CN109022435B

CN109022435B - Conditional induction mouse spermatogonium Tet3 gene knockout cell line and construction method thereof

Info

Publication number: CN109022435B
Application number: CN201810801881.5A
Authority: CN
Inventors: 白银山; 朱翠; 刘珊珊; 冯美莹; 詹小舒; 王丙云
Original assignee: Foshan University
Current assignee: Foshan University
Priority date: 2018-07-19
Filing date: 2018-07-19
Publication date: 2022-05-06
Anticipated expiration: 2038-07-19
Also published as: CN109022435A

Abstract

The invention belongs to the technical field of genetic engineering, and relates to a SgRNA guide sequence for knocking out a mouse Tet3 gene, a conditionally-induced mouse spermatogonium Tet3 gene knockout cell line, a construction method and application thereof, wherein a gene editing off-target effect is an important aspect which puzzles the application of a gene editing technology, a Tet3 gene target point obtained by screening the patent is a target point of a unique target sequence screened out of the whole mouse genome, and no other similar sequences exist in the genome, therefore, no off-target effect exists theoretically, and the inducible knockout method is adopted to timely close the expression of the Cas9 protein and effectively prevent off-target generation, after 24h of Dox addition, the mouse spermatogonial cell genome is knocked out by more than 97%, and before and after Dox induction, the mouse spermatogonial cell genome is taken as a good test group and a good control group, so that the cell line and the method established by the invention can be widely applied to Tet3 and other gene function researches.

Description

Conditional induction mouse spermatogonium Tet3 gene knockout cell line and construction method thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a SgRNA guide sequence for knocking out a mouse Tet3 gene, a conditionally-induced mouse spermatogonium Tet3 gene knock-out cell line and a construction method thereof.

Background

The Tet family (Tet1, Tet2 and Tet3) is one of the important ways of epigenetic regulation by oxidizing 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) to demethylate genomic DNA. Tet family-mediated methylation regulation involves many aspects of stem cell self-renewal, differentiation, reprogramming and carcinogenesis, and different Tet family members are shown to act on specific cell populations.

Research shows that Tet1/2 is highly expressed in mouse embryonic stem cells (mESCs), and the expression of a pluripotent factor (such as Oct 4) can be reduced by down-regulating the expression of Tet1/2, so that the differentiation of the mESCs is promoted; tet1/3 plays an important role in the self-renewal and differentiation of neural stem cells, mice with a Tet1 knockout show the characteristics of long-term depression and memory loss, and Tet3 with mESCs knockout weakens the capacity of differentiating the mESCs into the neural cells; tet2 has important significance for the maintenance of the self renewal and differentiation of hematopoietic stem cells, and the reduction of the expression of Tet2 can promote the proliferation of the hematopoietic stem cells, but weaken the differentiation capability and promote the transformation of the hematopoietic stem cells into tumors; deletion of Tet2 expresses the ability of myocytes to lose differentiation into myocytes.

Studies have found that 5-mC and 5-hmC levels in the male sperm genome increase on average 1.76% and 5% per year with age, reflecting an increase in variability in sperm DNA. In the development process of mouse sperms, the expression level of 5-hmC is dynamically changed, so that the expression level in the mouse spermatogonium which begins to differentiate is the highest; expression levels decreased dramatically after spermatocytes appeared. And Tet3 expression is high in mouse spermatogonial stem cells and mouse testis tissues, while Tet1/2 is weak, which shows that Tet3 is probably a main regulatory molecule of a Tet family in a sperm development process, after differentiation of primordial germ stem cells, the expression level of Tet1/2 is reduced, an imprinting mode begins to be established, and Tet3 shows a high-level expression state, which indicates that Tet3 can play an important role in maintaining the imprinting mode of a male animal. Whether Tet3 regulates the methylation of mouse spermatogonial stem cell paternal imprinting genes and further controls the sperm development is yet to be proved by research.

Tet3 shows an important role in the development of nerves and reproduction, becomes a hot spot of the research of related apparent molecular mechanisms, and provides important value for the deep research of the functions of the Tet3 in the treatment and prevention of related diseases. In addition, the existing gene editing system comprising CRISPR-Cas9 does not well solve the off-target problem, and is an important restriction aspect influencing the application. The cell line model has wide scientific research and application prospect.

Disclosure of Invention

Based on the situation, in order to overcome the defects of the prior art, the invention provides a SgRNA guide sequence for efficiently knocking out a mouse Tet3 gene, a conditionally-induced mouse spermatogonium Tet3 gene knock-out cell line and a construction method thereof.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

on one hand, the invention provides a SgRNA guide sequence for knocking out a mouse Tet3 gene, wherein the SgRNA guide sequence has a sequence shown in SEQ ID NO: 1, or a nucleotide sequence represented by the formula (I).

In another aspect, the invention also provides an expression vector containing the SgRNA guide sequence. In a preferred embodiment, the expression vector is pLVX-EGFP-mU6-Tet 3-SgRNA. As a more preferred embodiment, the expression vector has the sequence of SEQ ID NO: 2, or a nucleotide sequence shown in the figure.

On the other hand, the invention also provides a CRISPR-Cas9 expression system for knocking out a mouse Tet3 gene, which comprises the expression vector and a transcription vector of Cas9 protein.

In another aspect, the invention also provides a preferred mouse conditional knockout vector system comprising the SgRNA targeting sequence or expression vector or expression system described above.

On the other hand, the invention also provides application of the SgRNA guide sequence or the expression vector or the expression system or the vector system in preparing the mouse cell with the Tet3 gene knocked out.

In another aspect, the present invention provides a method for conditionally inducing a mouse Tet3 gene knockout, comprising the steps of:

(1) pmU6-gRNA, Addgene 53187 and pLX-SgRNA-EGFP vectors are respectively used as templates, and the sequences shown in SEQ ID NO: 5-6 and SEQ ID NO: 7-8 are primers, and an mU6 fragment and a Tet3-SgRNA fragment are obtained through amplification; using mU6 fragment and Tet3-SgRNA fragment as templates, and obtaining the sequence shown in SEQ ID NO: 5 and SEQ ID NO: 8, performing overlapped PCR amplification by using primers to obtain mU6-Tet3-SgRNA fragments;

(2) the XhoI and NheI double-enzyme digestion mU6-Tet3-SgRNA fragments to obtain mU6-Tet3-SgRNA viscous terminal fragments, then the viscous terminal fragments are connected into a pLVX-EGFP-hU6-SgRNA vector framework with hU6-SgRNA sequences removed, and the pLVX-EGFP-mU6-Tet3-SgRNA slow virus vector is obtained through transformation and construction;

(3) purifying and packaging the pLVX-EGFP-mU6-Tet3-SgRNA lentiviral vector obtained in the step (2) to obtain a lentivirus carrying Tet3-SgRNA-EGFP, and infecting the lentivirus with Tet-on to regulate and express a Cas9 expression spermatogonial cell line, so as to construct and obtain the conditionally induced mouse spermatogonial Tet3 gene knockout cell line.

On the other hand, the invention also provides a mouse spermatogonium Tet3 gene knockout cell line prepared by the method.

Compared with the prior art, the invention has the following beneficial effects:

1. according to the invention, mouse spermatogonium is taken as a research object, a cell line for knocking out mouse spermatogonium Tet3 gene by Dox induction is constructed by combining the CRISPR/Cas9 system, the result shows that after induction, Tet3 gene in cell genome can be cut by 97%, and cutting does not occur before induction, the cell line is a cell model for researching Tet3 regulation and control reproductive development, and can be applied to scientific research and drug research and development, and due to good effect and high repeatability of cell model establishment, a thought can be provided for related drug development.

2. The invention relates to an induced knockout scheme, particularly designs and constructs a Tet3 knockout vector of a mouse, applies an mU6 promoter, adds green fluorescent protein, and facilitates the observation of the result of the invention, the knockout target point designed and screened is the only site established in the genome of the mouse, similar or identical target point sequences do not exist in the genome of the mouse, off-target effect does not exist, and meanwhile, the test result shows that the knockout efficiency reaches more than 97 percent after Dox induction, and the operability is very strong.

Drawings

FIG. 1 is a flow chart of the method for establishing a conditional induced mouse spermatogonium Tet3 knockout cell line in example 1 of the present invention;

fig. 2 shows the screening results of stably transfected Cas9 spermatogonial cell line in example 1 of the present invention, wherein a: a single cell clonal colony stably transfected with the Cas9 gene; b: stably transfected Cas9 cells were passaged in large numbers;

FIG. 3 shows the steps of constructing the pLVX-EGFP-mU6-SgRNA vector in example 1 of the present invention, wherein: a: a Tet3 target point prediction result pattern diagram; b, mU6-Tet3-SgRNA sequence; c: amplifying an mU6 fragment (390bp) and an SgRNA fragment (177 bp); d: obtaining mU6-SgRNA (549bp) fragments through overlapping PCR; e: constructing a vector map of pLVX-EGFP-mU 6-SgRNA;

FIG. 4 shows the screening results of Tet3-SgRNA stable cell line in example 1 of the present invention, wherein A: 293FT cells; b: observing the result of the 293FT cell transfected with Tet3-SgRNA and packaged plasmid for 48h by using a fluorescence microscope; c: establishing a cell line for stably expressing Tet 3-SgRNA;

FIG. 5 shows the results of the establishment and detection of the conditionally-induced Tet3-KO spermatogonial cell line in example 1 of the present invention, wherein A-B: white light and fluorescence (EGFP) observations of Tet3-KO spermatogonium after induction, respectively; c: before and after Dox induction, Tet3-KO genome sequencing analysis results; d: tet3-KO efficiency analysis (97%).

FIG. 6 the target sequence is unique site in the mouse genome, no similar or identical sequence exists, which indicates that the target is reliable and no off-target effect exists (Blast result using ENSEMBL database).

Detailed Description

The invention is further described below with reference to the drawings and specific examples, which are not described for prior art. Specific examples of the present invention are given below, but the examples are only for the purpose of further elaborating the present invention and do not limit the claims of the present invention. The reagents and starting materials used in the following examples were all commercially available unless otherwise specified.

Example 1

Please refer to fig. 1, which is a flowchart of a method for establishing a cell line for conditionally inducing Tet3 knockout of mouse spermatogonium according to the present invention, specifically comprising the following steps:

1) screening of spermatogonial cell line stably expressing eSPcas9 Gene

The packaged lentivirus (Addgene) carrying the eSPcas9 gene is used for infecting a spermatogonial cell line, and finally, a monoclonal cell colony (shown as a figure 2A) is obtained by screening, and a large number of seed cells (shown as a figure 2B) are finally obtained for later researches.

2) pLVX-EGFP-mU6-Tet3-SgRNA vector construction

Referring to the Ensembl database Tet3 gene sequence (NM _183138), according to the webpage SgRNA target prediction tool: http:// www.broadinstitute.org/rnai/public/analysis-tools/sgrn-design-v 1, predicted target sequence (GGAGCTCATCCGGCAATTTG) (SEQ ID NO: 1) (FIG. 3A, located downstream of the first exon ATG); applying pLVX-EGFP-hU6-SgRNA vector (addge) to mouse cells, changing the human hU6 promoter (hU6,266bp) into the mouse mU6 promoter (mU6,316bp) (as shown in figure 3B), firstly amplifying mU6 fragment (390bp) and SgRNA fragment (177bp) (the primers have added enzyme cutting sites and design overlapping parts; as shown in figure 3C); then mU6-Tet3-SgRNA (549 bp; see FIG. 3D) was obtained by overlap PCR; the method comprises the following specific steps:

respectively taking (pmU6-gRNA, Addgene 53187) and pLX-SgRNA-EGFP plasmids as templates, respectively amplifying an mU6 fragment and a Tet3-SgRNA fragment respectively at the upstream of a first section of mU6, the downstream of a first section of mU6, the upstream of a second section of Tet3-SgRNA and the downstream of a second section of Tet3-SgRNA (Table 1), wherein a PCR system (Table 1) comprises the following steps:

TABLE 1 first and second fragment amplification reaction systems

Secondly, mU6+ targeting SgRNA fragments are amplified by an overlapping PCR method, and the PCR reaction system is the same as the above table 1.

The PCR reaction procedure is as in table 2:

TABLE 2 PCR reaction procedure

The obtained PCR product was subjected to 1.3% agarose Gel electrophoresis and then Gel-recovered using the magenta Hipure Gel Pure DNA Mini Kit (D2111-03).

Thirdly, obtaining a promoter mU6-Tet3-SgRNA sequence by an overlapping PCR method, and taking the upstream of the first section of mU6 and the downstream of the second section of Tet3-SgRNA as amplification primers. The reaction system is shown in the following table 4:

TABLE 3 pLX-mU6-Tet3-SgRNA-EGFP vector construction primers TABLE

TABLE 4 overlapping PCR reaction systems

Setting PCR reaction conditions according to requirements, carrying out 1.3% agarose gel electrophoresis on a PCR product after the reaction is finished, recovering gel to obtain a fusion PCR product mU6-Tet3-SgRNA fragment, measuring the concentration by an ultraviolet spectrophotometer, and storing at-20 ℃.

2) Construction of pLVX-EGFP-mU6-Tet3-SgRNA plasmid

The mU6-Tet3-SgRNA fragment is subjected to double enzyme digestion of XhoI and NheI, reaction is carried out for 2h at 37 ℃, then mU6-Tet3-SgRNA cohesive end fragments are recovered, then the mU6-Tet3-SgRNA cohesive end fragments are connected into a pLVX-EGFP-hU6-SgRNA vector framework with hU6-SgRNA sequences removed, Takara T4 DNA Ligase connection kit (D2011A) is used for connection for 3h at 16 ℃, and after positive bacteria are determined by transformation and bacteria liquid PCR and sequencing, a pLVX-EGFP-mU6-Tet3-SgRNA slow virus vector with the length of 8321bp (shown in figure 3E and SEQ ID NO: 2) is successfully constructed.

3) pLVX-EGFP-mU6-Tet3-SgRNA virus packaging and selection of stable cell line

Mixing the constructed pLVX-EGFP-mU6-Tet3-SgRNA lentiviral vector and virus packaging plasmids (pMD2.G and psPAX2) according to a certain proportion, and transfecting 293FT cells growing to 60-70% confluence (figure 4A); after transfection for 48h, the transfection efficiency and the quality and the existence of the virus package were evaluated, and the vector transfection efficiency was high as shown in the results (FIG. 4B); the purified virus liquid carrying the Tet3-SgRNA sequence is infected with a Tet-on expression Cas9 expression spermatogonial cell line (figure 4C), and finally the stably expressed stably-transferred spermatogonial cell line with two vectors of Cas9 and Tet3-SgRNA-EGFP is obtained.

The lentivirus packaging plasmid and the shuttle plasmid are purified by the following method:

because the concentration of the extracted plasmid can not reach the requirement of the concentration of the plasmid in the lentiviral package, further purification is needed, and the specific steps are as follows:

(1) 1/10 volumes of 3M sodium acetate were added and mixed well.

(2) Adding 2.5 times volume of pre-cooled anhydrous ethanol, mixing, and standing at-20 deg.C for 30-60 min.

(3) Centrifuging at 4 deg.C and 12000rpm for 10min, recovering precipitate, and dissolving with 0.5-1mL precooled 75% ethanol;

(4) centrifuge at 12000rpm for 10min at 4 ℃ and gently aspirate the supernatant.

(5) Vacuum drying or room temperature drying, dissolving precipitate with sterile water 50-100 μ L, and storing at-20 deg.C.

The lentivirus packaging method comprises the following steps:

(1)293FT cells plating: is 10cm in advance one day²Culturing 293FT cells in a culture dish, culturing in a 10% 293FT cell culture medium, and infecting when the cell contact reaches 70-80%;

(2) when infection, a clean 1.5mL centrifuge tube was taken, and 300. mu.L DMEM was added, as well as the lentivirus packaging plasmids pSPAX2, pMD2.G and shuttle plasmids (Cas9 or pLVX-EGFP-mU6-Tet3-SgRNA), each using 3.5. mu.g, 10.4. mu.g and 10. mu.g, respectively. Adding 60 μ L Transfection Reagent Attracene Transfection Reagent (Qiagen), mixing well with pipette, standing at 15-25 deg.C for 10-15 min;

(3) washing cells twice by PBS, adding 6mL of 2% 293FT cell culture medium, and dropwise adding the mixed solution;

(4) culturing in 37 deg.C cell culture box for 6 hr, removing culture medium, culturing in 2% 293FT cell culture medium to maintain cell activity, culturing at 37 deg.C with 5% CO₂Culturing in an incubator;

(5) the virus stock solution is collected for 48 and 72 hours respectively, centrifuged by a slow speed centrifuge at 2000rpm for 3min, the supernatant is filtered by a 0.45 mu m filter and is marked to be put in a refrigerator for storage at 4 ℃.

The lentivirus infection method comprises the following steps:

(1) resuscitating the mouse spermatogonium preserved by liquid nitrogen, inoculating into a cassette bottle, and placing at 37 deg.C and 5% CO₂Culturing in an incubator;

(2) after the cells grow stably, passage is carried out, and a proper amount of cells are inoculated into a new cassette bottle;

(3) when the cells grow to about 60-80% of the bottom surface of the card bottle, washing for 2 times by PBS;

(4) 5mL of filtered pLVX-EGFP-mU6-Tet3-SgRNA lentivirus stock solution is added with 5 mU L of Polybrene with the concentration of 10 mU g/mL and 500 mU L of FBS to be cultured for 12h, and then the solution is changed;

(5) after 24h, the virus liquid is replaced by the complete culture medium for continuous culture;

(6) changing the liquid in a full amount every day, and needing to be tapped and washed by PBS during the liquid changing process;

(7) after the cell line is screened and stabilized, the cell is frozen and stored by a fluorescence microscope, and the result of the transgene is further detected.

4) Establishment and analysis of inducible Tet3-KO cell line

Stably transferring the cells into spermatogonia of two vectors of Cas9 and Tet3-SgRNA-EGFP, screening and passaging; finally obtaining a stable cell line with the in vitro passage frequency of more than 30 generations; the cell line sustained Expression (EGFP) (fig. 5B);

culturing the stable spermatogonia by adding doxycycline (Dox), culturing for 24-72h, and extracting a part of the genome. And using the genome as a template, designing primers for knocking out two sides of the Tet3 gene to amplify, amplifying the length to 440bp, sending to a worker for sequencing, and carrying out primary analysis to see whether a sequencing result has a set peak or not.

TABLE 5 Tet3 Gene knockout detection primer sequences

By adding doxycycline (Dox) for induction, the Tet3 gene was knocked out after induction by sequencing analysis, while the cells before induction showed no knock-out, and both forward and reverse sequencing showed a set of peaks (FIG. 5C), indicating that the Tet3 gene on the homologous chromosome of the cells was knocked out and the cells showed homozygous cell lines.

To further understand the knockout efficiency of Tet3 gene, the amplified fragment was ligated with T vector (pMD)^TM18-T Vector). The operation method comprises the following steps:

(1) prepare solutions in PCR tubes (table 6);

TABLE 6 preparation of solution reagent usage

(2) Adding 5 mu L of Solution I;

(3) placing the PCR tube in a thermostat, and reacting for 3h at 16 ℃;

(4) melting 100 μ L of competent cell DH5 α on ice, adding the solution after 3h, mixing gently, and standing on ice for 30 min;

(5) heat shocking at 42 deg.C for 42-60s, and rapidly placing in ice for 1-2 min;

(6) adding 300 μ L LB culture medium, culturing at 37 deg.C and 150rpm for 1 h;

(7) 100 mu L of the bacterial liquid is dripped on a culture medium plate with resistance ampicillin, is evenly smeared and is cultured in a temperature of 37 ℃.

After about 12 hours, 24 single-clone cells were gently picked up with a pipette tip and put into 24 tubes of a centrifuge tube containing 1mL of LB medium to which resistant ampicillin was added, fixed on a shaker, and then cultured at 37 ℃ and 150rpm for 3 hours. Then, M13 upstream and downstream primers (Table 7) are used, the no-load amplification length is 140bp, bacteria liquid PCR detection is carried out, the residual bacteria liquid with the correct strip length is sent to the sequencing, and the gene knockout efficiency is calculated according to the sequencing result.

TABLE 7 upstream and downstream sequences of M13

The knock-out efficiency was shown to be above 97% by molecular cloning combined with sequencing analysis (FIG. 5D), and the results of these data confirm that a conditionally-induced Tet3-KO spermatogonial cell line was obtained (FIG. 5).

EXAMPLE 2 screening of target sequences

In the research process, the inventors design a lot of target sequences (see table 8), however, many target sequences are verified through experiments, the target point has no cleavage activity, or the cleavage activity is very low, some target points have off-target effect, some target points have cleavage activity, but also have off-target effect, and finally screening obtains the target sequence 7, the genome is predicted to have no off-target possibility, and simultaneously the site cleavage activity is high, only the target sequence 7 is a unique site in the mouse genome (see fig. 6), and no similar or identical sequence exists, which indicates that the target point is reliable, and no off-target effect exists (using the Blast result of the ENSEMBL database). Thus, the present invention ultimately selects target sequence 7 as the targeting sequence.

TABLE 8Tet3 target sequence screening Table

Sequence listing

<110> institute of Buddha science and technology

<120> conditional induction mouse spermatogonium Tet3 gene knockout cell line and construction method thereof

<141> 2018-07-19

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 1

ggagctcatc cggcaatttg 20

<210> 2

<211> 8321

<212> DNA

<213> Artificial Sequence

<400> 2

ttaatgtagt cttatgcaat actcttgtag tcttgcaaca tggtaacgat gagttagcaa 60

catgccttac aaggagagaa aaagcaccgt gcatgccgat tggtggaagt aaggtggtac 120

gatcgtgcct tattaggaag gcaacagacg ggtctgacat ggattggacg aaccactgaa 180

ttgccgcatt gcagagatat tgtatttaag tgcctagctc gatacataaa cgggtctctc 240

tggttagacc agatctgagc ctgggagctc tctggctaac tagggaaccc actgcttaag 300

cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg cccgtctgtt gtgtgactct 360

ggtaactaga gatccctcag acccttttag tcagtgtgga aaatctctag cagtggcgcc 420

cgaacaggga cttgaaagcg aaagggaaac cagaggagct ctctcgacgc aggactcggc 480

ttgctgaagc gcgcacggca agaggcgagg ggcggcgact ggtgagtacg ccaaaaattt 540

tgactagcgg aggctagaag gagagagatg ggtgcgagag cgtcagtatt aagcggggga 600

gaattagatc gcgatgggaa aaaattcggt taaggccagg gggaaagaaa aaatataaat 660

taaaacatat agtatgggca agcagggagc tagaacgatt cgcagttaat cctggcctgt 720

tagaaacatc agaaggctgt agacaaatac tgggacagct acaaccatcc cttcagacag 780

gatcagaaga acttagatca ttatataata cagtagcaac cctctattgt gtgcatcaaa 840

ggatagagat aaaagacacc aaggaagctt tagacaagat agaggaagag caaaacaaaa 900

gtaagaccac cgcacagcaa gcggccgctg atcttcagac ctggaggagg agatatgagg 960

gacaattgga gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta 1020

gcacccacca aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga 1080

gctttgttcc ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg 1140

ctgacggtac aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg 1200

agggctattg aggcgcaaca gcatctgttg caactcacag tctggggcat caagcagctc 1260

caggcaagaa tcctggctgt ggaaagatac ctaaaggatc aacagctcct ggggatttgg 1320

ggttgctctg gaaaactcat ttgcaccact gctgtgcctt ggaatgctag ttggagtaat 1380

aaatctctgg aacagatttg gaatcacacg acctggatgg agtgggacag agaaattaac 1440

aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca agaaaagaat 1500

gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt taacataaca 1560

aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt aggtttaaga 1620

atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg 1680

tttcagaccc acctcccaac cccgagggga cccttgcgcc ttttccaagg cagccctggg 1740

tttgcgcagg gacgcggctg ctctgggcgt ggttccggga aacgcagcgg cgccgaccct 1800

gggtctcgca cattcttcac gtccgttcgc agcgtcaccc ggatcttcgc cgctaccctt 1860

gtgggccccc cggcgacgct tcctgctccg cccctaagtc gggaaggttc cttgcggttc 1920

gcggcgtgcc ggacgtgaca aacggaagcc gcacgtctca ctagtaccct cgcagacgga 1980

cagcgccagg gagcaatggc agcgcgccga ccgcgatggg ctgtggccaa tagcggctgc 2040

tcagcagggc gcgccgagag cagcggccgg gaaggggcgg tgcgggaggc ggggtgtggg 2100

gcggtagtgt gggccctgtt cctgcccgcg cggtgttccg cattctgcaa gcctccggag 2160

cgcacgtcgg cagtcggctc cctcgttgac cgaatcaccg acctctctcc ccagggggta 2220

ccaccatggc caagcctttg tctcaagaag aatccaccct cattgaaaga gcaacggcta 2280

caatcaacag catccccatc tctgaagact acagcgtcgc cagcgcagct ctctctagcg 2340

acggccgcat cttcactggt gtcaatgtat atcattttac tgggggacct tgtgcagaac 2400

tcgtggtgct gggcactgct gctgctgcgg cagctggcaa cctgacttgt atcgtcgcga 2460

tcggaaatga gaacaggggc atcttgagcc cctgcggacg gtgccgacag gtgcttctcg 2520

atctgcatcc tgggatcaaa gccatagtga aggacagtga tggacagccg acggcagttg 2580

ggattcgtga attgctgccc tctggttatg tgtgggaggg cgagggcaga ggaagtctgc 2640

taacatgcgg tgacgtcgag gagaatcctg gcccagagag cgacgagagc ggcctgcccg 2700

ccatggagat cgagtgccgc atcaccggca ccctgaacgg cgtggagttc gagctggtgg 2760

gcggcggaga gggcaccccc aagcagggcc gcatgaccaa caagatgaag agcaccaaag 2820

gcgccctgac cttcagcccc tacctgctga gccacgtgat gggctacggc ttctaccact 2880

tcggcaccta ccccagcggc tacgagaacc ccttcctgca cgccatcaac aacggcggct 2940

acaccaacac ccgcatcgag aagtacgagg acggcggcgt gctgcacgtg agcttcagct 3000

accgctacga ggccggccgc gtgatcggcg acttcaaggt ggtgggcacc ggcttccccg 3060

aggacagcgt gatcttcacc gacaagatca tccgcagcaa cgccaccgtg gagcacctgc 3120

accccatggg cgataacgtg ctggtgggca gcttcgcccg caccttcagc ctgcgcgacg 3180

gcggctacta cagcttcgtg gtggacagcc acatgcactt caagagcgcc atccacccca 3240

gcatcctgca gaacgggggc cccatgttcg ccttccgccg cgtggaggag ctgcacagca 3300

acaccgagct gggcatcgtg gagtaccagc acgccttcaa gacccccatc gccttcgcca 3360

gatcccgcgc tcagtcgtcc aattctgccg tggacggcac cgccggaccc ggctccaccg 3420

gatctcgcta agaattctag atcttgagac aaatggcagt attcatccac aattttaaaa 3480

gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata atagcaacag 3540

acatacaaac taaagaatta caaaaacaaa ttacaaaaat tcaaaatttt cgggtttatt 3600

acagggacag cagagatcca ctttggcgcc ggctcgagtg tacaaaaaag caggctttaa 3660

aggaaccaat tcagtcgact ggatccggta ccgatccgac gccgccatct ctaggcccgc 3720

gccggccccc tcgcacagac ttgtgggaga agctcggcta ctcccctgcc ccggttaatt 3780

tgcatataat atttcctagt aactatagag gcttaatgtg cgataaaaga cagataatct 3840

gttcttttta atactagcta cattttacat gataggcttg gatttctata agagatacaa 3900

atactaaatt attattttaa aaaacagcac aaaaggaaac tcaccctaac tgtaaagtaa 3960

ttgtgtgttt tgagactata aatatccctt ggagaaaagc cttgtttggg agctcatccg 4020

gcaatttggt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt 4080

gaaaaagtgg caccgagtcg gtgctttttt tctagaccca gctttcttgt acaaagttgg 4140

cattagctag cgctaaccgg tggcgcgtta agtcgacaat caacctctgg attacaaaat 4200

ttgtgaaaga ttgactggta ttcttaacta tgttgctcct tttacgctat gtggatacgc 4260

tgctttaatg cctttgtatc atgctattgc ttcccgtatg gctttcattt tctcctcctt 4320

gtataaatcc tggttgctgt ctctttatga ggagttgtgg cccgttgtca ggcaacgtgg 4380

cgtggtgtgc actgtgtttg ctgacgcaac ccccactggt tggggcattg ccaccacctg 4440

tcagctcctt tccgggactt tcgctttccc cctccctatt gccacggcgg aactcatcgc 4500

cgcctgcctt gcccgctgct ggacaggggc tcggctgttg ggcactgaca attccgtggt 4560

gttgtcgggg aaatcatcgt cctttccttg gctgctcgcc tgtgttgcca cctggattct 4620

gcgcgggacg tccttctgct acgtcccttc ggccctcaat ccagcggacc ttccttcccg 4680

cggcctgctg ccggctctgc ggcctcttcc gcgtcttcgc cttcgccctc agacgagtcg 4740

gatctccctt tgggccgcct ccccgcgtcg actttaagac caatgactta caaggcagct 4800

gtagatctta gccacttttt aaaagaaaag gggggactgg aagggctaat tcactcccaa 4860

cgaagacaag atctgctttt tgcttgtact gggtctctct ggttagacca gatctgagcc 4920

tgggagctct ctggctaact agggaaccca ctgcttaagc ctcaataaag cttgccttga 4980

gtgcttcaag tagtgtgtgc ccgtctgttg tgtgactctg gtaactagag atccctcaga 5040

cccttttagt cagtgtggaa aatctctagc agtacgtata gtagttcatg tcatcttatt 5100

attcagtatt tataacttgc aaagaaatga atatcagaga gtgagaggaa cttgtttatt 5160

gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt 5220

ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg 5280

ctctagctat cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc 5340

attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg 5400

cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggg acgtacccaa 5460

ttcgccctat agtgagtcgt attacgcgcg ctcactggcc gtcgttttac aacgtcgtga 5520

ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 5580

ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 5640

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 5700

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 5760

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 5820

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 5880

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 5940

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 6000

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 6060

acaaaaattt aacgcgaatt ttaacaaaat attaacgctt acaatttagg tggcactttt 6120

cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat 6180

ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg 6240

agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt 6300

tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga 6360

gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa 6420

gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt 6480

attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt 6540

gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc 6600

agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga 6660

ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat 6720

cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct 6780

gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc 6840

cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg 6900

gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc 6960

ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg 7020

acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca 7080

ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta gattgattta 7140

aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc 7200

aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa 7260

ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca 7320

ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta 7380

actggcttca gcagagcgca gataccaaat actgttcttc tagtgtagcc gtagttaggc 7440

caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca 7500

gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta 7560

ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag 7620

cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt 7680

cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc 7740

acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac 7800

ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac 7860

gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc 7920

tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat 7980

accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag 8040

cgcccaatac gcaaaccgcc tctccccgcg cgttggccga ttcattaatg cagctggcac 8100

gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc 8160

actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt 8220

gtgagcggat aacaatttca cacaggaaac agctatgacc atgattacgc caagcgcgca 8280

attaaccctc actaaaggga acaaaagctg gagctgcaag c 8321

<210> 3

<211> 98

<212> DNA

<213> Artificial Sequence

<400> 3

ccactttggc gccggctcga gtgtacaaaa aagcaggctt taaaggaacc aattcagtcg 60

actggatccg gtaccgatcc gacgccgcca tctctagg 98

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 4

gcgccaccgg ttagcgctag c 21

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 5

tttggcgccg gctcgagtgt aca 23

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 6

aaacaaggct tttctccaag gg 22

<210> 7

<211> 59

<212> DNA

<213> Artificial Sequence

<400> 7

tggagaaaag ccttgtttgg gagctcatcc ggcaatttgg ttttagagct agaaatagc 59

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 8

caccggttag cgctagctaa tgcc 24

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 9

cagaaggaca ggcaccgtta c 21

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 10

atggaagcag gtagttgaga gca 23

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 11

cgccagggtt ttcccagtca cgac 24

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 12

cacacaggaa acagctatga c 21

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 13

gtggtaactg gccgcgggga c 21

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 14

ggcccgccgg acccggtctt c 21

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 15

gcctggtggc cttttcggcc g 21

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 16

gacccctgct ggaggtcccg t 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 17

ggacttaccc gaaagcctgt g 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 18

gatttgcacc tagtccctcc g 21

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 19

ggacacgtat cgcgcttacc a 21

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 20

ggtacaggcc aggagttccg 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 21

gctgctccag ttctgccata 20

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 22

gaatgagatc ccccagcccc a 21

<210> 23

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 23

gatagggtca gggcttgggc g 21

<210> 24

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 24

gttagctgcc ttgaatctcc a 21

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 25

ggctctctag caccattgac 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 26

gaatggtgct agagagcccg 20

Claims

1. A SgRNA guide sequence for knocking out a mouse Tet3 gene is characterized in that the SgRNA guide sequence is shown as SEQ ID NO: 1, or a nucleotide sequence represented by the formula (I).

2. An expression vector comprising the SgRNA targeting sequence of claim 1.

3. The expression vector of claim 2, wherein the expression vector is pLVX-EGFP-mU6-Tet 3-SgRNA; the base sequence of the expression vector is shown as SEQ ID NO: 2, respectively.

4. A CRISPR-Cas9 expression system for knocking out a mouse Tet3 gene, which is characterized by comprising the expression vector of any one of claims 2 to 3 and a Cas9 protein expression vector.

5. Use of the SgRNA targeting sequence of claim 1 or the expression vector of any one of claims 2 to 3 or the expression system of claim 4 in the preparation of a mouse cell with a Tet3 gene knockout; the use is for non-disease treatment purposes.