CN111549032A - Construction method of inducible spermatogonium Tubb4b gene knockout cell line - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and relates to a SgRNA guide sequence for knocking out a mouse Tubb4b gene, a Tubb4b gene knockout cell line for inducing spermatogonium and a construction method thereof. The invention provides an efficient Tubb4b gene knockout guide sequence, has high knockout efficiency and achieves ideal effect. The cell line established by the invention and the construction method thereof can be widely applied to Tubb4b and related gene function research and product development and application.

Description

Construction method of inducible spermatogonium Tubb4b gene knockout cell line

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a SgRNA guide sequence for knocking out a mouse Tubb4b gene, an inducible spermatogonium Tubb4b gene knockout cell line and a construction method thereof.

Background

Primary Germ Cells (PGCs) are present in mammals, and these PGCs can differentiate into spermatogonia in male animals and meiotic progenitors in female animals. Within the days of male birth, part of PGCs can migrate due to pseudopodia, migrate to the basal membrane of the seminiferous tubule, differentiate into spermatogonial stem cells, undergo mitosis and meiosis, and form sperms. Microtubules are initially found in the flagella of sperm and affect the process of spermatogenesis. Microtubules are long tubular organelle structures assembled from fibrils in eukaryotic cells, including 7 types of proteins, α -Tubulin, β -Tubulin, γ -Tubulin, ζ -Tubulin, and η -Tubulin, which are skeletal fibers of cells and are involved in cellular processes such as maintenance of cell morphology, control of cell movement, cell division, and transport of intracellular material. TUBB4B is a protein on the microtubule β -tubulin subunit, and studies have shown that it is highly expressed in mouse testicular tissue, provides structural support for a large number of germ cells, and may affect the process of spermatogenesis in males. However, there are few studies on TUBB4B protein to date, and how TUBB4b plays a role in the process of mouse spermatogenesis still needs further research, and its related functions and mechanisms of action still remain to be elucidated. The method is characterized in that an inducible TUBB4B knocked-out spermatogonium is constructed by applying CRISPR/Cas9 technology, the regulation and control effect of TUBB4B-KO on spermatogonial gene expression can be better explored, a key signal path and mechanism of TUBB4B regulation and control are analyzed, a good cell model is provided for the later research of the function of Tubb4b gene, and the method has important significance for the research of molecular mechanism of spermatogonium.

Disclosure of Invention

Based on the above, in order to overcome the defects of the prior art, the invention provides a SgRNA targeting sequence for efficiently knocking out Tubb4b gene, a Tubb4b gene knockout cell line for conditionally inducing spermatogonium and a construction method thereof.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

in one aspect, the invention provides a SgRNA guide sequence for knocking out Tubb4b gene, wherein the SgRNA guide sequence has a base sequence shown as SEQ ID No. 1.

In another aspect, the invention also provides an expression vector containing the SgRNA guide sequence. In a preferred embodiment, the expression vector is pLVX-EGFP-mU6-Tubb4 b-SgRNA. In a more preferred embodiment, the expression vector has a base sequence represented by SEQ ID No. 8.

On the other hand, the invention also provides a CRISPR-Cas9 expression system for knocking out mouse Tubb4b gene, which comprises the expression vector and a transcription vector of Cas9 protein.

On the other hand, the invention also provides a kit, and the kit is the SgRNA guide sequence or the expression vector or the expression system.

On the other hand, the invention also provides application of the SgRNA guide sequence, the expression vector, the expression system or the kit in preparing a Tubb4b gene knockout mouse cell.

In another aspect, the present invention provides a method for conditionally inducing Tubb4b gene knockout in mice, comprising the following steps:

(1) respectively taking pmU6-gRNA and pLX-sgRNA-EGFP vectors as templates and SEQ ID Nos. 4-5 and SEQ ID Nos. 6-7 as primers, and amplifying to obtain an mU6 fragment and a Tubb4b-sgRNA fragment; performing overlapping PCR amplification by using the mU6 fragment and Tubb4b-sgRNA fragment as templates and SEQ ID No.4 and SEQ ID No.7 as primers to obtain an mU6-Tubb4b-sgRNA fragment;

(2) performing double enzyme digestion on an mU6-Tubb4b-SgRNA fragment by XhoI and NheI to obtain an mU6-Tubb4b-SgRNA viscous terminal fragment, then connecting the mU6-Tubb4b-SgRNA viscous terminal fragment into a pLVX-EGFP-hU6-SgRNA vector framework with an hU6-SgRNA sequence removed, connecting and transforming to construct a pLVX-EGFP-mU6-Tubb4b-SgRNA lentiviral vector;

(3) purifying and packaging the pLVX-EGFP-mU6-Tubb4b-SgRNA lentiviral vector obtained in the step (2) to obtain a Tubb4 b-sgRNA-EGFP-carrying lentivirus, and infecting a Tet-on to regulate and express a Cas9 expression spermatogonial cell line by using the lentivirus, so as to construct and obtain the conditionally induced mouse spermatogonial Tubb4b gene knockout cell line.

In another aspect, the invention also provides a Tubb4b gene knockout cell line of mouse spermatogonium prepared by the method.

Compared with the prior art, the invention has the following beneficial effects: according to the invention, spermatogonium is taken as a research object, a cell line for knocking Tubb4b gene by Dox induction is constructed by combining a CRISPR/Cas9 system, and the result shows that after induction, Tubb4b gene in cell genome can be cut, and the cutting does not occur before induction, and the cell line is a cell model for researching Tubb4b regulation and control reproductive development, and can be applied to scientific research and drug research and development. Compared with the conventional CRISPR/Cas9 system gene knockout method, the method provided by the invention adopts an inducible knockout technology, especially designs and constructs Tubb4b guide sequence, has high knockout efficiency, and achieves ideal effect.

Drawings

FIG. 1 is a flow chart of a method for constructing a Tubb4b knockout cell line of spermatogonium induced according to example 1 of the present invention.

Fig. 2 is a graph of the detection result of adult mouse testis TUBB4B protein expression, wherein a: TUBB4B staining; b: negative control;

FIG. 3 mU6-Tubb4b-SgRNA fragment amplification, in which A: amplification of mU6 fragment (375 bp); b: tubb4b target sequence + SgRNA fragment (163bp) amplification; c: mU6+ Tubb4b + SgRNA sequence (518bp) is amplified;

FIG. 4 Tubb4b-SgRNA lentiviral vector lentiviral packaging, wherein: a: pattern diagram of conditional inducible expression of Cas9 lentiviral vector and Tubb4b-SgRNA vector; b and C: white light and fluorescence screened after the mU6-Tubb4b-SgRNA virus infects mouse spermatogonium Cas9 cells; d: merge results for B and C; E-L: detecting the virus titer;

FIG. 5 is a screen of a stable transgenic Tubb4B-SgRNA cell line, wherein A and B: white light and fluorescence map of mouse spermatogonium Cas9 cell screen expressing mU6-Tubb4 b-SgRNA; c: merge results for A and B. D and E: white light and fluorescence of mouse spermatogonium Cas9 cells stably expressing mU6-Tubb4 b-SgRNA; f: merge results for D and E;

FIG. 6 is a test of the effect of inducing Tubb4b-KO spermatogonium knockout, wherein A: tubb4b-KO genome sequencing analysis results before and after Dox induction; b: TUBB4B protein expression assay; c: tubb4b-KO efficiency analysis (92.3%).

Detailed Description

The present invention will be described in further detail below with reference to specific embodiments and with reference to the attached drawings. Nothing in this specification is said to apply to the prior art. The following specific examples of the present invention are given for illustrative purposes only and do not limit the scope of the claims of the present invention. The reagents and starting materials used in the following examples were all commercially available unless otherwise specified.

Please refer to fig. 1, which is a flowchart illustrating a method for constructing an induced murine spermatogonium Tubb4b knockout cell line according to the present invention, comprising the following steps:

1) expression of TUBB4B in mouse testis

The distribution of the TUBB4B protein in the mouse testis was detected by immunohistochemical techniques and was mainly expressed in the spermatogonium and sperm of the mouse testis (as shown in fig. 2, panel a, and fig. 2, panel B, a negative control). Thus, in later studies, the role of TUBB4B in male germ cells was studied using a spermatogonial cell line in which Tet-on regulates Cas9 expression.

2) mU6-Tubb4b-SgRNA fragment amplification

With reference to the gene sequence of Tubb4b in Ensembl database (ENSMUSG00000036752), the potential target sequence of Tubb4b-SgRNA was predicted from the webpage (http:// www.broadinstitute.org/rnai/public/analysis-tools/SgRNA-design-v 1).

The inventors designed a plurality of SgRNA targeting sequences, 3 target sequences listed in the following table 1 are all located at the downstream of the first exon ATG, and the SgRNA targeting sequence of SEQ ID No.1 is preferably selected from the target sequences, and experiments show that the sequence has the highest knockout rate.

Table 1:

target sequence numbering	Serial number	Target sequence fragment
			Tubb4b-KO-SgRNA target sequence 1	SEQ ID No.1	GGGTAGAGGAGCCTTACCGG
Tubb4b-KO-SgRNA target sequence 2	SEQ ID No.2	ATGGGGTAGAGGAGCCTTAC
			Tubb4b-KO-SgRNA target sequence 3	SEQ ID No.3	CTACAACGAAGCCACCGGTA

Applying pLVX-EGFP-hU6-SgRNA vector (Addgene company) to mouse cells, changing the human hU6 promoter (hU6, 266bp) into the mouse mU6 promoter (mU6, 316bp, shown in A picture of figure 3), firstly amplifying mU6 fragment (375bp, containing partial SgRNA sequence) and SgRNA fragment (163bp) (the primer has added enzyme cutting site and designed overlapping part; shown in B picture of figure 3); then mU6-Tubb4b-SgRNA (518 bp; as shown in FIG. 3C) was obtained by overlap PCR; the method comprises the following specific steps:

(1) respectively amplifying mU6 and Tubb4b-sgRNA fragments by using pmU6-gRNA (purchased from Addgene company, commercial product number 53187) and pLX-sgRNA-EGFP plasmids as templates and upstream of mU6 first segment (SEQ ID No.4), downstream of mU6 first segment (SEQ ID No.5) and upstream of Tubb4b-sgRNA second segment (SEQ ID No.6) and downstream of Tubb4b-sgRNA second segment (SEQ ID No.7) (shown in a sequence table 2), wherein the PCR system is shown in a table 3:

table 2: promoter modification and Tubb4b-sgRNA sequence amplification primer table

Table 3: mU6 and Tubb4b-sgRNA fragment amplification reaction system

Reagent	Amount used (μ L)
		2×Taq Master Mix	25
Upstream primer	1
		Downstream primer	1
Template pLX-sgRNA-EGFP	3
		ddH2O	To 50

The PCR reaction procedure is as in table 4:

table 4: PCR reaction procedure

The obtained PCR product was subjected to 1.3% agarose Gel electrophoresis and then Gel-recovered using the magenta Hipure DNAmini Kit (D2111-03).

(2) The mU6-Tubb4b-sgRNA sequences were obtained by an overlapping PCR method. PCR amplification is carried out by taking recovered mU6 and Tubb4b-sgRNA fragments as templates and taking upstream of the first segment of mU6 and downstream of the second segment of Tubb4b-sgRNA as primers. The reaction system is shown in the following table 5:

table 5: overlapping PCR reaction system

Reagent	Amount used (μ L)
		2×Taq Master Mix	25
mU6 first segment upstream primer	1
		Tubb4 b-downstream of the second SgRNA stage	1
mU6 fragment	1
		Tubb4b-sgRNA fragment	1
dd H2O	Up to 50

The reaction was carried out according to the PCR procedure of Table 3, and the reaction product was recovered according to step 1 to obtain fusion product mU6-Tubb4b-sgRNA fragment, whose concentration was measured by UV spectrophotometer and stored at-20 ℃.

3) pLVX-EGFP-mU6-Tubb4b-SgRNA vector construction

The mU6-Tubb4b-SgRNA fragment was digested with two restriction enzymes (XhoI and NheI) and reacted at 37 ℃ for 3h, then the mU6-Tubb4b-sgRNA cohesive end fragment was recovered and ligated into the pLVX-EGFP-hU6-SgRNA vector backbone digested with the hU6-SgRNA sequence by the same digestion (XhoI and NheI) using TaKaRa T4DNA Ligase ligation kit (D2011A) and ligated at 16 ℃ for 12 h. Subsequently, the ligation product is cloned into escherichia coli through transformation, a bacterial liquid PCR is used for determining positive bacteria, sequencing comparison results are carried out, and the sequencing is correct, namely the successfully constructed pLVX-EGFP-mU6-Tubb4b-SgRNA lentiviral vector is 8321bp in length (shown in an A picture of figure 4 and SEQ ID No. 8).

4) pLVX-EGFP-mU6-Tubb4b-SgRNA virus package and selection of stable cell line

Mixing the constructed pLVX-EGFP-mU6-Tubb4B-SgRNA lentiviral vector and virus packaging plasmids (pMD2.G and psPAX2) according to a certain proportion, and transfecting 293FT cells growing to 60-70% confluence (B-D in figure 4); after transfection for 48h, the transfection efficiency and the quality and the existence of the virus package were evaluated, and the vector transfection efficiency was higher as shown in the results (FIG. 4E-L); and infecting Tet-on with purified virus liquid carrying Tubb4b-SgRNA sequence to regulate and express Cas9 expression spermatogonial cell line (such as A-C shown in figure 5), and finally obtaining the stably expressed stable spermatogonial cell line (such as D-F shown in figure 5) which is transferred into two vectors of Cas9 and Tubb4 b-SgRNA-EGFP.

The lentivirus packaging plasmid and the shuttle plasmid are purified by the following method:

because the concentration of the extracted plasmid can not reach the requirement of the concentration of the plasmid in the lentiviral package, further purification is needed, and the specific steps are as follows:

(1) add 1/10 volumes of 3M sodium acetate and mix well.

(2) Adding 2.5 times volume of pre-cooled anhydrous ethanol, mixing, and standing at-20 deg.C for 30-60 min.

(3) Centrifuging at 4 deg.C and 12000rpm for 10min, recovering precipitate, and dissolving with 0.5-1mL precooled 75% ethanol;

(4) centrifuge at 12000rpm for 10min at 4 ℃ and gently aspirate the supernatant.

(5) Vacuum drying or room temperature drying, dissolving precipitate with sterile water 50-100 μ L, and storing at-20 deg.C.

The lentivirus packaging method comprises the following steps:

(1)293FT cells plating: is 10cm in advance one day²Culturing 293FT cells in a culture dish, culturing in a 10% 293FT cell culture medium, and infecting when the cell contact reaches 70-80%;

(2) at the time of infection, a clean 1.5mL centrifuge tube was taken, and 300. mu.L of DMEM and 10. mu.g of lentiviral packaging plasmid pSPAX23.5. mu.g, pMD2. G10.4. mu.g and 10. mu.g of shuttle plasmid (Cas9 or pLVX-EGFP-mU6-Tubb4b-SgRNA) were added. Adding 60 μ L Transfection Reagent Attracene Transfection Reagent, mixing well with pipette, standing at 15-25 deg.C for 10-15 min;

(3) washing cells twice by PBS, adding 6mL of 2% 293FT cell culture medium, and dropwise adding the mixed solution;

(4) culturing in 37 deg.C cell culture box for 6 hr, removing culture medium, culturing in 2% 293FT cell culture medium to maintain cell activity, culturing at 37 deg.C with 5% CO₂Culturing in an incubator;

(5) the virus stock solution is collected for 48h and 72h respectively, centrifuged by a slow centrifuge at 2000rpm for 3min, the supernatant is filtered by a 0.45 μm filter and stored in a refrigerator at 4 ℃ under the mark.

The lentivirus infection method comprises the following steps:

(1) resuscitating the mouse spermatogonium preserved by liquid nitrogen, inoculating into a cassette bottle, and placing at 37 deg.C and 5% CO₂Culturing in an incubator;

(2) after the cells grow stably, passage is carried out, and a proper amount of cells are inoculated into a new cassette bottle;

(3) when the cells grow to about 60-80% of the bottom surface of the card bottle, washing for 2 times by PBS;

(4) 5mL of filtered pLVX-EGFP-mU6-Tubb4b-SgRNA lentivirus stock solution is added with 5 mul of Polyberen with the concentration of 10 mug/mL and 500 mul of FBS for 12h and then the solution is changed;

(5) after 24h, the virus liquid is replaced by the complete culture medium for continuous culture;

(6) changing the liquid in a full amount every day, and needing to be tapped and washed by PBS during the liquid changing process;

(7) after the cell line is screened and stabilized, the cell is frozen and stored by a fluorescence microscope, and the result of the transgene is further detected.

5) Establishment and analysis of inducible Tubb4b-KO cell line

Stably transformed spermatogonia which are transformed into two vectors of Cas9 and Tubb4b-SgRNA-EGFP are screened and passed; finally obtaining a stable cell line with the in vitro passage frequency of more than 10 generations; the cell line sustained Expression (EGFP) (D-F in FIG. 5); subsequently, the knockdown of the gene and protein of interest was analyzed at the gene level (see graph A in FIG. 6) and at the protein level (see graph B in FIG. 6), and the knockdown efficiency thereof was analyzed (see graph C in FIG. 6).

The method for detecting the Tubb4b gene knockout condition at the gene level comprises the following steps:

culturing the stable spermatogonia by adding doxycycline (Dox), culturing for 48-72h, and extracting a part of the genome. And using the genome as a template, designing primers on two sides of the Tubb4b gene to be knocked out, amplifying the length by 464bp, sending to a worker for sequencing, carrying out primary analysis, and observing whether a sequencing result has a set peak.

Table 6: tubb4b gene knockout detection primer sequence

By adding doxycycline (Dox) for induction, the Tubb4b gene was knocked out after induction as shown by sequencing analysis, while the cells before induction showed no knocking-out, and both forward and reverse sequencing showed a set peak (FIG. 6A), indicating that Tubb4b gene on homologous chromosome of the cells was knocked out, and the cells showed homozygous cell line.

The method for detecting the TUBB4B protein knockout at the protein level was as follows:

(1) scraping off all induced and non-induced knocked-out mouse spermatogonium by cell scraping, adding 200 μ L protein lysate, shaking at 4 deg.C for 30s, standing on ice for 4min, and repeating for 5 times;

(2)12000g, centrifuging for 5min at 4 ℃, collecting the supernatant of the whole protein extract, subpackaging and storing at-80 ℃ for later use, and avoiding repeated freeze thawing;

(3) determining and calculating the concentration of mouse spermatogonial protein with induced and non-induced knockout by using a BCA protein quantitative detection kit;

(4) adjusting the concentration of each group of proteins to 1 μ g/μ L with PBS, adding 5 XSDS loading buffer solution to make the final concentration of the solution 1 ×, boiling the protein sample in boiling water for 5-10min to denature the proteins, cooling, and storing at-20 deg.C;

(5) preparing 10% of separation glue and 4% of concentrated glue, and waiting for the glue to solidify;

(6) adding 20 μ L protein sample into the sample well, and performing electrophoresis (concentrated gel constant pressure 70V, 40 min; separation gel constant pressure 90V, 2 h);

(7) preparing 6 pieces of filter paper and 1 piece of PVDF membrane (the size is equivalent to that of a gel sample), operating in a membrane-transferring buffer solution according to a 'sandwich' mode of a negative terminal (a black plate), a sponge, 3 layers of filter paper, glue, a membrane, 3 layers of filter paper, a sponge and a positive terminal (red), and paying attention to remove bubbles in each link;

(8) the clip is put into a transfer tank according to the principle of 'red to red and black to black', and a transfer buffer is added for western blotting (the transfer condition is constant pressure 80V, 1h and 4 ℃);

(9) after the film is rotated, the film is placed in sealing liquid with the right side facing upwards and sealed for 1 hour at room temperature;

(10) primary antibody incubation: after dilution of murine FLAG antibody (1:1000) with TBST, incubation was carried out overnight at 4 ℃;

(11) recovering primary antibody, washing the hybrid membrane with TBST twice for 10min each time on a shaking table; washing with TBS for 10 min;

(12) and (3) secondary antibody incubation: diluting anti-mouse IgG with TBST, and incubating at room temperature in a dark place for 1 h;

(13) cleaning the hybrid membrane in the same step (11) to prepare for exposure;

(14) the chemiluminescent reaction was performed according to the procedures described in the Pro-light HRP chemiluminescent detection reagent instructions and the gel imaging system was developed for imaging.

Western blot analysis showed that TUBB4B protein was no longer expressed after induction, whereas the cells before induction expressed TUBB4B protein, and GADPH showed consistent loading of both sets of proteins (fig. 6B), indicating successful inhibition of translation of mouse spermatogonial TUBB4B protein.

To further understand the Tubb4b gene knockout efficiency, the amplified fragment was ligated with T vector (pMD)^TM18-TVector). The operation method comprises the following steps:

(1) prepare solutions in PCR tubes (table 7);

table 7: preparation of solution reagent usage

(2) Adding 5 mu L of Solution I;

(3) placing the PCR tube in a thermostat, and reacting for 3h at 16 ℃;

(4) melting 100 μ L of competent cell DH5 α on ice, adding the solution after 3h, mixing gently, and standing on ice for 30 min;

(5) thermally shocking at 42 deg.C for 42-60s, and rapidly placing in ice for 1-2 min;

(6) adding 300 μ L LB culture medium, culturing at 37 deg.C and 150rpm for 1 h;

(7) 100 mu L of the bacterial liquid is dripped on a culture medium plate with resistant ampicillin, is evenly smeared and is cultured at 37 ℃.

After about 12 hours, 24 single colonies were picked up with a pipette tip and added to 24 tubes of a centrifuge tube containing 1mL of LB medium to which resistant ampicillin was added, fixed on a shaker, and cultured at 37 ℃ and 150rpm for 3 hours. Then, M13 upstream and downstream primers (Table 8) are used, the no-load amplification length is 140bp, bacteria liquid PCR detection is carried out, the residual bacteria liquid with the correct strip length is sent to the sequencing, and the gene knockout efficiency is calculated according to the sequencing result.

Table 8: m13 upstream and downstream sequences

The knockout efficiency was shown to be more than 92.3% by molecular cloning combined with sequencing analysis (FIG. 6, panel C), and the results of these data confirm that a conditionally inducible Tubb4b-KO spermatogonial cell line was obtained (FIG. 6).

SEQUENCE LISTING

<110> Zhaoqing college

<120> construction method of inducible spermatogonium Tubb4b gene knockout cell line

<130>

<160>12

<170>PatentIn version 3.5

<210>1

<211>20

<212>DNA

<213> Artificial sequence

<400>1

gggtagagga gccttaccgg 20

<210>2

<211>20

<212>DNA

<213> Artificial sequence

<400>2

atggggtaga ggagccttac 20

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<400>3

ctacaacgaa gccaccggta 20

<210>4

<211>23

<212>DNA

<213> Artificial sequence

<400>4

tttggcgccg gctcgagtgt aca 23

<210>5

<211>22

<212>DNA

<213> Artificial sequence

<400>5

aaacaaggct tttctccaag gg 22

<210>6

<211>59

<212>DNA

<213> Artificial sequence

<400>6

tggagaaaag ccttgtttgg ggtagaggag ccttaccggg ttttagagct agaaatagc 59

<210>7

<211>24

<212>DNA

<213> Artificial sequence

<400>7

caccggttag cgctagctaa tgcc 24

<210>8

<211>8321

<212>DNA

<213> Artificial sequence

<400>8

ttaatgtagt cttatgcaat actcttgtag tcttgcaaca tggtaacgat gagttagcaa 60

catgccttac aaggagagaa aaagcaccgt gcatgccgat tggtggaagt aaggtggtac 120

gatcgtgcct tattaggaag gcaacagacg ggtctgacat ggattggacg aaccactgaa 180

ttgccgcatt gcagagatat tgtatttaag tgcctagctc gatacataaa cgggtctctc 240

tggttagacc agatctgagc ctgggagctc tctggctaac tagggaaccc actgcttaag 300

cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg cccgtctgtt gtgtgactct 360

ggtaactaga gatccctcag acccttttag tcagtgtgga aaatctctag cagtggcgcc 420

cgaacaggga cttgaaagcg aaagggaaac cagaggagct ctctcgacgc aggactcggc 480

ttgctgaagc gcgcacggca agaggcgagg ggcggcgact ggtgagtacg ccaaaaattt 540

tgactagcgg aggctagaag gagagagatg ggtgcgagag cgtcagtatt aagcggggga 600

gaattagatc gcgatgggaa aaaattcggt taaggccagg gggaaagaaa aaatataaat 660

taaaacatat agtatgggca agcagggagc tagaacgatt cgcagttaat cctggcctgt 720

tagaaacatc agaaggctgt agacaaatac tgggacagct acaaccatcc cttcagacag 780

gatcagaaga acttagatca ttatataata cagtagcaac cctctattgt gtgcatcaaa 840

ggatagagat aaaagacacc aaggaagctt tagacaagat agaggaagag caaaacaaaa 900

gtaagaccac cgcacagcaa gcggccgctg atcttcagac ctggaggagg agatatgagg 960

gacaattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta 1020

gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga 1080

gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg 1140

ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg 1200

agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc 1260

caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg 1320

ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat 1380

aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac 1440

aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat 1500

gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca 1560

aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga 1620

atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg 1680

tttcagaccc acctcccaac cccgagggga cccttgcgcc ttttccaagg cagccctggg 1740

tttgcgcagg gacgcggctg ctctgggcgt ggttccggga aacgcagcgg cgccgaccct 1800

gggtctcgca cattcttcac gtccgttcgc agcgtcaccc ggatcttcgc cgctaccctt 1860

gtgggccccc cggcgacgct tcctgctccg cccctaagtc gggaaggttc cttgcggttc 1920

gcggcgtgcc ggacgtgaca aacggaagcc gcacgtctca ctagtaccct cgcagacgga 1980

cagcgccagg gagcaatggc agcgcgccga ccgcgatggg ctgtggccaa tagcggctgc 2040

tcagcagggc gcgccgagag cagcggccgg gaaggggcgg tgcgggaggc ggggtgtggg 2100

gcggtagtgt gggccctgtt cctgcccgcg cggtgttccg cattctgcaa gcctccggag 2160

cgcacgtcgg cagtcggctc cctcgttgac cgaatcaccg acctctctcc ccagggggta 2220

ccaccatggc caagcctttg tctcaagaag aatccaccct cattgaaaga gcaacggcta 2280

caatcaacag catccccatc tctgaagact acagcgtcgc cagcgcagct ctctctagcg 2340

acggccgcat cttcactggt gtcaatgtat atcattttac tgggggacct tgtgcagaac 2400

tcgtggtgct gggcactgct gctgctgcgg cagctggcaa cctgacttgt atcgtcgcga 2460

tcggaaatga gaacaggggc atcttgagcc cctgcggacg gtgccgacag gtgcttctcg 2520

atctgcatcc tgggatcaaa gccatagtga aggacagtga tggacagccg acggcagttg 2580

ggattcgtga attgctgccc tctggttatg tgtgggaggg cgagggcaga ggaagtctgc 2640

taacatgcgg tgacgtcgag gagaatcctg gcccagagag cgacgagagc ggcctgcccg 2700

ccatggagat cgagtgccgc atcaccggca ccctgaacgg cgtggagttc gagctggtgg 2760

gcggcggaga gggcaccccc aagcagggcc gcatgaccaa caagatgaag agcaccaaag 2820

gcgccctgac cttcagcccc tacctgctga gccacgtgat gggctacggc ttctaccact 2880

tcggcaccta ccccagcggc tacgagaacc ccttcctgca cgccatcaac aacggcggct 2940

acaccaacac ccgcatcgag aagtacgagg acggcggcgt gctgcacgtg agcttcagct 3000

accgctacga ggccggccgc gtgatcggcg acttcaaggt ggtgggcacc ggcttccccg 3060

aggacagcgt gatcttcacc gacaagatca tccgcagcaa cgccaccgtg gagcacctgc 3120

accccatggg cgataacgtg ctggtgggca gcttcgcccg caccttcagc ctgcgcgacg 3180

gcggctacta cagcttcgtg gtggacagcc acatgcactt caagagcgcc atccacccca 3240

gcatcctgca gaacgggggc cccatgttcg ccttccgccg cgtggaggag ctgcacagca 3300

acaccgagct gggcatcgtg gagtaccagc acgccttcaa gacccccatc gccttcgcca 3360

gatcccgcgc tcagtcgtcc aattctgccg tggacggcac cgccggaccc ggctccaccg 3420

gatctcgcta agaattctag atcttgagac aaatggcagt attcatccac aattttaaaa 3480

gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata atagcaacag 3540

acatacaaac taaagaatta caaaaacaaa ttacaaaaat tcaaaatttt cgggtttatt 3600

acagggacag cagagatcca ctttggcgcc ggctcgagtg tacaaaaaag caggctttaa 3660

aggaaccaat tcagtcgact ggatccggta ccgatccgac gccgccatct ctaggcccgc 3720

gccggccccc tcgcacagac ttgtgggaga agctcggcta ctcccctgcc ccggttaatt 3780

tgcatataat atttcctagt aactatagag gcttaatgtg cgataaaaga cagataatct 3840

gttcttttta atactagcta cattttacat gataggcttg gatttctata agagatacaa 3900

atactaaatt attattttaa aaaacagcac aaaaggaaac tcaccctaac tgtaaagtaa 3960

ttgtgtgttt tgagactata aatatccctt ggagaaaagc cttgtttggg gtagaggagc 4020

cttaccgggt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt 4080

gaaaaagtgg caccgagtcg gtgctttttt tctagaccca gctttcttgt acaaagttgg 4140

cattagctag cgctaaccgg tggcgcgtta agtcgacaat caacctctgg attacaaaat 4200

ttgtgaaaga ttgactggta ttcttaacta tgttgctcct tttacgctat gtggatacgc 4260

tgctttaatg cctttgtatc atgctattgc ttcccgtatg gctttcattt tctcctcctt 4320

gtataaatcc tggttgctgt ctctttatga ggagttgtgg cccgttgtca ggcaacgtgg 4380

cgtggtgtgc actgtgtttg ctgacgcaac ccccactggt tggggcattg ccaccacctg 4440

tcagctcctt tccgggactt tcgctttccc cctccctatt gccacggcgg aactcatcgc 4500

cgcctgcctt gcccgctgct ggacaggggc tcggctgttg ggcactgaca attccgtggt 4560

gttgtcgggg aaatcatcgt cctttccttg gctgctcgcc tgtgttgcca cctggattct 4620

gcgcgggacg tccttctgct acgtcccttc ggccctcaat ccagcggacc ttccttcccg 4680

cggcctgctg ccggctctgc ggcctcttcc gcgtcttcgc cttcgccctc agacgagtcg 4740

gatctccctt tgggccgcct ccccgcgtcg actttaagac caatgactta caaggcagct 4800

gtagatctta gccacttttt aaaagaaaag gggggactgg aagggctaat tcactcccaa 4860

cgaagacaag atctgctttt tgcttgtact gggtctctct ggttagacca gatctgagcc 4920

tgggagctct ctggctaact agggaaccca ctgcttaagc ctcaataaag cttgccttga 4980

gtgcttcaag tagtgtgtgc ccgtctgttg tgtgactctg gtaactagag atccctcaga 5040

cccttttagt cagtgtggaa aatctctagc agtacgtata gtagttcatg tcatcttatt 5100

attcagtatt tataacttgc aaagaaatga atatcagaga gtgagaggaa cttgtttatt 5160

gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt 5220

ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg 5280

ctctagctat cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc 5340

attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg 5400

cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggg acgtacccaa 5460

ttcgccctat agtgagtcgt attacgcgcg ctcactggcc gtcgttttac aacgtcgtga 5520

ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 5580

ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 5640

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 5700

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 5760

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 5820

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 5880

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 5940

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 6000

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 6060

acaaaaattt aacgcgaatt ttaacaaaat attaacgctt acaatttagg tggcactttt 6120

cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat 6180

ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg 6240

agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt 6300

tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga 6360

gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa 6420

gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt 6480

attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt 6540

gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc 6600

agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga 6660

ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat 6720

cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct 6780

gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc 6840

cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg 6900

gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc 6960

ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg 7020

acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca 7080

ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta gattgattta 7140

aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc 7200

aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa 7260

ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca 7320

ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta 7380

actggcttca gcagagcgca gataccaaat actgttcttc tagtgtagcc gtagttaggc 7440

caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca 7500

gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta 7560

ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag 7620

cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt 7680

cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc 7740

acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac 7800

ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac 7860

gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc 7920

tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat 7980

accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag 8040

cgcccaatac gcaaaccgcc tctccccgcg cgttggccga ttcattaatg cagctggcac 8100

gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc 8160

actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt 8220

gtgagcggat aacaatttca cacaggaaac agctatgacc atgattacgc caagcgcgca 8280

attaaccctc actaaaggga acaaaagctg gagctgcaag c 8321

<210>9

<211>20

<212>DNA

<213> Artificial sequence

<400>9

gggaggtaat cagcgacgag 20

<210>10

<211>20

<212>DNA

<213> Artificial sequence

<400>10

ccgcagtcag ttggaccttc 20

<210>11

<211>24

<212>DNA

<213> Artificial sequence

<400>11

cgccagggtt ttcccagtca cgac 24

<210>12

<211>21

<212>DNA

<213> Artificial sequence

<400>12

cacacaggaa acagctatga c 21

Claims (10)

1. A SgRNA guide sequence for knocking out a Tubb4b gene of a mouse is characterized in that the SgRNA guide sequence has a base sequence shown as SEQ ID No. 1.

2. An expression vector comprising the SgRNA targeting sequence of claim 1.

3. The expression vector of claim 2, wherein the expression vector is pLVX-EGFP-mU6-Tubb4 b-SgRNA.

4. The expression vector of claim 3, wherein the expression vector has a base sequence represented by SEQ ID No. 8.

5. A CRISPR-Cas expression system for knocking out a mouse Tubb4b gene, which is characterized by comprising the expression vector of claim 2 or 3 and a Cas9 protein transcription vector.

6. A kit comprising the SgRNA targeting sequence or the expression vector or the expression system according to any one of claims 1 to 5.

7. Use of the SgRNA targeting sequence or expression vector or expression system or kit of any one of claims 1 to 6 in the preparation of a mouse cell knockout of the Tubb4b gene.

8. A method for conditionally inducing Tubb4b gene knockout in mice, comprising the steps of:

A. using pmU6-gRNA and pLX-sgRNA-EGFP vectors as templates, and amplifying to obtain an mU6 fragment and a Tubb4b-sgRNA fragment; performing overlapping PCR amplification by using the mU6 fragment and the Tubb4b-sgRNA fragment as templates to obtain an mU6-Tubb4b-sgRNA fragment;

XhoI and NheI double-enzyme digestion of mU6-Tubb4b-SgRNA fragments to obtain mU6-Tubb4b-SgRNA cohesive end fragments, then connecting the mU6-Tubb4b-SgRNA cohesive end fragments into a pLVX-EGFP-hU6-SgRNA vector framework with hU6-SgRNA sequences removed, connecting and transforming to construct a pLVX-EGFP-mU6-Tubb4b-SgRNA lentiviral vector;

C. and B, purifying and packaging the pLVX-EGFP-mU6-Tubb4B-SgRNA lentiviral vector obtained in the step B to obtain a lentivirus carrying Tubb4B-sgRNA-EGFP, and infecting a Tet-on to regulate and express a Cas9 expression spermatogonial cell line by using the lentivirus, so that the conditionally induced mouse spermatogonial cell Tubb4B gene knockout cell line is constructed.

9. The method according to claim 8, wherein the sgRNA has a base sequence as set forth in SEQ ID No. 1; preferably, the primers of the mU6 fragment obtained by amplification in the step (1) are shown in SEQ ID Nos. 4-5; primers for amplifying Tubb4b-sgRNA fragments are shown as SEQ ID Nos. 6-7; the amplification primers of the overlapping PCR are shown as SEQ ID No.4 and SEQ ID No. 7.

10. An inducible spermatogonial Tubb4b gene knockout cell line produced by the method of claim 8 or 9.

Images