samples; after 12 weeks of challenge, 5 mice per group were randomly selected for follow-up testing by dissecting samples.

The results in FIG. 3 show that Bfra-PLGA significantly promoted secretion of cytokines TNF- α, IL-10 and antibody IgG in serum (FIG. 3A, B, C) and IFN- γ in spleen cell supernatant (FIG. 3D).

The results of detecting the liver bacterial load of the mice after MAP challenge for 8 weeks (figure 4) show that compared with the PBS group, the liver bacterial load of the Bfra-PLGA group is obviously reduced (figure 4A); the results of detecting the liver bacterial load of the mice after MAP challenge for 12 weeks show that compared with the PBS group, the PBS-PLGA group, the Bfra group and the Bfra-PLGA group have obviously reduced liver bacterial load of the mice, and the Bfra-PLGA group has most obvious reduction.

Sequence listing

<110> Chinese university of agriculture

<120> preparation and application of recombinant protein Bfra nanoparticle

<130> aaaaa

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 477

<212> DNA

<213> artificial sequence

<400> 1

atgcaagggg atccggaagt tttgcgtctg ctcaacgagc agctgaccag cgaactcacc 60

gcgatcaacc aatacttcct gcactccaag atgcaggaca actgggggtt caccgagtta 120

gctgagcaca cccgggccga gtccttcgac gagatgcgcc acgccgaggc gatcaccgac 180

cgcatcctgc tgctcgacgg gttgccgaac tatcagcgcc tgttctcgct gcgcatcggc 240

cagacgctgc gcgagcagtt cgaggccgac ctggccatcg aatacgaggt gatggaccgg 300

ctcaagccgg ccatcatcct gtgccgggag aagcaggact ccaccaccgc cacgcttttc 360

gagcagatcg tcgccgacga ggaaaagcac atcgactacc tggagacgca gctggagttg 420

atggacaagc tgggcgtgga gctctactcg gcgcagtgcg tgtcgcggcc accgagc 477

Claims

1. An application of recombinant protein Bfra nano-particles in preparing paratuberculosis vaccines, wherein the recombinant protein Bfra nano-particles are PLGA-entrapped recombinant antigen protein Bfra of paratuberculosis mycobacteria; the nucleic acid sequence of the recombinant antigen protein Bfra of the mycobacterium paratuberculosis is SEQ ID NO.1;

the preparation process of the recombinant protein Bfra nano-particles comprises the following steps:

2) Extracting 0.5mL of 2-4mg/mL of recombinant antigen protein Bfra solution of mycobacterium paratuberculosis by using a syringe, dripping the solution obtained in the step 1) to form micro-droplets, and then placing the micro-droplets in ice water;

3) Preparing colostrum: performing ultrasonic emulsification on the solution obtained in the step 2) under ice bath conditions, wherein the ultrasonic conditions are 300W, the total time is 4min, the operation is 2s, and the operation is stopped for 3s to obtain colostrum;

4) Preparing pre-compound emulsion: pouring the colostrum obtained in the step 3) into 10mL of 1% PVA solution, performing ultrasonic emulsification under ice bath condition, wherein the ultrasonic condition is 300W, the total time is 6min, working is 2s, and stopping for 3s to obtain pre-compound emulsion;

5) Pouring the pre-compound emulsion obtained in the step 4) into 10mL of 0.5% PVA solution to prepare compound emulsion; stirring at 300-400rpm at room temperature for 4h, volatilizing the oil phase to obtain nanoparticle solution;

6) Centrifuging the nanoparticle solution obtained in the step 5) in a high-speed refrigerated centrifuge for 3min under the centrifugation condition of 12000r/min, discarding the supernatant, adding distilled water for washing, cleaning for 2 times, discarding the supernatant, and preserving at 4 ℃ for a while or drying at-80 ℃ in a vacuum freeze dryer to obtain microsphere powder;

the expression steps of the recombinant antigen protein Bfra of the mycobacterium paratuberculosis are as follows:

adding enzyme cutting sites 5'EcoRI and 3' HindIII at two ends of Bfra gene with a nucleic acid sequence of SEQ ID NO.1, connecting to a prokaryotic expression vector pET-30a (+) through double enzyme cutting, converting into escherichia coli competent cells BL21 (DE 3), culturing bacteria to a logarithmic growth phase with OD600nm of 006-000 by using LB culture medium containing kanamycin with a final concentration of 50 mug/mL, adding IPTG with a final concentration of 1mM, shaking table at 30 ℃,160rpm, carrying out induced expression for 4h,4 ℃ at 0000rpm for 3min, collecting thalli, washing twice by precooling PBS, re-suspending thalli by PBS and carrying out ultrasonic treatment, lysing, centrifuging at 10000rpm for 10min, and obtaining a lysate; purifying the cleavage supernatant by Ni column affinity chromatography to obtain the recombinant antigen protein Bfra of the mycobacterium paratuberculosis.