CN111548401A - Salvia miltiorrhiza ERF-VII transcription factor SmERF73 participating in diterpene biosynthesis regulation and application thereof - Google Patents

Abstract

The invention discloses a salvia miltiorrhiza ERF-VII transcription factor SmERF73 participating in diterpene biosynthesis regulation and application thereof. The invention protects protein with an amino acid sequence of SEQ ID No.2 and a coding gene thereof. The invention also protects the protein as a transcription factor and application thereof in improving the yield of tanshinone. The invention has important theoretical significance for improving the yield of the tanshinone and provides theoretical and technical support for the molecular mechanism of the biosynthesis and control of the secondary metabolites of the medicinal plants.

Description

Salvia miltiorrhiza ERF-VII transcription factor SmERF73 participating in diterpene biosynthesis regulation and application thereof

Technical Field

The invention relates to a salvia miltiorrhiza ERF-VII transcription factor SmERF73 participating in diterpene biosynthesis regulation and application thereof.

Background

Tanshinone is a group of diterpenoid natural products contained in Chinese traditional medicine salvia miltiorrhiza, has obvious curative effect in clinical treatment of cardiovascular diseases, but the research on the regulation mechanism of biosynthesis is still deficient. Therefore, under the condition that the tanshinone biosynthesis pathway is clear, the research on the regulation mechanism of the tanshinone biosynthesis has important theoretical significance for improving the tanshinone yield, and provides theoretical and technical support for the molecular mechanism of the regulation of the biosynthesis of the secondary metabolites of the medicinal plants.

ERF transcription factor has the function of regulating and controlling the biosynthesis of active components (such as vinblastine, sesquiterpene artemisinin, diterpene taxol, etc.) in various medicinal plants. However, these ERFs all belong to group IX of the ERF subfamily, and group VII of ERFs involved in hypoxic stress have not been reported to regulate the biosynthesis of secondary metabolites. The repressor protein JAZ in the JA signaling pathway can mediate the expression of downstream genes through interaction with transcription factors of MYB and bHLH families, but the interaction with ERF is rarely reported.

Disclosure of Invention

The invention aims to provide a salvia miltiorrhiza ERF-VII transcription factor SmERF73 participating in diterpene biosynthesis regulation and an application thereof.

In the first aspect, the protective protein of the present invention is any one of the following (a1) to (a 4);

(A1) a protein having an amino acid sequence of SEQ ID No. 2;

(A2) a protein obtained by substituting and/or deleting and/or adding (A1) by one or more amino acid residues and having the same function;

(A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (A1) to (A2) and having the same function;

(A4) a fusion protein obtained by attaching a protein tag to the N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A3).

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

Among the above proteins, protein-tag (protein-tag) refers to a polypeptide or protein that is expressed by fusion with a target protein using in vitro recombinant DNA technology, so as to facilitate the expression, detection, tracking and/or purification of the target protein. The protein tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others.

In a second aspect, the invention protects a gene encoding said protein.

The gene is a DNA molecule as described in any one of (B1) to (B3) below:

(B1) DNA molecule shown in SEQ ID No. 1;

(B2) a DNA molecule which hybridizes with the DNA sequence defined in (B1) under strict conditions and codes for a protein with the same function;

(B3) and (B) the DNA molecule which has more than 90% of identity with the DNA sequence limited by (B1) or (B2) and codes the protein with the same function.

The stringent conditions are hybridization and washing of the membrane 2 times 5min at 68 ℃ in a solution of 2 XSSC, 0.1% SDS and 2 times 15min at 68 ℃ in a solution of 0.5 XSSC, 0.1% SDS.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 90% or more, or 95% or more identity to the nucleotide sequence of SEQ ID No.1 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

In a third aspect, the invention protects a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene.

In a fourth aspect, the invention provides the use of a protein as hereinbefore described as a transcription factor.

In a fifth aspect, the invention provides a use of the protein or gene as described above, wherein the use is any one of (C1) to (C5):

(C1) regulating the expression of key enzyme gene for tanshinone biosynthesis;

(C2) activating the transcription of key enzyme genes for tanshinone biosynthesis;

(C3) combining with a promoter of a key enzyme gene for tanshinone biosynthesis;

(C4) binding to a promoter having a GCC-Box region;

(C5) regulating and controlling the synthesis of tanshinone substances.

The key enzyme gene for tanshinone biosynthesis is SmDXR1 and/or SmCPS1 and/or SmKSL1 and/or SmCYP76AH3 gene.

In the step (C4), the GCC-Box region is GCCGCC.

In the (C5), the modulation is a forward modulation.

The tanshinone is cryptotanshinone I (CPT) and/or tanshinone IIA (Tan IIA) and/or dihydrotanshinone I (DHT) and/or tanshinone I (Tan I).

In a sixth aspect, the present invention provides a method for increasing the expression level of a key enzyme gene for biosynthesis of plant tanshinone and/or the synthesis level of tanshinone, comprising the following steps: improving the activity and/or abundance of the proteins in the target plant to obtain the plant with improved expression level of key enzyme genes for tanshinone biosynthesis and/or improved synthesis level of tanshinone substances.

In a seventh aspect, the present invention provides a method for producing a transgenic plant, comprising the steps of: introducing the genes into a target plant to obtain a transgenic plant; the expression quantity of the key enzyme gene for tanshinone biosynthesis and/or the synthetic quantity of tanshinone substances are higher than that of the target plant. The gene can be introduced into a target plant by an expression vector containing the gene. The expression vector can be obtained by introducing the gene into pK7WG2D vector by Gateway technology.

In an eighth aspect, the invention protects the use of a protein or gene or method as described hereinbefore in plant breeding. The breeding aim is to breed plants with high expression quantity of key enzyme genes for tanshinone biosynthesis and/or high synthesis quantity of tanshinone substances.

Any one of the above plants is Salvia miltiorrhiza. The Saviae Miltiorrhizae radix can be herba Violae Mundae.

The invention has important theoretical significance for improving the yield of the tanshinone and provides theoretical and technical support for the molecular mechanism of the biosynthesis and control of the secondary metabolites of the medicinal plants.

Drawings

FIG. 1 shows GFP expression of GFP protein on epidermal cells of onion: GFP fluorescence; white: bright field; merge: overlay of GFP and White.

FIG. 2 shows the growth of yeast containing different plasmids on the deficient medium SD/-Ade-His-Leu-Trp.

FIG. 3 shows the expression levels of SmERF73, SmDXR1, SmCPS1, SmKSL1 and SmCYP76AH3 in flowers, leaves, stems and roots.

FIG. 4 shows the expression level of SmERF73 in the interfering strain.

FIG. 5 shows the expression level of SmERF73 in the overexpression strain.

FIG. 6 shows the expression level of key enzyme genes involved in tanshinone biosynthesis in interfering strains.

FIG. 7 shows the expression level of key enzyme genes involved in tanshinone biosynthesis in overexpression strains.

FIG. 8 shows the content of tanshinone in the interfering strains.

FIG. 9 shows the content of tanshinone in the over-expressed strain.

FIG. 10 is a schematic structural diagram of ERF73 and promoter of key enzyme gene for tanshinone biosynthesis with GCC-box.

FIG. 11 is a schematic diagram of the sequence of a tandem GCC-Box probe for EMSA.

FIG. 12 is a graph of SmERF73 protein binding to GCC-Box in vitro.

FIG. 13 is a schematic diagram of a promoter fragment probe containing GCC-Box for EMSA. (a) A SmDXR1 gene promoter fragment probe; (b) SmCPS1 gene promoter fragment probe; (c) SmKSL1 gene promoter fragment probes; (d) SmCYP76AH3 gene promoter fragment probe

FIG. 14 is a promoter diagram of the in vitro binding of the SmERF73 protein to a protein containing GCC-Box.

FIG. 15 is a colony map of Bait-Reporter Yeast Strains.

FIG. 16 is a photograph of a growth colony screened for 3 XGCC and 2 XGCC-L Bait reporter strains.

FIG. 17 is a colony map of Bait-Reporter Yeast Strains.

FIG. 18 shows proSmDXR1⁸⁶⁶、proProSmKSL1-L⁸⁵⁷、proProSmKSL1-S²⁸⁹And prommCYP 76AH3⁶³⁰The report strain is screened for growth colony maps.

FIG. 19 shows a diagram of the SmDXR1 gene region and the ChIP-qPCR result.

FIG. 20 is a diagram showing the gene region of SmCPS1 and the results of ChIP-qPCR.

FIG. 21 is a diagram showing the region of the SmKSL1 gene and the results of ChIP-qPCR.

FIG. 22 is a diagram showing the SmCYP76AH3 gene region and the ChIP-qPCR result.

FIG. 23 shows that SmERF73 transcriptionally activates tanshinone biosynthesis pathway genes.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The red sage root variety adopted in the embodiment is purple-flower red sage root, and the seeds are from Shanxi province Shanxi Shanluo City and are identified by the center for traditional Chinese medicine resources of Chinese academy of traditional Chinese medicine.

E3025-GFP vector: are described in the literature: preliminary studies on cloning and function of sorbitol dehydrogenase gene dependent on NAD- + in tobacco [ D ]; the university of Henan agriculture, 2008, the public is available from the institute of traditional Chinese medicine, academy of sciences of Chinese medicine.

pK7GWIWG2D (II): are described in the literature: zhao Zuo, Rongqixian, Liuyu faithful, etc. the RNAi expression vector of the transcription factor of Salvia miltiorrhiza SmNAC1 is constructed by using the Gateway cloning technology [ J ] Chinese traditional medicine journal, 2014(09):31-35. in China, the public can be obtained from Chinese medicine research institute of Chinese academy of sciences.

pK7WG 2D: are described in the literature: in Rui, the over-expression of the Kandelia candel C2H2 type zinc finger protein gene KcZFP improves the analysis of the salt tolerance of tobacco [ D ]. Beijing university of forestry, 2013, the public can be obtained from the Chinese medicine research institute of Chinese academy of science.

pGWB17, pGWB 35: are described in the literature: development of services of gateway providers, pGWBs, for reallocating the knowledge of fusion genes for plant transformation, is available to the public from the institute of Chinese medicine, the national academy of sciences of Chinese medicine.

Example 1 discovery of ERF-VII group transcription factor SmERF73

Discovery of ERF-VII transcription factor SmERF73

By using the experimental and bioinformatics analysis methods of induction of biological/abiotic elicitors, gene cloning and the like, from YE/Ag⁺An ERF subfamily gene is obtained by screening in a transcriptome after the induction of the hairy roots of the salvia miltiorrhiza, is named as SmERF73 as shown in SEQ ID No.1, and the encoded protein is shown in SEQ ID No. 2.

Secondly, construction of a plasmid containing the SmERF73 gene

Using salvia miltiorrhiza hairy root cDNA as a template, adopting a primer pair consisting of a primer Isotig10181-F and a primer Isotig10181-R to carry out PCR amplification, purifying a PCR product, and then connecting the purified PCR product with a cloning vector Blunt Zero (from pEASY-Blunt Zero cloning Kit, Code No. CB501, Beijing all-purpose gold biotechnology Co., Ltd.) to obtain a Blunt Zero plasmid (which is verified by sequencing) containing the SmERF73 gene.

Isotig10181-F：5’-GTACAGATTTGGAAGACATTTCACC-3’；

Isotig10181-R：5’-CAACACAAACTACCAACACTCCAC-3’。

Example 2 analysis of transcription characteristics of SmERF73

First, subcellular localization

1. Construction of E3025-SmERF73 plasmid

PCR amplification was carried out using the plasmid containing the SmERF73 gene prepared in example 1 as a template, and a primer pair consisting of a primer E3025-SmERF73-F and a primer E3025-SmERF73-R, and the amplified product was digested simultaneously with Nco I and Kpn I and ligated with the E3025-GFP vector digested simultaneously with Nco I and Kpn I to obtain an E3025-SmERF73 plasmid (which had been verified by sequencing).

E3025-SmERF73-F：5’-CCCATGGACATGTGTGGCGGTGC-3’；

E3025-SmERF73-R：5’-GGGGTACCAGTGTTCACCGGAAACT-3’。

2. Preparation of DNA gold powder suspension

(1) Weighing 20mg PVP (Code No.0507-500G, Amresco company, USA), adding 1mL 100% absolute ethyl alcohol, loading into a screw tube, diluting to 0.01-0.1mg/mL with ethyl alcohol, namely diluting 25 mu L to 5 mL; (2) weighing gold powder (1.6 μm, Code No.1652264, Bio-rad, USA) 25mg to 1.5mL of EP tube; adding 100 mu L of 0.05mol/L spermidine into the gold powder; (3) vortex and shake the mixture, and break the gold lumps with ultrasound for 3-5 s; adding 50 μ L of plasmid DNA prepared in step 1 (1 μ g/uL) and vortexing for 5 s; (4) vortex at medium speed, add 100 μ L of 1M CaCl dropwise while shaking₂Precipitating at room temperature for 10 min; (5) centrifuging to remove supernatant, vortexing, washing with 1mL of absolute ethanol for 3 times (centrifuging to remove supernatant each time); (6) the product was transferred to a 15mL EP tube and adjusted to 3mL with PVP solution.

3. Making bullets

(1) Mounting the preparation platform, and measuring the horizontal condition of the preparation platform by using a level meter; connecting a nitrogen pipe, and scrubbing the long pipe and the o-ring by using alcohol; (2) inserting the long tube into o-ring, opening the flowmeter valve, N2 tank pressure gauge shows 0.1, preparing table pressure should be between 3-4, blowing for 15 min; (3) closing a valve on the preparation table, taking down the long pipe, connecting a10 mL syringe with the hose, and inserting the long pipe into the hose; (4) mixing the gold powder evenly at medium speed, and quickly sucking the suspension into the tube through an injector; inserting a long tube containing gold powder into the o-ring, and standing for 5-10 minutes; (5) taking the injector fixed on the hose before, slowly sucking out the liquid at a constant speed, and taking down the hose and the injector; rotating the tube for 180 degrees and standing for 5 s; (6) opening a rotary valve on the preparation table, and starting the tube to rotate for 20-30 s; after 20-30s, opening an N2 valve on the preparation table, drying the tube while still rotating the tube, and performing for 5-10 min; (7) taking down the long pipe, scrubbing the surfaces of the cutting knife and the long pipe by alcohol, cutting off redundant parts at two ends of the long pipe by the cutting knife after drying, and closing the N2 valve; the remaining part containing the gold powder was cut and stored at 4 ℃ together with allochroic silica gel.

4. Bombardment of onion epidermal cells by gene gun

(1) Cutting fresh onion inner layer epidermal cells into 2 × 2cm, peeling with forceps, placing on MS culture medium, and dark culturing at 25 deg.C overnight; (2) in a clean bench, the bullet is arranged in a gene gun, connected with nitrogen and bombarded at a position about 1cm away from onion epidermal cells under the condition that the air pressure is 160 PM; (3) culturing at 25 deg.C for about 24 hr; (4) the onion epidermal cells were sliced and observed under a fluorescence microscope.

The results are shown in FIG. 1. The result shows that the SmERF73-GFP fusion protein is expressed on the nucleus, which indicates that SmERF73 has the function of transcription and regulation in the nucleus like most transcription factors.

Second, detection of transcriptional activation Activity

1. Construction of pGBKT7-SmERF73 vector

The plasmid containing the SmERF73 gene prepared in example 1 was used as a template, PCR amplification was carried out using a primer pair consisting of the primer pGBKT7-SmERF73-F and the primer pGBKT7-SmERF73-R, and the amplification product was digested simultaneously with Nde I and Xma I and ligated with pGBKT7 plasmid (Yeast Two-Hybrid System, Code No.630489, Clontech, Japan) which was digested simultaneously with Nde I and Xma I, to obtain pGBKT7-SmERF73 vector (sequencing-verified).

pGBKT7-SmERF73-F：5’-GGAATTCCATATGGTACAGATTTGGAAGACATTTCACC-3’；

pGBKT7-SmERF73-R：5’-TCCCCCCGGGCAACACAAACTACCAACACTCCAC3’。

2. Construction of pGADT7-SmERF73 vector

PCR amplification was carried out using the plasmid containing the SmERF73 gene prepared in example 1 as a template and a primer pair consisting of the primer pGADT7-SmERF73-F and the primer pGADT7-SmERF73-R, and the amplification product was digested simultaneously with Nde I and EcoR I and ligated with pGADT7 plasmid (Yeast Two-Hybrid System, Code No.630489, Clontech, Japan) which was digested simultaneously with Nde I and EcoR I to obtain pGADT7-SmERF73 vector (sequencing-verified).

pGADT7-SmERF73-F：GGAATTCCATATGTGTGGCGGTGCAATCCTC；

pGADT7-SmERF73-R：CGGAATTCCTAGTGTTCACCGGAAACTTCATCG。

3. Preparation of Yeast competent cells

(1) Culture of AH109 Yeast (from Yeast Two-hybrid System, Code No.630489, Clontech, Japan) to OD at 30 ℃ in 10mL of YPD Medium₆₀₀1.0, (2)500 × g of centrifugal bacteria liquid for 4min, sucking off the supernatant, (3) adding 10mL of EZ1 solution to resuspend and precipitate, re-centrifuging and precipitating cells, sucking off the supernatant, and (4) adding 1mL of LEZ2 solution to resuspend and precipitate the cells, wherein the cells are competent cells.

4. The plasmids are grouped and transformed into the competent cells obtained in the step 3 as follows;

group 1: pGBKT7+ pGADT7 empty vector control group;

group 2: pGBKT7-53+ pGADT7-RecT positive control group; the plasmid was obtained from Yeast Two-Hybrid System, Code No.630489, Clontech, Japan;

group 3: pGBKT7+ pGADT7-SmERF73 negative control group;

group 4: pGBKT7-SmERF73+ pGADT7 experimental group.

(1) Mixing 50 μ L of competent cells with 0.2-1 μ g of plasmid (total volume is no more than 5 μ L); (2) adding 500 mu LEZ3 solution, and mixing completely; incubating at 30 deg.C for 45min, and mixing with finger flicking or low speed vortex for 2-3 times during incubation; (3) taking 50-150 μ L from the above conversion mixture, and respectively coating on 2-deficiency (-Trp-Leu) and 4-deficiency (-Ade-His-Leu-Trp) culture media; (4) the plate was incubated at 30 ℃ for 2-4 days, and the self-activating activity was analyzed by the colony growth state.

The results are shown in FIG. 2.

pGBKT7+ pGADT7 is an empty vector control group, and the proteins encoded by the group are known to have neither interaction nor transcriptional activation activity, so that only two amino acids, namely Trp (pGBKT7) and Leu (pGADT7), can be synthesized in AH109 yeast, and cannot grow on SD/-Ade-His-Leu-Trp culture medium.

pGBKT7-53+ pGADT7-RecT is a positive control group, and the interaction between GAL4-p53 fusion protein coded by the group and SV40large T-antigen protein is known, and after the interaction, the transcription of a reporter gene in AH109 yeast is started, so that the group can synthesize Trp (pGBKT7), Leu (pGADT7) and Ade/His (AH109) in the AH109 yeast, and finally can grow on SD/-Ade-His-Leu-Trp culture medium.

pGBKT7+ pGADT7-SmERF73 negative control group, which has no interaction with the encoded protein theory and no transcriptional activation activity, therefore, only two amino acids, namely Trp (pGBKT7) and Leu (pGADT7), can be synthesized in AH109 yeast, and cannot grow on SD/-Ade-His-Leu-Trp medium.

pGBKT7-SmERF73+ pGADT7 is an experimental group, if pGBKT7-SmERF73 has no transcription activation activity, the transcription of a reporter gene in AH109 yeast cannot be started, and the group can only synthesize two amino acids of Trp (pGBKT7) and Leu (pGADT7) in the AH109 yeast and cannot grow on an SD/-Ade-His-Leu-Trp culture medium; pGBKT7-SmERF73, which has transcriptional activation activity, can turn on the transcription of reporter genes in AH109 yeast, and this group can synthesize Trp (pGBKT7), Leu (pGADT7) and Ade/His (AH109) in AH109 yeast, and finally can grow on SD/-Ade-His-Leu-Trp medium.

As can be seen from the above results, the empty vector failed to grow colonies, indicating that no interaction and transcriptional activation capability existed between the vectors, and excluding a false positive possibility; a colony grows out of the positive control group, which indicates the correctness of experimental operations such as culture medium preparation, plasmid transformation and the like, and eliminates the possibility of false negative; negative controls were colonies that grew, indicating that there was no interaction between SmERF73 and the protein encoded by pGBKT7, again excluding the possibility of a false positive; finally, colonies were grown in the experimental group and compared with the control group, indicating that SmERF73 has transcription activation activity.

Organ-specific expression analysis of SmERF73

Extracting total RNA of root, stem, leaf and floral organ of two-year-old purple-flower salvia in flowering period, carrying out reverse transcription to obtain cDNA, and carrying out fluorescence quantitative analysis by using the cDNA as a template. The references used for the quantitative fluorescence analysis are given in Table 1.

TABLE 1

The results are shown in FIG. 3. The results showed that the expression level of ERF73 was highest in roots, comparable to stems, 4.5-fold higher than leaves, 5-fold higher than flowers; DXR1 was also expressed in the highest amount in the roots, 6.8 times as much as the stems, 1.5 times as much as the leaves, 4.5 times as much as the flowers; CPS1 expression level was also highest in roots, 115-fold higher than stems, 277-fold higher than leaves, and 50-fold higher than flowers; the expression level of KSL1 was also highest in roots, 32.5 times that of stems, 46.5 times that of leaves, and 45 times that of flowers; CYP76AH3 was also expressed in the highest amount in the roots, 6.2 times as much as the stems, 207.2 times as much as the leaves, and 5.7 times as much as the flowers. In conclusion, the expression quantities of the salvia miltiorrhiza ERF73 gene and partial key enzyme genes DXR1, CPS1, KSL1 and CYP76AH3 for tanshinone biosynthesis are highest in roots, which indicates that the roots are main synthetic organs of SmERF73 protein and also provides a basis for the SmERF73 protein to directly regulate and control the key enzyme genes for tanshinone biosynthesis in the roots.

Example 3 transgenic analysis of SmERF73

Construction of interference vectors

1. PCR amplification was carried out using Blunt Zero plasmid containing SmERF73 gene prepared in example 1 as a template and a primer pair consisting of primer pK7GWIWG2D-SmERF73-F and primer pK7GWIWG2D-SmERF73-R, and the amplification product was purified and then subjected to BP reaction.

pK7GWIWG2D-SmERF73-F：5’-caccGCCCACGCTTACGACAGAGAG-3’；

pK7GWIWG2D-SmERF73-R：5’-GTGTTCACCGGAAACTTCATCG-3’。

BP reaction system: mu.L of water, 1. mu.L of Salt, 1. mu.L of PCR-purified product, and 0.5. mu.L of pENTR/SD/D-TOPOVector (Invitrogen). The reagent is derived from pENTR directive

Cloning Kits (codeno. K2525-20), Invitrogen, USA.

BP reaction conditions: ligation was performed at 22 ℃ for 1.5 h.

2. Taking the BP reaction product obtained in the step 1, and carrying out LR reaction.

LR reaction system: mu.L of TE Buffer (pH8.0), 1. mu.L of BP reaction product, 1. mu.L of pK7GWIWG2D (II), 1. mu.L of LLR clone II.

LR reaction conditions: and (3) carrying out water bath at 25 ℃ for 3h, adding proteinase K, incubating at 37 ℃ for 10min, and terminating the LR reaction to obtain an interference vector (verified by sequencing).

The agent is derived from Gateway LR clone^TMPlus enzyme mix (Code No. 12538-.

Second, construction of overexpression vector

1. The Blunt Zero plasmid containing the SmERF73 gene is used as a template, a primer pair consisting of a primer pK7WG2D-SmERF73-F and a primer pK7WG2D-SmERF73-R is adopted for PCR amplification, and an amplification product is purified and then subjected to BP reaction.

pK7WG2D-SmERF73-F：5’-caccATGTGTGGCGGTGCAATCCTCG-3’；

pK7WG2D-SmERF73-R：5’-GTGTTCACCGGAAACTTCATCG-3’。

BP reaction system: mu.L of water, 1. mu.L of Salt, 1. mu.L of PCR-purified product, and 0.5. mu.L of pENTR/SD/D-TOPOVector (Invitrogen).

BP reaction conditions: ligation was performed at 22 ℃ for 1.5 h.

2. Taking the BP reaction product obtained in the step 1, and carrying out LR reaction.

LR reaction system: mu.L TE Buffer (pH8.0), 1. mu.L BP reaction product, 1. mu.L pK7WG2D, 1. mu.L LLRClosase II.

LR reaction conditions: and (3) carrying out water bath at 25 ℃ for 3h, adding proteinase K, incubating at 37 ℃ for 10min, and terminating the LR reaction to obtain an overexpression vector (verified by sequencing).

Preparation and transformation of competent cells

And transforming the interference vector and the overexpression vector into agrobacterium EHA105 competent cells to obtain recombinant bacteria.

Transformation of salvia miltiorrhiza plants by leaf disc method

And (3) taking the recombinant bacterium introduced with the interference vector or the recombinant bacterium introduced with the overexpression vector prepared in the step three, and transforming the salvia miltiorrhiza plant by a leaf disc method according to the following method.

1. Selecting Saviae Miltiorrhizae radix with good growth vigor from tissue culture seedling, shearing its top leaf in super clean bench, placing in 10ml liquid MS plate, shearing to remove leaf edge, and cutting into 1cm²Square of (2). 2. And (3) putting the cut leaves into a recombinant bacterium solution containing a target carrier, sealing, and placing the port at 28 ℃ for 15min by using a 160rpm shaking table. 3. Taking out the mixture in a super clean bench, putting the mixture on absorbent paper, and sucking the liquid. 4. Clamping the leaf into solid MS culture medium plate with back of leaf upward, and sealing. 5. And (4) placing the mixture in a constant-temperature culture room for dark culture for 36-48h in a dark place (the agrobacterium is difficult to inhibit and the callus part is difficult to grow due to too long time). 6. The dark-cultured leaf discs were removed. 7. The leaves were rinsed 6-7 times in 100ml Erlenmeyer flasks with 50ml of sterile water until the sterile water was clear. 8. Then the leaves are transferred to the upper layer (the lower four layers and the upper three layers) of absorbent paper, and the moisture is absorbed. 9. Finally transferring the cells into an MS differentiation medium containing 50 mu g/mL Rif, 400 mu g/mL Cef and 50 mu g/mL Kan for culture (fire is carried out before an alcohol lamp when sealing is carried out), and subculturing every two weeks; when the callus grows out, the callus can be moved to a rooting culture medium.

And (3) introducing the empty vector into an agrobacterium EHA105 competent cell, and performing the steps to obtain a transgenic empty vector plant.

Fifth, detecting the expression quantity of the transgenic plant

And (4) taking the over-expression transgenic plant and the interference plant prepared in the step four, extracting total RNA, carrying out reverse transcription to obtain cDNA, and carrying out fluorescence quantitative analysis by taking the cDNA as a template. The references used for the quantitative fluorescence analysis are given in Table 1.

The results of the detection of interfering plants are shown in FIG. 4. The results of detection of the over-expressed plants are shown in FIG. 5.

The results show that the expression level of the SmERF73 gene in the interfering plants is reduced and the expression level of the SmERF73 gene in the over-expression plants is increased compared with the empty vector transfer (EV). Interference strains Ri-2, Ri-3 and Ri-7 and overexpression strains OE-1, OE-3 and OE-8 are selected for subsequent experiments.

Sixthly, detecting expression quantity of key enzyme gene for tanshinone biosynthesis

And (3) the plant to be detected: empty vector transfer (EV), interference strains Ri-2, Ri-3 and Ri-7, and overexpression strains OE-1, OE-3 and OE-8.

Extracting total RNA of a plant to be detected, transcribing the total RNA into cDNA, and performing fluorescence quantitative analysis by taking the cDNA as a template. The references used for the quantitative fluorescence analysis are shown in tables 1 and 2.

TABLE 2

The results of the interference strain detection are shown in FIG. 6. The results of the detection of the overexpression lines are shown in FIG. 7.

The results show that in the interfering strains, transcription of ERF73 was repressed to 20-30% of the Empty Vector (EV) control. The expression of MEP upstream rate-limiting enzyme genes DXS2 and DXR1 is respectively reduced by 50-88% and 28-70% compared with that of a control group; the expression levels of diterpene skeleton biosynthesis genes CPS1 and KSL1 are respectively reduced to 56-86% and 43-70%; the expressions of the Miltiradiene branch passage P450 genes CYP76AH1, CYP76AH3 and CYP76AK1 are respectively reduced to 49-87%, 53-83% and 60-90%. In the over-expressed lines, the transcriptional level of ERF73 was increased by about 2-3 fold compared to the EV control. Expression levels of upstream genes DXS2 and DXR1 of MEP pathway are 1.2-2.5 times and 1.2-1.8 times of those of control group respectively; the expression levels of diterpene skeleton biosynthesis genes CPS1 and KSL1 are 0.8-3.8 times and 1.4-2.0 times of those of a control system respectively; the expressions of the Miltiradiene branch pathway genes CYP76AH1, CYP76AH3 and CYP76AK1 are respectively 1.5-2.4 times, 2.7-3.7 times and 1.2-1.7 times higher than those of a control group.

Content detection of heptatanshinone

And (3) the plant to be detected: empty vector transfer (EV), interference strains Ri-2, Ri-3 and Ri-7, and overexpression strains OE-1, OE-3 and OE-8.

1. Extraction of tanshinone chemical components

(1) Precisely weighing freeze-dried radix Salviae Miltiorrhizae powder (3 separate replicates per sample) in 100mg to 2.0mL centrifuge tubes; (2) adding 1.5mL of methanol, sealing, weighing, and carrying out ultrasonic treatment (power 140W and frequency 42kHz) for 40 min; (3) cooling, weighing, and supplementing methanol to lost weight; (4) centrifuging at 10000rpm for 15min, collecting supernatant, filtering with 0.22 μm microporous membrane, and collecting filtrate to obtain test solution.

2. LC-MS method

Chromatographic conditions are as follows: waters ACQUITY UPLC BEH C18 column (2.1 mm. times.100 mm,1.8 μm), flow rate 0.5mL/min, column temperature 40 deg.C, sample size 1.0 μ L.

The elution conditions are shown in Table 3.

TABLE 3

Mass spectrum conditions:

an ion source: a Turbo V; ionization mode: ESI +; the collection mode is as follows: MRM; ionization temperature: 550 deg.C

The optimized condition parameters are given below in 4.

TABLE 4 optimization of LC-MS/MS mass spectrometry conditions for tanshinone ingredients

The standard information is shown in Table 5.

TABLE 5

Performing linear regression analysis on the mass concentration (X, μ g/mL) with peak area (Y) of quantitative ion of tanshinone I, dihydrotanshinone, tanshinone II A and cryptotanshinone, and weighting to 1/X²The equation is shown in Table 6.

TABLE 6 Standard Curve for the tanshinone Components

The detection result of the content of interference strains of tanshinone is shown in figure 8. The results of the detection of the content of the over-expressed strain are shown in FIG. 9.

Compared with EV control lines, ERF73-Ri transgenic plants had 43-61%, 29-45%, 43-45%, and 15-24% less accumulation of cryptotanshinone I (CPT), tanshinone IIA (Tan IIA), dihydrotanshinone I (DHT), and tanshinone I (Tan I), respectively. These results indicate that inhibition of ERF73 by RNAi results in inhibition of gene expression in the biosynthetic pathway and reduction of accumulation of tanshinone biosynthesis.

Compared with the EV control line, the accumulation of cryptotanshinone I (CPT), tanshinone IIA (Tan IIA), dihydrotanshinone I (DHT) and tanshinone I (Tan I) of the ERF73-OE transgenic plant is respectively improved by about 1.2 times, 1.6 times and 1.7 times. These results indicate that overexpression of ERF73 can induce the expression of tanshinone pathway gene and generally stimulate the accumulation of tanshinone in transgenic red sage root, suggesting that ERF73 may be an active regulatory factor for tanshinone biosynthesis.

Example 4 study of the in vitro binding of the SmERF73 protein to the promoter sequence

First, promoter sequence analysis

Promoter sequences of SmERF73, SmDXS2, SmDXR1, SmCPS1, SmKSL1, SmCYP76AH1, SmCYP76AH3 and SmCYP76AK1 were obtained from genomic data, promoter element analysis was performed using PLACE, and plotted as FIG. 10, and it was found that only the promoters of SmDXR1, SmCPS1, SmKSL1 and SmCYP76AH3 genes contained the predicted ERF-binding element GCC-Box (GCCGCC) and an element similar to GCC-Like-Box (GCCGCC).

II, amplification of promoter sequence

Extracting total DNA of salvia miltiorrhiza, performing PCR amplification by using primers shown in table 7 by using the total DNA as a template, connecting an amplification product to a pEASY-Blunt Zero cloning vector, and obtaining cloning vectors containing promoters of SmERF73, SmDXS2, SmDXR1, SmCPS1, SmKSL1, SmCYP76AH1, SmCYP76AH3 and SmCYP76AK1 genes respectively (sequencing verification).

TABLE 7

Primer name	Sequence (5 '-3')
		pSmERF73-F	CCAACTGGAGAGATGATGACGG
pSmERF73-R	TTTTGGTGAAATGTCTTCCAAATC
		pSmDXS2-F	ATCAACTTTCGTCATTTATCTGCCGTA
pSmDXS2-R	CATCTCTGTGTATCTCTCTCTCAGCC
		pSmDXR1-F	CTCTGTCTAATGCTTCAATTTGG
pSmDXR1-R	GGCTTATCCACGCTCGAATGCACA
		pSmCPS1-F	TACAGTGCAGGGGAAAGAATAACATGA
pSmCPS1-R	TCAAATTTCCCTTTGAGTGGAGATGT
		pSmKSL1-F	AGTGGAGAAGCAAAGGTGAAAGGTA
pSmKSL1-R	CTTTAGCTCTGGGGCGG
		pSmCYP76AH1-F	TCAAGAATATAAGCACAGTGCATATATACA
pSmCYP76AH1-R	CATATTTTCTCTTCTTGTTTTTCCCTCTTTA
		pSmCYP76AH3-F	ACCCCAACCTAGTTAAAGATATTAGG
pSmCYP76AH3-R	CATATTTTCTCTTCTTCTTTTTCGCTC
		pSmCYP76AK1-F	TTATTCATCGTCAACCTTCAAACTGCG
pSmCYP76AK1-R	AGTCCGACCACCTTGAGTAGACGAGCC

Preparation of polyclonal antibody

1. The SmERF73 protein sequence is searched in NCBI, the secondary structure, the hydrophilicity and hydrophobicity, the antigenicity and other characteristics of the protein sequence are analyzed, the optimal epitope polypeptide fragment site is selected as immunogen, and finally the polypeptide is synthesized by the Huada gene.

The optimal epitope polypeptide fragment is C EHVSKNNGPKSK; c cysteine was artificially added for coupling.

2. Blood is taken from the canthus of Balb/c mouse before immunization, the mouse is held firmly by one hand and the eyeball of the mouse is exposed, a capillary tube is inserted into the back corner of the mouse eye by the other hand, and the blood is slowly screwed in from the back corner of the mouse eye at an inclination of 45 degrees. Slowly adjusting hand force and posture to make blood flow into capillary, immediately placing capillary into 1.5mL centrifuge tube after filling, standing whole blood at room temperature for 30min-120min, centrifuging at 5000rpm for 10min, collecting serum, and storing in refrigerator at-80 deg.C. Preimmune serum can be used as a control for subsequent experiments.

3. 60 μ g of immunogen (60 μ g of prime boost 30 μ g) was taken, diluted to 200 μ L with physiological saline, and an equal volume of freund's adjuvant (freund's complete adjuvant for prime boost and freund's incomplete adjuvant for boost) was added; the solution and adjuvant are mixed by a mixing instrument to form water-in-oil. And (3) performing subcutaneous injection immunization on the back and the abdomen of the uniformly mixed immunogen, and beating 8-10 points. A total of 5 mice were immunized and 4 boosts were performed.

4. The mouse is grasped firmly by one hand and the eyeball is exposed, the eyeball of the mouse is quickly removed by holding forceps by the other hand, blood is dripped into the tube by facing to a 1.5mL centrifuge tube, and the mouse is killed by pulling the neck after the blood dripping is finished. Standing the collected whole blood at room temperature for 2-3h, centrifuging at 5000rpm for 10min by a small centrifuge, and collecting serum.

5. ELISA assay potency

(1) Diluting the antigen with coating solution to a final concentration of 2. mu.g/mL, 100. mu.L/well, 4 ℃ overnight; then washing with washing liquor for 2 times; (2) liquid sealing, 200 mu L/hole, incubating at 37 ℃ for 2 h; then washing with washing liquor for 1 time; (3) the multiple antiserum was diluted in a 2-fold gradient from 200 fold (in PBS), the blank control (blank) was PBS, and the negative control (negative) was a 200-fold dilution of negative serum (inPBS); 100 mu L/hole, incubating at 37 ℃, and washing for 3 times by using washing liquor after 1 h;

(4) adding a secondary antibody which is diluted 20000 times by PBS (phosphate buffer solution), 100 mu L/hole, incubating at 37 ℃ for 1 h; taking out, and washing with washing solution for 3 times; (5) developing with developing solution 100 μ L/hole for 5-15 min; (6) adding 50 mu L of stop solution into each hole to stop; (7) measuring the light absorption value at double wavelengths (450, 630), recording and storing data, and performing graph analysis; (8) the titer is 1/2 dilution factor corresponding to the maximum OD value.

The mouse serum after ELISA titer determination was used as a primary antibody for subsequent experiments.

Fourth, SmERF73 protein expression purification and identification

1. Construction of expression vectors

The plasmid containing the SmERF73 gene prepared in example 1 was used as a template, PCR amplification was performed using a primer pair consisting of the primer pMAL-c2X-SmERF73-F and the primer pMAL-c2X-SmERF73-R, and the amplification product was digested simultaneously with BamH I and Sal I and ligated with the pMAL-c2X plasmid digested simultaneously with BamH I and Sal I to obtain the PMAL-c2X-SmERF73 plasmid (verified by sequencing).

pMAL-c2X-SmERF73-F：5’-CGGGATCCATGTGTGGCGGTGCAATCCTCG-3’；

pMAL-c2X-SmERF73-R：5’-CCCAAGCTTCTAGTGTTCACCGGAAACTTCA-3’。

2. Prokaryotic expression of proteins

(1) Respectively transferring the extracted recombinant plasmid and the empty vector plasmid into an escherichia coli BL21(DE3) protein expression strain, and screening by using 100 mu g/mL Amp antibiotics; (2) shaking the positive bacterial colony in LB liquid culture medium at 37 deg.c for overnight culture; (3) the next day, the cells were transferred and then shake-cultured on a shaker at 37 ℃ until OD₆₀₀0.6; (4) at this time, IPTG was added to a final concentration of 0.4mM, and the mixture was subjected to shake culture at 18 ℃ for 12 hours to complete protein expression.

3. Purification of proteins

(1) Placing the bacterial liquid in a centrifuge cup, centrifuging at 4 ℃ and 4000rpm for 10min, pouring off the supernatant, and repeating the process once again (the precipitate faces to the rotating shaft); (2) washing the precipitate with PBS, merging, transferring into a 15mL green cover centrifuge tube, centrifuging at 4 ℃ and 4000rpm for 10min, discarding the supernatant, and weighing the precipitate; (3) adding 5mL of Cloumn Buffer into each gram of thallus, adding PMSF and DTT until the final concentration is 1mM, and re-suspending; (4) carrying out low-temperature ultrasonic crushing for 10min (crushing for 5s, stopping for 5s, and 30Hz) until the mixture is semitransparent; (5) transferring into a 50mL round-bottom high-speed centrifuge tube, centrifuging at 12000rpm for 15min at 4 ℃; (6) taking the supernatant into a 1.5mL centrifuge tube, adding 40 mu L of the isovolumetric mixed solution of the Amylose beads and the Cloumn Buffer after alcohol removal, placing at 4 ℃, and carrying out rotary mixing for 2 h; (7) taking out, centrifuging at 4 deg.C for 3min at 500g, sucking supernatant, adding 1mL Cloumn Buffer to wash impurity protein for 4-5 times; (8) adding 200 mu L precipitation Buffer into the precipitate, placing the precipitate at 4 ℃, and rotationally mixing the precipitate for 1 h; (9) taking out 500g of the purified protein, and centrifuging for 3min at 4 ℃ to obtain a supernatant (MBP-SmERF 73).

And (3) detecting the recombinant protein MBP-SmERF73 by adopting the polyclonal antibody (Anti-SmERF73) prepared in the third step as a primary antibody. The result shows that the blot band of the MBP-SmERF73 is consistent with the expected position, the brightness is consistent with the concentration, the blot band is the special MBP-SmERF73 band, the protein expressed in the previous step is the recombinant protein MBP-SmERF73, and the Anti-SmERF73 antibody can specifically recognize the MBP-SmERF73 protein, thereby laying the experimental foundation for the subsequent ChIP experiment.

Fifth, EMSA experiment analysis SmERF73 protein in vitro combined with tanshinone biosynthesis related gene promoter

1. Probe preparation

By ddH₂O the 3' terminal biotin-labeled complementary oligonucleotide fragments were dissolved to a final concentration of 10. mu.M, respectively. 50 mu L of the dissolved oligonucleotide fragments are respectively taken, mixed, denatured at 95 ℃ for 10 minutes, naturally cooled and slowly renatured to be combined, and the probe with the molecular weight of 5 mu M is obtained. The probe sequences are shown in Table 8.

TABLE 8

2. Binding reaction

Preparing a reaction system from a non-protein group, a labeled protein group, an experimental group and a mutant group according to the following components, and reacting for 20 minutes at room temperature; the competition group was subjected to cold competition with "5. mu.M GCC-box" and reacted at room temperature for 20 minutes, and then the probe labeled with "125 nM GCC-box-biotin" was added and reacted at room temperature for 20 minutes.

MBP is obtained by expression and purification of Escherichia coli containing pMAL-c2X plasmid.

3. After the reaction in the step 2 is finished, performing non-denaturing polyacrylamide gel electrophoresis on the reaction system, and then performing film transfer and ultraviolet crosslinking on the reaction system by using LightShift^TMChemilmescent EMSA kit (Code No.20148, Thermo Fisher Scientific Co., USA)) And (5) carrying out hybridization development.

To demonstrate that SmERF73 can bind directly to GCC-Box, an electrophoretic migration transfer assay (EMSA) was performed using MBP-ERF73 fusion protein, and the probe schematic is shown in FIG. 11. The results in FIG. 12 show that significant DNA-ERF73 protein complexes (lane 3) were detected when 3 XGCC-Box and 2 XGCC-like-Box were used as the labeled probes. However, the binding activity was abolished by the G > T mutation of the 5' GCC base (lane 5). In addition, cold competitor probes (unlabeled 3 XGCC-Box and 2 XGCC-like-Box probes at 100-fold concentrations) attenuated the binding of SmERF73 to the labeled probe (lane 4).

To further confirm that SmERF73 binds to the promoter targets of SmDXR1, SmCPS1, SmKSL1 and SmCYP76AH3 genes, DNA fragments of 30-34bp in the GCC-motif region of the 4 gene promoters were synthesized as EMSA-specific probes, and a schematic diagram is shown in FIG. 13.

The results in FIG. 14 show that MBP-SmERF73 fusion protein can bind to the promoter fragment probe of these 4 tanshinone pathway genes (lane 3), but not to the DNA probe comprising the TCCTCC mutant (lane 5). And high concentrations of unlabeled DNA probe competitively inhibited the binding of SmEFR73 to the labeled DNA probe (lane 4). These results provide strong evidence for SmERF73 binding to 4 promoter fragments of tanshinone pathway gene containing GCC-box.

Sixthly, Y1H experimental analysis of SmERF73 in vitro combination with tanshinone biosynthesis related gene promoter

1. Construction of pBait-Abai plasmid

(1) Designing forward and reverse complementary sequences comprising SacI/XhoI cleavage sites on pAbAi vector (from Matchmaker Gold Yeast One-hybrid Screening System, Code No.630491, Clontech, Japan) and multiple tandem boxs for annealing to bind Bait fragments, as shown in Table 9;

(2) forward and reverse primers containing Sac I and Xho I cleavage sites on the pAbAi vector were designed for the promoter sequence to amplify the promoter sequence with cleavage sites (template is a cloning vector containing the promoters of SmDXR1, SmCPS1, SmKSL1 and SmCYP76AH3 genes constructed in step two), as shown in Table 9.

TABLE 9

(3) The product is subjected to double digestion by SacI/XhoI and then is connected with a pAbAi vector which is subjected to double digestion by SacI/XhoI to obtain recombinant plasmids (verified by sequencing), namely pAbAi-3 × GCC, pAbAi-2 × GCC-L, pAbAi-proSmDXR1⁸⁶⁶、pAbAi-proSmCPS1¹⁰⁴²、pAbAi-proProSmKSL1-L⁸⁵⁷、pAbAi-proProSmKSL1-S²⁸⁹And pAbAi-proSmCYP76AH3⁶³⁰。

2. Acquisition of Bait-Reporter Yeast Strains

(1 plasmid from Matchmaker Gold Yeast One-Hybrid library screening System, Code No.630491, Clontech, Japan) was linearized by digesting pBait-AbAi, pAbAi (blank control) and p53-AbAi (positive control, always in interaction with AD-Rec-p 53) with restriction enzyme BstB I.

(2) The linearized plasmid was purified and transferred to Y1HGold competent (from kit Matchmaker gold Yeast One-Hybrid Library Screening System, Code No.630491, Clontech, Japan) and subjected to selection culture using SD/-Ura medium; and selecting a colony which is normal in shape, clear in boundary, mellow and large from the plate for PCR identification.

3. Bait strain was tested using expression of AbAr (finding the lowest AbA concentration that inhibits growth of the bait strain)

(1) Selecting colony with normal shape, clear boundary, round and large size from bait (yeast strain containing gene promoter) and control strains (yeast strain containing no gene promoter), re-suspending with appropriate amount of 0.9% NaCl, and adjusting to OD₆₀₀To 0.01; (2) 100. mu.L of each of SD/-Ura with AbA (200ng/mL), SD/-Ura with AbA (300ng/mL) and SD/-Ura with AbA (500ng/mL) medium was applied, inverted cultured at 30 ℃ for 2-3d, and the lowest AbA concentration that inhibits the growth of the bait strain was examinedDegree; (3) when screening protein-DNA positive strains, experiments are carried out by using the concentration of the AbA which can completely inhibit the growth of the bait strain and is the lowest in the AbA concentration which can inhibit the growth of the bait strain and is higher than 100 ng/mL by 200 ng/mL.

4. Screening of protein-DNA Positive strains

(1) Preparing competent cells of bait and control strains; (2) transferring pGADT7-SmERF73 vector into (single transfer) receptor cells, and carrying out screening culture by using SD/-Leu culture medium; (3) selecting a colony which is normal in shape, clear in boundary, mellow and large from a plate for PCR identification; (4) the positive colonies were expanded to OD₆₀₀Centrifuging at 500 × g at normal temperature (1.0) (5), removing culture medium, re-suspending the bacteria solution with appropriate amount of 0.9% NaCl, and adjusting OD₆₀₀To 1.0, 0.1, 0.01 (i.e. 1-fold, 10-fold, 100-fold dilution); (6) colony growth (i.e., transcription factor binding to promoter) was analyzed by 2.5. mu.L each spot in SD/-Leu with AbA medium, respectively, as compared to control.

5. Results

The pAbAi-3 XGCC and pAbAi-2 XGCC-L recombinant plasmids are digested and linearized by restriction enzyme BstB I, transferred into a YIH Gold yeast report strain, screened and grown in an SD-Ura defective culture medium, and colony with regular morphology and plump colony is colony integrating 3 XGCC and 2 XGCC-L into yeast genome, and identified correctly by PCR to obtain a report strain containing 3 XGCC and 2 XGCC-L Bait (figure 15).

Through screening of report strains for AbA tolerance, the lowest AbA concentration for inhibiting the growth of report strains containing 3 × GCC and 2 × GCC-L Bait is found to be 300ng/mL, then AD-SmERF73 is introduced into yeast report strains containing 3 × GCC or 2 × GCC-L, and screening growth is carried out on SD-Leu/ABA (500ng/mL) plates, finally, yeast strains containing AD-SmERF73 and 3 × GCC or AD-SmERF73 and 2 × GCC-L can grow on SD-Leu/ABA (500ng/mL), and the fact that the AbA is resistant to AbA is proved^rThe reporter gene was expressed in a YIH Gold yeast strain, demonstrating that SmERF73 is indeed able to bind to tandem repeats of GCC-Box (FIG. 16).

The obtained pAbAi-proSmDXR1⁸⁶⁶、pAbAi-proSmCPS1¹⁰⁴²、pAbAi-proProSmKSL1-L⁸⁵⁷、pAbAi-proProSmKSL1-S²⁸⁹And pAbAi-proSmCYP76AH3⁶³⁰The recombinant plasmid is transformed into a YIH Gold yeast report strain after being subjected to restriction enzyme digestion linearization by restriction endonuclease BstB I, and is screened and grown in an SD-Ura defective culture medium, and a colony which is regular in shape and full is the integrated proSmDXR1⁸⁶⁶、proSmCPS1¹⁰⁴²、proProSmKSL1-L⁸⁵⁷、proProSmKSL1-S²⁸⁹And prommCYP 76AH3⁶³⁰Colonies in the yeast genome were identified correctly by PCR to obtain a plasmid containing ProSmDXR1⁸⁶⁶、proSmCPS1¹⁰⁴²、proProSmKSL1-L⁸⁵⁷、proProSmKSL1-S²⁸⁹And prommCYP 76AH3⁶³⁰The reporter strain of (1) (FIG. 17).

Screening for reporter strain tolerance AbA finds that the reporter strain contains proSmDXR1⁸⁶⁶、proProSmKSL1-L⁸⁵⁷、proProSmKSL1-S²⁸⁹And prommCYP 76AH3⁶³⁰The reporter strain of (1) has a minimum AbA concentration of 300ng/mL and comprises proSmCPS1¹⁰⁴²The lowest AbA concentration for growth of the reporter strain of (1) is 700 ng/mL. AD-SmERF73 was then introduced separately into the yeast reporter strain described above and screened for growth on SD-Leu/ABA (500ng/mL) plates. Finally, the compound contains AD-SmERF73 and ProSmDXR1⁸⁶⁶/proProSmKSL1-L⁸⁵⁷/proProSmKSL1-S²⁸⁹/proSmCYP76AH3⁶³⁰The yeast strain can grow on SD-Leu/ABA (500ng/mL), and simultaneously contains AD-SmERF73 and proSmCPS1¹⁰⁴²The yeast strain of (A) can grow on SD-Leu/ABA (800ng/mL), indicating that AbA^rThe reporter gene was expressed in a YIH Gold yeast strain, demonstrating that SmERF73 is indeed able to bind to proSmDXR1⁸⁶⁶、proSmCPS1¹⁰⁴²，proProSmKSL1-L⁸⁵⁷、proProSmKSL1-S²⁸⁹And prommCYP 76AH3⁶³⁰(FIG. 18).

Example 5 study of the binding and activation of the promoter in SmERF73 protein in vivo

ChIP-qPCR verification of SmERF73 in vivo combination with tanshinone biosynthesis related gene promoter

1. Sample collection

(1) Taking 2g of roots (pink and thin) of fresh salvia miltiorrhiza seedlings, removing soil, and placing in 100mL of 1% formaldehyde; (2) by means of vacuum tanksVacuum crosslinking is carried out under a pressure of 1kg/cm ²5 min; (3) releasing the pressure and repeating the step (2) for 2 times; (4) releasing the pressure, and adding 6.25mL of 2M glycine into the formaldehyde solution to a final concentration of 0.125M; (5) vacuumizing again for 10min, and terminating crosslinking; (6) releasing pressure, repeatedly rinsing the roots with clear water to remove formaldehyde and glycine; (7) quick freezing with liquid nitrogen, and grinding into fine powder.

2. Chromatin co-immunoprecipitation and qPCR detection

The powder collected in step 1 was subjected to ultrasonic disruption of chromatin, followed by addition of polyclonal antibody (Anti-SmERF73) prepared in example 4 for chromatin co-immunoprecipitation, followed by extraction of genomic DNA, and qPCR detection was performed using the genomic DNA as a template and primers in table 10.

The primers in the table were designed based on the analysis of the whole genome sequence of SmDXR1, SmCPS1, SmKSL1 and SmCYP76AH3, the amplified fragment size was 150bp, and the regions included the Promoter front segment Promoter 1(P1), the middle segment Promoter2(P2), the GCC-Box region (Box), the 5 'untranslated region (5' UTR) and the 3 'untranslated region (3' UTR), wherein only the Box fragment contained GCC-motif.

Watch 10

The results are shown in FIGS. 19-22. The results show that SmERF73 has significantly higher enrichment efficiency for Box region of SmDXR1 gene promoter than P1, P2, 5'UTR and 3' UTR regions, 5.2 times as high as P1 region, 2.1 times as high as P2 region, 25.4 times as high as 5'UTR region and 2.1 times as high as 3' UTR region. The enrichment efficiency of SmERF73 on the Box region of the SmCPS1 gene promoter is obviously higher than that of the P1, P2, 5'UTR and 3' UTR regions, and is 1.4 times of the P1 region, 1.6 times of the P2 region, 3.7 times of the 5'UTR region and 1.4 times of the 3' UTR region. The enrichment efficiency of SmERF73 on the Box region of the SmKSL1 gene promoter is obviously higher than that of the P1, P2, 5'UTR and 3' UTR regions, and is 4.3 times of the P1 region, 2.7 times of the P2 region, 2.0 times of the 5'UTR region and 2.1 times of the 3' UTR region. The enrichment efficiency of SmERF73 on the Box region of the SmCYP76AH3 gene promoter is obviously higher than that of the P1, P2, 5'UTR and 3' UTR regions, and is 1.5 times of the P1 region, 2.0 times of the P2 region, 2.1 times of the 5'UTR region and 1.6 times of the 3' UTR region. Taken together, the results show that SmERF73 binds to the promoters of SmDXR1, SmCPS1, SmKSL1 and SmCYP76AH3 in vivo, and in particular SmERF73 binds to GCC-box containing fragments more tightly than to other fragments.

The results show that SmERF73 is combined with GCC-box of salvia miltiorrhiza biosynthetic gene to further regulate the transcription of the gene.

Secondly, SmERF73 transcription activation tanshinone biosynthesis related gene promoter

1. Construction of pGWB17-SmERF73, pGWB35-ProSmDXR1⁸⁶⁶，pGWB35-ProSmCPS1¹⁰⁴²，pGWB35-ProSmKSL1⁸⁵⁷And pGWB35-ProSmCYP76AH3⁶³⁰Plasmids

(1) Using the cloning vector containing the promoters of the genes SmERF73, SmDXR1, SmCPS1, SmKSL1 and SmCYP76AH3 prepared in example 4 as a template, PCR amplification was performed using the primers shown in Table 11, and the PCR products were purified, respectively.

TABLE 11

(2) Carrying out BP reaction on the purified PCR product;

BP reaction system: mu.L of water, 0.5. mu.L of Salt, 1. mu.L of PCR-purified product, and 0.5. mu.L of pENTR/SD/D-TOPOVectror (Invitrogen).

BP reaction conditions: ligation was performed at 22 ℃ for 1.5 h.

(3) Taking the BP reaction product, and carrying out LR reaction.

LR reaction system: mu.L of TE Buffer (pH8.0), 1. mu.L of BP reaction product, 1. mu.L of pGWB17 or pGWB35, 1. mu.L of LLR clone II.

LR reaction conditions: water bath is carried out for 3h at 25 ℃, proteinase K is added, incubation is carried out for 10min at 37 ℃, LR reaction is stopped, and pGWB17-SmERF73 (containing SmERF73 gene) is obtained)，pGWB35-ProSmDXR1⁸⁶⁶(promoter containing the gene SmDXR 1), pGWB35-ProSmCPS1¹⁰⁴²(promoter containing SmCPS1 Gene), pGWB35-ProSmKSL1⁸⁵⁷(promoter containing SmKSL1 Gene) and pGWB35-ProSmCYP76AH3⁶³⁰(containing the CYP76AH3 gene promoter) (verified by sequencing).

2. The plasmids are respectively introduced into agrobacterium GV3101 competence to obtain recombinant bacteria.

3. The GV3101, GV3101 containing no load and Agrobacterium P19 (GV3101(PSOUP-P19) CHEMICALLY COMPETENT CELL Agrobacterium chemocompetent cells, Qiqi organism, cat # MF2469-1000UL) after transformation and identification were respectively expanded to OD₆₀₀1.0 or more; accurate determination of OD₆₀₀The 3 agrobacteria were mixed into a10 mL system according to the following table, so that the OD of each bacterium was determined₆₀₀About 0.5; mixing the three bacteria uniformly, centrifuging at 13000rpm for 1min, suspending in 10mL Infiltration medium, standing at 28 deg.C for 3-5 hr; injecting the back of the native tobacco by using a 1ml injector, injecting completely without leaving a gap as much as possible, marking the injected tobacco leaves by using a line hanging label, culturing for 2-3 days, and detecting fluorescence.

pGWB 35-promoles are pGWB35-ProSmDXR1⁸⁶⁶Or pGWB35-ProSmCPS1¹⁰⁴²Or pGWB35-ProSmKSL1⁸⁵⁷Or pGWB35-ProSmCYP76AH3⁶³⁰A plasmid.

The fluorescence of the leaves is detected by using a Lumazone living body imaging system and Winview software, and the fluorescence intensity is analyzed by using imageJ image analysis software.

The results are shown in FIG. 23. The results showed that DXR1pro, LUC, CPS1pro, KSL1pro, LUC, CYP76AH3pro, LUC reporter gene co-expressed with SmERF73 transcription factors were increased in fluorescence intensity 1.24, 1.43, and 1.38 times higher than the control, respectively, compared to the control lacking 35 Spro:smerf 73, indicating that SmERF73 binds to the promoters of SmDXR1, CPS1, SmKSL1, and SmCYP76AH3 genes and turned on the expression of the LUC reporter gene, indicating that SmERF73 can transcriptionally activate the expression of these four tanshinone biosynthetic genes.

Sequence listing

<110> institute of traditional Chinese medicine of Chinese academy of traditional Chinese medicine

<120> Salvia miltiorrhiza ERF-VII transcription factor SmERF73 participating in diterpene biosynthesis regulation and control and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>780

<212>DNA

<213> Salvia miltiorrhiza Bunge (Salvia militirhiza Bunge)

<400>1

atgtgtggcg gtgcaatcct cgccggactt attcccagcc gccacgtctc atccaccgac 60

atccttccta ccgccgcaga cttctggccg gccgctttca gctattctga ccagaacgac 120

gctcctcctc tcaaacgatc cagatcctct gcaggcgatg agcatgtgtc gaagaacaat 180

ggtccgaaga gtaagaagca gaggaaaaat ctgtacaggg ggatacggca gcggccgtgg 240

gggaaatggg cggcagagat tcgcgatcca cggaaaggcg tccgtgtttg gctgggcacg 300

tacaacactg ctgaagaagc cgcccacgct tacgacagag aggcgcgcaa aatcagaggg 360

aaaaaagcca aagtcaattt cccaaacgag gatgatgatt acagctgcaa ttacaatcct 420

agccctaatt tcgagtatta cagtgaattc aaccaggctg gattgggaat ttgcgattat 480

gtagaaacat tctacgccgt gaatgatgcc gctgatgcga agcctgaggc taacgagagc 540

ggcggtaaag atgcggtgat tggacctgcg gcggaggcgg cgaaggagga gaagcacgcg 600

gcggcggaga atgatgaagt gcagaagctg tcggaggagc tgatggcgta tgagaactac 660

atgaagttct atcagattcc gtattacgac gggcagtcgc agtcgccgcc gccgcctagt 720

aatccgccgc cagatacggt ggagctgtgg agcttcgatg aagtttccgg tgaacactag 780

<210>2

<211>259

<212>PRT

<213> Salvia miltiorrhiza Bunge (Salvia militirhiza Bunge)

<400>2

Met Cys Gly Gly Ala Ile Leu Ala Gly Leu Ile Pro Ser Arg His Val

1 5 10 15

Ser Ser Thr Asp Ile Leu Pro Thr Ala Ala Asp Phe Trp Pro Ala Ala

20 25 30

Phe Ser Tyr Ser Asp Gln Asn Asp Ala Pro Pro Leu Lys Arg Ser Arg

35 40 45

Ser Ser Ala Gly Asp Glu His Val Ser Lys Asn Asn Gly Pro Lys Ser

50 55 60

Lys Lys Gln Arg Lys Asn Leu Tyr Arg Gly Ile Arg Gln Arg Pro Trp

65 70 75 80

Gly Lys Trp Ala Ala Glu Ile Arg Asp Pro Arg Lys Gly Val Arg Val

85 90 95

Trp Leu Gly Thr Tyr Asn Thr Ala Glu Glu Ala Ala His Ala Tyr Asp

100 105 110

Arg Glu Ala Arg Lys Ile Arg Gly Lys Lys Ala Lys Val Asn Phe Pro

115 120 125

Asn Glu Asp Asp Asp Tyr Ser Cys Asn Tyr Asn Pro Ser Pro Asn Phe

130 135 140

Glu Tyr Tyr Ser Glu Phe Asn Gln Ala Gly Leu Gly Ile Cys Asp Tyr

145 150 155 160

Val Glu Thr Phe Tyr Ala Val Asn Asp Ala Ala Asp Ala Lys Pro Glu

165 170 175

Ala Asn Glu Ser Gly Gly Lys Asp Ala Val Ile Gly Pro Ala Ala Glu

180 185 190

Ala Ala Lys Glu Glu Lys His Ala Ala Ala Glu Asn Asp Glu Val Gln

195 200 205

Lys Leu Ser Glu Glu Leu Met Ala Tyr Glu Asn Tyr Met Lys Phe Tyr

210 215 220

Gln Ile Pro Tyr Tyr Asp Gly Gln Ser Gln Ser Pro Pro Pro Pro Ser

225 230 235 240

Asn Pro Pro Pro Asp Thr Val Glu Leu Trp Ser Phe Asp Glu Val Ser

245 250 255

Gly Glu His

Claims (10)

1. A protein which is any one of the following (A1) to (A4);

(A1) a protein having an amino acid sequence of SEQ ID No. 2;

(A2) a protein obtained by substituting and/or deleting and/or adding (A1) by one or more amino acid residues and having the same function;

(A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence defined in any one of (A1) to (A2) and having the same function;

(A4) a fusion protein obtained by attaching a protein tag to the N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A3).

2. A gene encoding the protein of claim 1.

3. The gene of claim 2, wherein: the gene is a DNA molecule as described in any one of (B1) to (B3) below:

(B1) DNA molecule shown in SEQ ID No. 1;

(B2) a DNA molecule which hybridizes with the DNA sequence defined in (B1) under strict conditions and codes for a protein with the same function;

(B3) and (B) the DNA molecule which has more than 90% of identity with the DNA sequence limited by (B1) or (B2) and codes the protein with the same function.

4. A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacterium comprising the gene of claim 2 or 3.

5. Use of the protein of claim 1 as a transcription factor.

6. The protein of claim 1, or the use of the gene of claim 2 or 3, which is any one of the following (C1) - (C5):

(C1) regulating the expression of key enzyme gene for tanshinone biosynthesis;

(C2) activating the transcription of key enzyme genes for tanshinone biosynthesis;

(C3) combining with a promoter of a key enzyme gene for tanshinone biosynthesis;

(C4) binding to a promoter having a GCC-Box region;

(C5) regulating and controlling the synthesis of tanshinone substances.

7. A method for improving the expression quantity of key enzyme genes for biosynthesis of plant tanshinone and/or the synthetic quantity of tanshinone substances comprises the following steps: improving the activity and/or abundance of the protein as claimed in claim 1 in the target plant to obtain the plant with improved expression level of key enzyme gene for tanshinone biosynthesis and/or improved tanshinone substance synthesis level.

8. A method of making a transgenic plant comprising the steps of: introducing the gene of claim 2 or 3 into a plant of interest to obtain a transgenic plant; the expression quantity of the key enzyme gene for tanshinone biosynthesis and/or the synthetic quantity of tanshinone substances are higher than that of the target plant.

9. Use of the protein of claim 1, or the gene of claim 2 or 3, or the method of claim 7 or 8 in plant breeding.

10. A method or use according to any one of claims 7 to 9, wherein: the plant is Saviae Miltiorrhizae radix.

Images