CN111518806A - Acetobacter pasteurianus promoter and application thereof - Google Patents

Abstract

The invention discloses a acetobacter pasteurianus promoter and application thereof, belonging to the field of gene and metabolic engineering. The invention selects a nucleotide sequence between a constitutive gene and the last gene in acetobacter pasteurianus as a candidate promoter, and adopts an enhanced green fluorescent protein gene egfp as a reporter gene to construct a promoter fluorescent probe plasmid. Then detecting the transcription level and the protein expression level of the reporter gene egfp in the recombinant strain by a fluorescent quantitative PCR and a fluorescent microplate reader to determine the strength of the promoter; finally, the product is processedAnd (3) screening a constitutive strong promoter. The promoter of the invention has the function of effectively expressing endogenous or exogenous genes in acetobacter pasteurianus, and is compared with a commonly reported promoter P_adhCompared with the high-activity promoter, the promoter has higher promoter activity and can be used for constructing the genetic engineering bacteria for high yield of acetic acid.

Description

Acetobacter pasteurianus promoter and application thereof

Technical Field

The invention relates to a acetobacter pasteurianus promoter and application thereof, belonging to the field of gene and metabolic engineering.

Background

A promoter is a region of a DNA sequence that can bind to RNA polymerase to initiate transcription, and is a component of a gene that controls the timing of initiation and the degree of expression of the gene (transcription). The screening of the promoter has very important significance for the research of an expression regulation mechanism in an organism and the realization of the expression of a target gene.

Acetobacter pasteurianus protease strain CICIM B7003 is an acetic acid high-producing strain taking ethanol as a substrate, and is widely used for producing acetic acid in industry. In recent years, traditional breeding, adaptive evolution and directed evolution technologies are widely applied to screening of extreme microorganisms, and some acid-resistant and high-yield acetic acid bacteria are successfully bred, but the three methods are complex to operate, large in workload, long in time period, unobvious and unstable in effect of improving the yield of acetic acid, and are difficult to improve on the basis.

Research shows that high-concentration acetic acid has serious feedback inhibition effect on the growth of acetic acid bacteria cells and the synthesis of products, and is a bottleneck problem that the yield and the production intensity of the acetic acid are difficult to improve. Improving the acid resistance of acetic acid bacteria cells is an effective means for improving the yield of acetic acid. Acid resistance of acetic acid bacteria cells is influenced by respiratory chain productivity, and key dehydrogenases (ethanol/aldehyde dehydrogenases) participating in respiratory chain productivity all take pyrroloquinoline quinone (PQQ) as a coenzyme and participate in electron transfer in the respiratory chain. Gupta et al determined that The PQQ synthesis-related gene in G.oxydans is The pqqABCDE gene cluster (Felder M, Gupta A, Verma V, et al (2000) The pyrazoloquinoline synthesis genes of Gluconobacteroxydans. FEMS Microbiol Lett,193(2): 231. sup. 236.).

At present, the research on the transcription regulation level of the acetobacter pasteurianus promoter in China is less, and the obtained efficient promoter can be used in A.pateurianus and can inject new activity for the gene and metabolic engineering modification of an industrial production strain A.pateurianus CICICIM B7003.

Disclosure of Invention

In order to solve the defect that the deficiency of a corresponding genetic operation system of the acetobacter pasteurianus restricts the improvement of the acetobacter pasteurianus genetic engineering, the invention provides a constitutive promoter of the acetobacter pasteurianus.

The invention provides a constitutive promoter of acetobacter pasteurianus, wherein the nucleotide sequence of the promoter is shown as SEQ ID No.7 or SEQ ID No.9 in a sequence table.

The invention provides an expression vector, which carries a nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO. 9.

The invention provides a microbial cell containing the promoter or the expression vector.

In one embodiment of the invention, the microbial cell is acetobacter pasteurianus.

The invention provides a method for improving gene expression quantity, which utilizes a promoter coded by a nucleotide sequence shown by SEQ ID NO.7 or SEQ ID NO.9 to start the expression of a gene.

In an embodiment of the invention, the gene is egfp, and the nucleotide sequence of the gene is shown as SEQ ID NO. 12.

The invention provides a method for improving the yield of PQQ or acetic acid, which comprises the steps of connecting a pqqABCDE gene to a vector containing a nucleotide sequence shown in SEQ ID No.7 or SEQ ID No.9, transferring the vector into acetobacter pasteurianus to construct a recombinant bacterium, and fermenting by using the recombinant bacterium to produce the acetic acid.

In one embodiment of the invention, the nucleotide sequence of the pqqabccde gene is shown in SEQ ID No. 13.

The invention provides a method for producing PQQ or acetic acid, which is to use the recombinant bacteria for fermentation production. In one embodiment of the invention, the recombinant bacterium is inoculated into a GY liquid medium for fermentation.

The invention provides the application of the vector, the microbial cell, the method for improving the gene expression level, the method for improving the yield of PQQ or acetic acid, or the method for producing PQQ or acetic acid in the preparation of acetic acid in the fields of chemical industry, food and medical treatment.

The invention has the beneficial effects that: the two promoters used in the invention can improve the transcriptional activity and the expression level of a target gene, and the transcriptional activity is 6.45 times and 2.90 times of that of a control; when the method is applied to acetic acid production by acetobacter pasteurianus, the yield of the acetic acid can be obviously improved, and the yield can be respectively improved by 44.5 percent and 27.2 percent compared with a control. Has important significance for promoting the application of the biological method for producing the acetic acid in the industry.

Drawings

FIG. 1 shows FPKM values of promoter candidate library.

FIG. 2 is a schematic diagram showing the construction of the promoter probe plasmid pBBR1MCS 2-Promter-egfp.

FIG. 3 shows the expression level of egfp protein in recombinant strains detected by the promoter.

FIG. 4 shows the promoter detection of egfp transcript levels in recombinant strains.

FIG. 5 shows PQQ contents of the original strain and the recombinant strain.

FIG. 6 shows the acetic acid content of the original strain and the recombinant strain.

Detailed Description

GY solid Medium: 10g/L of yeast extract, 10g/L of glucose, 1000mL of deionized water and 18g/L of agar powder.

PBS buffer (pH 7.4): 8g/L NaCl, mg/LKCl200, 1.44g/L Na₂HPO₄，240mg/LKH₂PO₄。

Example 1: initiation of construction of screening libraries

Selecting a promoter P of a reported acetobacter pasteurianus-derived ethanol dehydrogenase gene adhA according to the sequencing result of an A.pasteurianus transcriptome_adh(H11) As controls (Wu X, YaoH, CaoL, ZHENGZ, ChenX, ZhangM, WeiZ, ChengJ, JiangS, PanL, Li X. (2017) Improving Interactive Acid Production by Over-expression PQQ-ADH in Acetobacter passareanus. frontiers in Microbiology,8:1713), all nucleotide fragments between constitutive genes having high FPKM values and the ORF of the previous gene were selected and the possible promoter sequences were scored using promoter on-line evaluation software (http:// www.softberry.com) to construct a promoter candidate library(FIG. 1).

According to the screened candidate promoter library, Acetobacter passeurianus CICICIM B7003 genome is used as a template to amplify a promoter H1 (nucleotide sequence is shown as SEQ ID NO. 1), H2 (nucleotide sequence is shown as SEQ ID NO. 2), H3 (nucleotide sequence is shown as SEQ ID NO. 3), H4 (nucleotide sequence is shown as SEQ ID NO. 4), H5 (nucleotide sequence is shown as SEQ ID NO. 5), H6 (nucleotide sequence is shown as SEQ ID NO. 6), H7 (nucleotide sequence is shown as SEQ ID NO. 7), H8 (nucleotide sequence is shown as SEQ ID NO. 8), H9 (nucleotide sequence is shown as SEQ ID NO. 9), H10 (nucleotide sequence is shown as SEQ ID NO. 10) and H11 (nucleotide sequence is shown as SEQ ID NO. 11).

In order to determine the strength of the 11 promoters, the promoters H1, H2, H3, H4, H5, H6, H7, H8, H9, H10 and H11 and the reporter gene egfp (see SEQ ID NO.12 for the egfp gene sequence) are cloned into a broad-host vector pBBR1MCS2 by adopting an enzyme digestion ligation (enzyme digestion sites: BamHI and KpnI) method to construct a promoter fluorescent probe plasmid pBBR1MCS2-Promter-egfp (FIG. 2). PCR amplification reactions were amplified with the high fidelity DNA polymerase PrimeSTAR HS (premix) (TaKaRa), and the amplification primers are shown in Table 1.

Primer sequences used in Table 1

Example 2: screening of starter libraries

1. Construction of recombinant bacteria for promoter effect detection

The preparation steps of the competent cells are as follows:

(1) inoculating acetobacter pasteurianus preserved in a glycerol tube into GY liquid culture medium, and performing shaking culture at 30 ℃ and 170rpm overnight; inoculating into 50mL GY liquid medium at 10%, shaking at 170rpm at 30 deg.C to OD₆₀₀The value is 0.8-1.2;

(2) transferring the bacterial liquid obtained in the step (1) into a precooled 50mL centrifuge tube, centrifuging at 4 ℃ and 4000rpm for 5min, discarding the supernatant, and collecting thalli;

(3) resuspending the thallus with 30mL of precooled 10% glycerol solution, centrifuging for 5min at 4 ℃ and 4000rpm, discarding the supernatant, and collecting the thallus;

(4) repeating the step (3) once;

(5) add 500. mu.L of pre-cooled 10% glycerol solution to resuspend the cells, prepare into electroporation competent cells, 80. mu.L of each cell was dispensed into sterile EP tubes, and store at-80 ℃ for use.

In the step (1), the formula of the GY liquid culture medium is as follows: 10g/L yeast extract, 10g/L glucose and 1000mL deionized water; sterilizing with high pressure steam at 115 deg.C for 30 min;

the acetobacter pasteurianus electric shock conversion method comprises the following steps:

(1) adding DNA molecules with the concentration of 1.2-1.8 mug/microliter into the pasteurella acetate competent cells, and gently mixing the DNA molecules and the pasteurella acetate competent cells;

(2) transferring the competent cells into a precooled 1.0mm electric rotor cup, and standing for 5-10min on ice;

(3) performing electric conversion with reference to the Bio-Rad electric conversion instrument specification, wherein the electric field intensity is 1.8kV, the resistance is 200 omega, the capacitance is 25 muF, and the electric conversion time is 5 ms;

(4) immediately adding fresh GY culture medium after electric shock, re-suspending the cells and transferring the cells into a centrifuge tube, culturing at 30 ℃ and 170rpm for 2-4h by shaking;

(5) the bacterial liquid is coated on a GY solid culture medium plate containing 25 mu g/mL kanamycin, inverted culture is carried out for 3-5 days at the temperature of 30 ℃, and transformants are picked and subjected to PCR verification by using corresponding primers in the table 1.

Preparing competent cells, and adopting an electric shock transformation method to electrically transform 11 constructed promoter probe plasmids into a wild type A.pateurians CICICIM B7003. A single colony of the transformant is picked up, colony PCR verification is carried out by using primers in table 1, positive clones are obtained, and the positive clones containing promoters from H1 to H11 are named as A.P. -pH1, A.P. -pH2, A.P. -pH3, A.P. -pH4, A.P. -pH5, A.P. -pH6, A.P. -pH7, A.P. -pH8, A.P. -pH9, A.P. -pH10 and A.P. -pH11 respectively.

2. Determination of protein expression levels

Each positive strain (a.p. -pH1, a.p. -pH2, a.p. -pH3, a.p. -pH4, a.p. -pH5, a.p. -pH6, a.p. -pH7, a.p. -pH8, a.p. -pH9, a.p. -pH10 and a.p. -pH11) which verified to be correct was inoculated in GY medium containing 25 μ g/mL kanamycin and cultured with shaking at 30 ℃ and 170 rpm. 2ml of the bacterial suspension was collected at 4h, 8h, 12h, 24h, and 48h, and the cells were washed 2 times with PBS (pH 7.4) buffer to remove dead cells, cell secretions, and media-precipitated components, thereby reducing the fluorescence detection background. Fluorescence detection was performed using NUNC 96-well black microplate, and OD was performed using 96-well white cell culture plate₆₀₀Detection (fluorescence and OD)₆₀₀Detection is carried out in 4 multiple holes, and 200uL of bacterial liquid is added into each hole). The fluorescence intensity parameters were set to, Ex/Em: 488/509 nm. OD₆₀₀The parameters were set to absorb light at 600 nm.

As shown in fig. 3, the fluorescence intensity of the promoter recombinant strains a.p. -pH7 and a.p. -pH9 is significantly higher than that of the control strain a.p. -pH11, which indicates that the protein expression levels of the promoters H7 and H9 are significantly higher than that of the reported common promoter H11 (P7 and H9 are significantly higher than that of the promoter H11 (P)_adh) The expression intensity was 14.55-fold and 4.53-fold, respectively.

3. Promoter transcript level determination

Extraction of total RNA: taking a proper amount of Acetobacter pasteurianus cultured to the middle and later logarithmic stages, extracting the total RNA of the Acetobacter pasteurianus by using a UNlQ-10 column type Trizol total RNA extraction kit of a biological company, and detecting the purity and the concentration of a sample by using an ultraviolet spectrophotometry.

And (3) cDNA synthesis: RNA was Reverse transcribed into cDNA using Maxima Reverse Transcriptase Transcriptase from Thermo Scientific.

Fluorescent real-time quantitative PCR: a. pateurinus 1696 rRNA is used as an internal reference gene, and fluorescent quantitative PCR primers of 16S rRNA and egfp are designed according to a fluorescent quantitative PCR primer design principle, and the primers are shown in Table 2.

Primer sequences used in Table 2

20 μ L reaction: forward and reverse primers were 0.4. mu.L each, cDNA 2. mu.L, 2 XFastSYBR Green MasterMix 10. mu.L, ddH2O 7.2.2. mu.L.

The reaction conditions were set as follows: denaturation at 95 ℃ for 3min, 5s at 95 ℃ and 30s at 60 ℃ for 45 cycles; each sample was replicated in 3 tubes.

As shown in FIG. 4, the transcription levels of egfp in the promoter recombinant strains A.P. -pH7 and A.P. -pH9 were 6.45 times and 2.90 times of A.P. -pH11, respectively, and this study showed that the transcriptional activities of the promoters H7 and H9 were those of the conventional promoter H11 (P7 and H9 are those of the conventional promoter H11 (P)_adh) 6.45 times and 2.90 times.

Example 3: construction and application of over-expression recombinant bacteria

1. Construction of recombinant bacterium

A, protease nucleic CICICIM B7003 genome is used as a template, and a primer is used for amplifying a pqABCDE gene (the nucleotide sequence is shown as SEQ ID NO. 13). The primers are shown in Table 3.

Primer sequences used in Table 3

After the target fragment is digested by restriction enzymes (the digestion sites are spe I and Pvu I) and the glue is recovered, the target fragment is connected to a plasmid pBBR1MCS2-H7/9/11 which is digested by the restriction enzymes, so that an over-expression recombinant vector is obtained: pBBR1MCS 2-H7-pqABCDE, pBBR1MCS 2-H9-pqABCDE and pBBR1MCS 2-H11-pqABCDE (controls). The constructed over-expression recombinant vectors were introduced into a. pateuricanus CICIM B7003, respectively, using the acetobacter pasteurianus shock transformation method in example 2, and it was verified that correct transformants were named recombinant bacteria a.p. -pH 7-pqqbcde, a.p. -pH 9-pqabcde, and a.p. -pH 11-pqabcde), respectively.

2. Shaking flask fermentation of recombinant bacteria

Respectively inoculating acetobacter pasteurianus A.P. -pH7-pqqABCDE, A.P. -pH 9-pqABCDE and A.P. -pH 11-pqABCDE which are preserved in a glycerin tube to a GY liquid culture medium containing 25 mu g/mL kanamycin, and carrying out shaking culture at 30 ℃ and 170rpm for 24 hours to obtain a bacterial liquid; transferring the strain solution into GY liquid medium (containing 25. mu.g/mL kanamycin and 4% (v/v) absolute ethanol) at an inoculum size of 10% (v/v), performing shake flask fermentation at 30 deg.C and 170rpm for stationary phaseInitial stage (OD)₆₀₀1.2 to 1.5).

Taking the initial stage of stationary phase (OD)₆₀₀1.2-1.5), and determining the content of pyrroloquinoline quinone PQQ (figure 5) by using a recombinant enzyme method (the specific steps refer to summer rain, Zhongjing, Chenjian. (2017) establishment and optimization of a pyrroloquinoline quinone high-throughput detection method, a report of food and biotechnology, 36(02): 122-. The fermentation broth in the stationary phase of the growth of the cells was taken and the acid production of the recombinant strain was determined by acid-base titration (see "inorganic and analytical chemistry" by Jia careful, Press of Chinese university of agriculture) (FIG. 6).

As shown in the results of fig. 5, the PQQ concentrations of a.p. -pH 7-pqqacde and a.p. -pH 9-pqqacde were greatly increased as compared with the control strain a.p. -pH 11-pqqacde, 8.1 times and 4.0 times, respectively, of the control strain.

As shown in the results of fig. 6, the acetic acid production of the strain overexpressing pqqabccde using the promoters H7 and H9 (a.p. -pH 7-pqabcde, a.p. -pH 9-pqqcbe de) was increased by 44.5% and 27.2% respectively as compared to the control strain (a.p. -pH 11-pqabcde).

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> Acetobacter pasteurianus promoter and application thereof

<160>43

<170>PatentIn version 3.3

<210>1

<211>266

<212>DNA

<213>Acetobacter pasteurianus

<400>1

caagcggcgg cggctcgccc gaaatggcgc agttctgaaa gggtgatcag atagcgtaat 60

tgctgggcag aaggcagcgg cagcacggcg tgatttcctg atgcaatgta tctgagaggc 120

aaatgttcgg catttcatcg aatacttcaa tgattttgat ataaaatatt cattggctta 180

aatgaaaaag ccgcgccata caggacaaca cagccggtgg cacgttggtg ctgcatggcg 240

tgtgccaagc tataaggagc aagatt 266

<210>2

<211>237

<212>DNA

<213>Acetobacter pasteurianus

<400>2

ctccccaata cgcccgatca tgcaggtgcc ttctatacgt aaagtgtaga gggtatctgc 60

atattgtttg ttaaaaatgc tgcattgttc tttagatatg ggaagcgatg ttatgacatg 120

cacgcatttc cggcacgctg aatcagggca tgtaaaattg atctggatca agggaggggc 180

gatcagaaag cggtgatact cctaagcgtg atcacaaggg tgccgcgtgc cgggccc 237

<210>3

<211>220

<212>DNA

<213>Acetobacter pasteurianus

<400>3

caccatgcag gatcggcttt ccaatgagct tctggatgcc gtcaacaatc gtggcgcagc 60

agtgaagaag cgggaagata cccaccgtat ggcggaagct aacaaagcat tcagccacta 120

tcgctggtaa tgaaagaagc tgctgcattt cctcttgcag tgagtttgca gggcttataa 180

caactgcatc ccgaatagtt tttggggcat ggagtaaaaa 220

<210>4

<211>180

<212>DNA

<213>Acetobacter pasteurianus

<400>4

ggcgcttgat gttaaggctg gtgaccgcgt cctgttcggc aaatggtccg gcacggaagt 60

gaagatcgac ggcgaagagc tgctgatcat gaaggaaagc gacatcatgg gcgtggtaac 120

cgcctgattt tgcgctgatc cgcattttaa tttcagaacg atcttcacag gagaaattca 180

<210>5

<211>323

<212>DNA

<213>Acetobacter pasteurianus

<400>5

aaattggctg tttatgcaga aaaccccaca tcacaaaaat gtgatgtggg gtttttgctg 60

tccataattt ggccgcaata aaggcggata caggcaataa gcagaactgt gtctttttcg 120

tctcactcaa tgtatggcag gtatgagata cagagatgca acttgaccca cagaataagc 180

tatggcttag ggcaagttgg tctccaaaat tcgtcggctc ttcgaagggt tcggagagga 240

gcagaagaag acgcggggat acaaggttag aactcttttc tcccgaatag ttccgcaagg 300

aaccaattct caggatccga cac 323

<210>6

<211>221

<212>DNA

<213>Acetobacter pasteurianus

<400>6

tgccaaggct tcctgatcag gaggttacgg catggcggca ggtaaaaaat cctgcccgcc 60

aaggtgtttt cccttcttga aaaagagaaa acgccaccat acatcagggt tatcattcag 120

gcctgctttt accccgttat gggcagagcg ggcgggtaaa tgaaagcaag ggccttttct 180

ggtgcttcgg gccggatggg gtcgctgaaa gggaatatat a 221

<210>7

<211>445

<212>DNA

<213>Acetobacter pasteurianus

<400>7

gctttttctt ccatttggcc atgtgcgggc atgattctag gctgttctta atggataata 60

cccgcacaag aaagcccgtt tccccttatc ctgtcctgct gtggctatca tgccagcatc 120

gggtgggtat gggcgcggag atatcacata actgtgagat taagaaaagt gtgtgaaact 180

cccgccaatt tcatgctttt ctatagtcgc acgctgttgg ctgtgctacg gaaacagtgg 240

gcgcatttgc agctttcagg aacgggaacg gtggcgtttt cttcaaatta cgtaaacctg 300

tcaacccatt ccggcaaact gcccgttttt caatatcggg agaagcttca gccttctccg 360

tactccagga tcaagaccgt tgaaaagtaa caggaccgac cgcagctctc gttttcctcg 420

ccgcggcgga tttgatgacg attac 445

<210>8

<211>421

<212>DNA

<213>Acetobacter pasteurianus

<400>8

ctggggccaa agcgcgaatc agctcgttat ggaaagccag aagaacataa gcggcatcac 60

gcacagatga aggcaaaaac cacaggcaca gcgcccggtc cgggtctgcc tgcacagctt 120

tttgcacctc cattacaaga ggctgatgtt tctgccgtgc cattaacccc agtatctccc 180

taaccctaac gtggcttgat gtgcgggaaa cctgtgcatg gttcatgcgt ttgaataatc 240

ccgctttcct aacggaaggc ccttattgtg cgccctactg gcaaggcaag tttccgtgag 300

tatggctgcg caaggcactt gtcatgcgcc tttcccttga cgcatctgcc ccgcgcccat 360

agctctggaa ctcaggtgtg ttccctcaca cgccccgcct ttagaattac ggagtattaa 420

a 421

<210>9

<211>162

<212>DNA

<213>Acetobacter pasteurianus

<400>9

gggtgcgata ttgtcaccga aatgtatcag tctggtgaac tgcagaacct gttcaaggaa 60

aaaaacattc cttgtaacgc cccagcctga tttttgggtt gtcaagtggg ggtgggcctg 120

tatagtccct aaagaaaaga gaaacaggtt gggatcagat ta 162

<210>10

<211>234

<212>DNA

<213>Acetobacter pasteurianus

<400>10

ggggaactgc cccacgtgcc tgttacggtt gcgagggcaa cggcctgccc ctgacgtgcc 60

cagagtagag cgtgatcaag aggcgtaaca agttgggaaa agagggctgg aactgtcatg 120

cctcaatcct atatcactca gcacgcagac tgcacatcag cagcgcagca gcgctggtgg 180

ttaaatgtcg cataatacgg catgctggca ggctgataga gtgatttgaa aagg 234

<210>11

<211>208

<212>DNA

<213>Acetobacter pasteurianus

<400>11

caagaattgt aagcgccttt cataacctga ttgtgagcat aatttcctgc tctacaggcc 60

tgtaagcacg ggaaattatc ccgcagaatg gaagctgcta ttccttcccc gtgattgaca 120

gacagcgttc cccttggctg ttgtgtgaga aaccggcctg ccggctatct ttttcctcac 180

cgtatataat agtcgaggac atgaacgc 208

<210>12

<211>1028

<212>DNA

<213>Acetobacter pasteurianus

<400>12

atgggtaagg gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60

gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120

aaacttaccc ttaaatttat ttgcactact ggaaagcttc ctgttccttg gccaacactt 180

gtcactactc ttacttatgg tgttcaatgc ttttcaagat acccagatca tatgaagcgg 240

cacgacttct tcaagagcgc catgcctgag ggatacgtgc aggagaggac catcttcttc 300

aaggacgacg ggaactacaa gacacgtgct gaagtcaagt ttgagggaga caccctcgtc 360

aacagaatcg agcttaaggg aatcgatttc aaggaggacg gaaacatcct cggccacaag 420

ttggaataca actacaactc ccacaacgta tacatcatgg cagacaaaca aaagaatgga 480

atcaaagtta acttcaaaat tagacacaac attgaagatg gaagcgttca actagcagac 540

cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600

ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660

cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaataagaa 720

ttctgcagat atccatcaca ctggcggccg ctcgagcatg catctagagg gccgcatcat 780

gtaattagtt atgtcacgct tacattcacg ccctcccccc acatccgctc taaccgaaaa 840

ggaaggagtt agacaacctg aagtctaggt ccctatttat ttttttatag ttatgttagt 900

attaagaacg ttatttatat ttcaaatttt tctttttttt ctgtacagac gcgtgtacgc 960

atgtaacatt atactgaaaa ccttgcttga gaaggttttg ggacgctcga aggctttaat 1020

ttgcggcc 1028

<210>13

<211>3205

<212>DNA

<213>Acetobacter pasteurianus

<400>13

atggcttgga ctgcaccaaa agtaaccgaa attccgttgg gcgctgaaat caacagctac 60

gtttgcggcc agaagaaata agtcagggtt atacccagct tagccgccag ccattaccgg 120

tgtgaacgcc ggttttgcac tggcggcttt tttatttaga tgtgttgtta tgcttgagat 180

tgttgttctt ggtgcaggtg caggtggcgg ttttccacaa tggaattcta acgcccccgc 240

ttgccgccgc gcccgtgcgg gagaccccgc agccccttcc cgcactcagg cctccattgc 300

tgtaagcgga gatggccagc actggtatgt gctcaatgcc tcacccgatc tgcgcaccca 360

gatcaaccag acaccggata tgttcccgcg tgaggggctg cgctccaccc ccatttctgg 420

cgttgtgctc acaagtgggg aaatcgatgc cattacgggc ctgttaaccc tgcgggaacg 480

gcagcatttt aatctgtatg ccacacagcc tgtgctcgat cagctcaacg caaaccctat 540

ttttaatgca ttggatcgca cgcttgtgcc gcgccatgcc atgcagccag aacaccctat 600

tcctttagtg cctgccggat ttagcatcac gccgtttatt gtgccgggca aagtgcccct 660

ttacgcagaa aaggctgaaa accctgctga aatcatgagc aatggggaaa acattgggct 720

ggaaataacg gacggccacg cccgcgccct gtttattccc ggctgcgcga tgatgacgga 780

tgccctacgc aaccgcataa acggcgcaga tgttgtgttt tttgatggca cgttgtggac 840

ggatgatgaa atgatccgtg ccgggcttgg cagcaaaact ggccaccgcatgggccatat 900

gtctattgca gatgagccag atggcaccat tgccgccttc cgccccttgc atgtgaaacg 960

taaaattctc atccacatca acaattccaa ccctattctg ctggccgatt caccagaacg 1020

tcgtgccgta gagcaagccg gatgggatgt tgcatttgat ggaatgaaag tcttgctatg 1080

accaaccaac tgctcacccc ggatgaactg gaaaaagccc tgcgtgccat aggcgcagaa 1140

cgctaccata acctgcaccc tttccaccgt gcgctgcatg acggcaaact gaacaaaggg 1200

caggttcagg catgggcatt gaacagatat tactatcagg ccagtatccc cgcgaaagat 1260

gcctctctcc ttgcgcgcct ccccaccgcc gaactgcggc gtgaatggcg gcggcggctg 1320

gaagaccatg atggcacaga accaggttct ggtggtgtgg cgcgttggct gaagctgaca 1380

gatgggcttg ggctggaccg tgcgtatgta gaatcactcg aaggcctgct gcccggcaca 1440

cggtttgctg tagaagccta tgtgcatttt gtgcgtgaac gctctgtgct ggaagccatt 1500

gcatcttccc tgacagaact gttctccccc accattatca gcgaacgtgt ttcgggcatg 1560

ttgcgcaact atgccttcat taccgaagaa acactggctt actttaagcc acgcctcact 1620

caggccccgc aagattctgc ctttgctctg gcttatgtaa aggagcatgc ccgcacggtt 1680

gaacaacagc agagtgtgct caacgcgcta aagtttaaat gtggggtgtt gtggtccatg 1740

ctggatgcgt tggattacgc ttatgtcacg cccgcacgta ttcccccagg cgcttttcgc 1800

ccagaaactg cggcataagc caaatagctg atacttcaat gatttctgaa aacagtatcc 1860

tccgctttgc ccggggcaca cgcttgcaac atgaccgcgt gcgagatgta tggttcattc 1920

aagcacctga acgcgccttt catgcagacc ctattgctgt tgaagtgctg caacttatag 1980

atggcacccg caatgtgggg ggcatactgg atctactttg ccagaaattt gccgccccac 2040

gggacattat cgcacaggat gtgctgaccc ttttacggga tctggccacc aaacaggttt 2100

tgcaagccat atgagtgctc cgccgccccc catgagcttg cttgcagagc tcacgcaccg 2160

ctgccctctg caatgccctt actgctctaa ccccttgcaa ctggaaccac gcacacaaga 2220

acttggcact gaggactgga agcgtgtgct gagtgaagct gctgaaatgg gcgtattgca 2280

ggttcacttt tctggtggtg agcctatggc gcggccagat ctgcctgagc ttgtggctca 2340

tgcagccaag gcaggattat acagcaatct gatcacctcc ggcgtgctgc tcaatgccaa 2400

aaacctgcaa gaactggctg atgctgggtt agaccacatt cagctttcct ttcaggatgc 2460

cgaagctgag agcgcagacc atattgccca catgacgggt gcccacgcca aaaagcttga 2520

agccgcacag cttattaaaa ctgaaggtct gccccttacc cttaactttg ttatccatcg 2580

gcaaaattgt gaacgtgtgc ctgccatgct ggccttggct gaacagctag gggccagacg 2640

cgtagaaatt gcgcatacgc agtattatgg ctgggggctg ctcaaccgta atgcattgtt 2700

gcccagccgc actcaggtag aagagacaga aaaggtggtt gcagaagcac gcgtacgcct 2760

ttctggccgc atgagcatag attttgtaac accagattat tatgctgaca ggcccaaacc 2820

ctgcatgggc ggatggggcc agcgctttct aaacgtttct cccgcaggca aggtgctgcc 2880

atgccacgcg gcagaaagta ttccgggcgt tcagatacct tctgttgcgg aagaatctct 2940

cgctaacatt tgggaaaatg caccgctatt ccgcttgttc cgcggcacag actggatgcc 3000

cgaaccatgt cagtcttgcg cattcaagga agatgattgg ggcggatgcc gctgccaagc 3060

tttggcactg gcaggagatg ctacggcaac tgaccccgta tgccaccgtg ccccggagca 3120

tgatcttatt acccaagcca taaccgaacg gccagaaacc ccgccacctt tccattacag 3180

gcgctatggc aacgccaaag tgtaa 3205

<210>14

<211>23

<212>DNA

<213> Artificial sequence

<400>14

cgcagttctg aaagggtgat cag 23

<210>15

<211>23

<212>DNA

<213> Artificial sequence

<400>15

aatcttgctc cttatagctt ggc 23

<210>16

<211>30

<212>DNA

<213> Artificial sequence

<400>16

ctccccaata cgcccgatca tgcaggtgcc 30

<210>17

<211>27

<212>DNA

<213> Artificial sequence

<400>17

gggcccggca cgcggcaccc ttgtgat 27

<210>18

<211>22

<212>DNA

<213> Artificial sequence

<400>18

caccatgcag gatcggcttt cc 22

<210>19

<211>30

<212>DNA

<213> Artificial sequence

<400>19

tttttactcc atgccccaaa aactattcgg 30

<210>20

<211>20

<212>DNA

<213> Artificial sequence

<400>20

ggcgcttgat gttaaggctg 20

<210>21

<211>25

<212>DNA

<213> Artificial sequence

<400>21

tgaatttctc ctgtgaagat cgttc 25

<210>22

<211>27

<212>DNA

<213> Artificial sequence

<400>22

aaattggctg tttatgcaga aaacccc 27

<210>23

<211>25

<212>DNA

<213> Artificial sequence

<400>23

gtgtcggatc ctgagaattg gttcc 25

<210>24

<211>20

<212>DNA

<213> Artificial sequence

<400>24

tgccaaggct tcctgatcag 20

<210>25

<211>24

<212>DNA

<213> Artificial sequence

<400>25

tatatattcc ctttcagcga cccc 24

<210>26

<211>23

<212>DNA

<213> Artificial sequence

<400>26

gctttttctt ccatttggcc atg 23

<210>27

<211>23

<212>DNA

<213> Artificial sequence

<400>27

gtaatcgtca tcaaatccgc cgc 23

<210>28

<211>20

<212>DNA

<213> Artificial sequence

<400>28

ctggggccaa agcgcgaatc 20

<210>29

<211>30

<212>DNA

<213> Artificial sequence

<400>29

tttaatactc cgtaattcta aaggcggggc 30

<210>30

<211>19

<212>DNA

<213> Artificial sequence

<400>30

gggtgcgata ttgtcaccg 19

<210>31

<211>24

<212>DNA

<213> Artificial sequence

<400>31

taatctgatc ccaacctgtt tctc 24

<210>32

<211>18

<212>DNA

<213> Artificial sequence

<400>32

ggggaactgc cccacgtg 18

<210>33

<211>27

<212>DNA

<213> Artificial sequence

<400>33

ccttttcaaa tcactctatc agcctgc 27

<210>34

<211>59

<212>DNA

<213> Artificial sequence

<400>34

cgcttacaat ttccattcgc cattcaggag ctcatccacc acagcctgcg tgcaccaga 59

<210>35

<211>58

<212>DNA

<213> Artificial sequence

<400>35

gtgaaaagtt cttctccctt acccatgtcg acgcgttcat gtcctcgact attatata 58

<210>36

<211>18

<212>DNA

<213> Artificial sequence

<400>36

aagagcgcca tgcctgag 18

<210>37

<211>21

<212>DNA

<213> Artificial sequence

<400>37

cgattctgtt gacgagggtg t 21

<210>38

<211>17

<212>DNA

<213> Artificial sequence

<400>38

cctacgggag gcagcag 17

<210>39

<211>17

<212>DNA

<213> Artificial sequence

<400>39

attaccgcgg ctgctgg 17

<210>40

<211>18

<212>DNA

<213> Artificial sequence

<400>40

aagagcgcca tgcctgag 18

<210>41

<211>21

<212>DNA

<213> Artificial sequence

<400>41

cgattctgtt gacgagggtg t 21

<210>42

<211>26

<212>DNA

<213> Artificial sequence

<400>42

atggcttgga ctgcaccaaa agtaac 26

<210>43

<211>29

<212>DNA

<213> Artificial sequence

<400>43

cgatcgttac actttggcgt tgccatagc 29

Claims (10)

1. The promoter is characterized in that the nucleotide sequence is shown as SEQ ID NO.7 or SEQ ID NO. 9.

2. An expression vector carrying the promoter of claim 1.

3. A microbial cell comprising the promoter according to claim 1 or the expression vector according to claim 2.

4. The microbial cell of claim 3, wherein said microbial cell is Acetobacter pasteurianus.

5. A method for increasing the expression level of a gene, which comprises inducing the expression of the gene using the promoter according to claim 1.

6. The method according to claim 5, wherein the gene is egfp and the nucleotide sequence is shown in SEQ ID No. 12.

7. The method according to claim 5, wherein the gene is pqqabccde and the nucleotide sequence is shown as seq id No. 13.

8. A method for increasing the yield of PQQ or acetic acid produced by a microorganism, comprising ligating the pqqABCDE gene to the expression vector of claim 2 to construct a recombinant vector; transferring the recombinant vector into microbial cells to obtain recombinant bacteria.

9. A method for producing PQQ or acetic acid, which comprises ligating pqqABCDE gene to the expression vector of claim 2 to construct a recombinant vector; transferring the recombinant vector into microbial cells to obtain recombinant bacteria; PQQ or acetic acid is produced by using the recombinant bacterium.

10. Use of the promoter according to claim 1, or the expression vector according to claim 2, or the microbial cell according to claim 3 or 4, or the method according to claim 5 or 7, or the method according to claim 8 or 9 for the production of acetic acid in the fields of chemical engineering, food, and medical treatment.

Images