CN111471702B - Slow-growing rhizobium stable red fluorescent labeling vector and application thereof - Google Patents

Abstract

The invention provides a stable red fluorescent marking carrier of slow rhizobium and application thereof. The fluorescence labeling of rhizobia depends on a vector which is stably present in bacterial cells and efficiently expresses a fluorescent protein. However, the existing rhizobium marking method has the defects of weak fluorescence signal, loss of expression plasmid and the like. Based on the existing defects of the fluorescence labeling of rhizobia. The present application constructs a bacterium having a slow-growing type rhizomaBradyrhizobium elkaniiThe rhizobium red fluorescence expression vector stably exists in the rhizobium, and has a strong fluorescence signal. Can provide an effective method and a tool for visualizing the interaction between the rhizobia and the leguminous plants and deeply researching the interaction between the leguminous plants and the rhizobia.

Description

Slow-growing rhizobium stable red fluorescent labeling vector and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a slow-growing rhizobium stable red fluorescent labeling vector and application thereof.

Background

The interaction of plants and beneficial microorganisms is researched, and the beneficial microorganisms are utilized, so that the method has an important effect on agricultural sustainable development. Symbiosis of legumes and rhizobia for biological nitrogen fixation is a classic example of plant and beneficial microbial work, and the use of rhizobia interaction with legumes is an important way to increase soybean yield with less nitrogen fertilizer application. However, to facilitate visualization of the interaction of rhizobia with legumes requires stable fluorescent labeling of rhizobia. However, the stable fluorescent labeling of the bacteria depends on the application of a vector which can stably exist in the bacteria and can efficiently express the fluorescent protein, and although some reported vectors are suitable for labeling bradyrhizobium, the soybean has the defects of easy plasmid loss, fluorescence intensity and the like. Therefore, the construction and the reconstruction of the vector which stably exists in the slow rhizobium and efficiently expresses the fluorescent proteins with various colors are the basis for visually researching the interaction of the soybean plant and the rhizobium.

Disclosure of Invention

The invention aims to provide a stable red fluorescent marking carrier of bradyrhizobium and application thereof.

In order to realize the purpose, the following technical scheme is adopted:

the slow rhizobium stable red fluorescent marker vector is Kanna resistance, and the Tdtomato red fluorescent protein with the fluorescence intensity about 6 times that of the common GFP fluorescent protein is selected as the fluorescent protein of the vector. The promoter of the fluorescent protein is NPTII promoter (the promoter sequence is shown in figure 2), and a ribosome binding site sequence GGAGGAAGAAAAA (RBS site) is added between the promoter and the fluorescent protein to improve the translation efficiency of the protein and enhance the intensity of the final fluorescent protein. The specific modification method of the carrier is to utilizeSphI andEcoRi pRBC vector is cut (pRBC is added on the basis of the original vector pMG103 through modification of the multiple cloning site of pMG103SphI (GCATGC) andEcoRi (GAATTC) enzyme cutting site, adding SpeI (ACTAGT) enzyme cutting site, inserting the gene expression frame of the fluorescent protein Tdtomato connected with the kalina promoter NPTIIpro intoSphI (GCATGC) andEcoRi (GAATTC) between two enzyme cutting sites, and a ribosome binding site sequence GGAGGAAGAAAAA (RBS site: shown in bold italics; NPTII promoter is shown in bold italics) is added between the promoter and the fluorescent protein, the size of the vector is 7427bp, and the sequence is shown in SEQ ID NO. 1. The map of the entire vector constructed successfully is shown in FIG. 1.

The invention has the advantages that:

first, the vector used has: the two vector replication initiation sites pHSG298 ori and pMG101 ori not only ensure the copy number of the plasmid in the strain, reduce the plasmid loss caused by bacterial division as much as possible, but also increase the copy number of the fluorescent protein gene Tdtomato in the bacteria, and are beneficial to the increase of the fluorescence intensity. Secondly, the fluorescent protein used by the carrier is Tdmomato, the fluorescence intensity of the fluorescent protein is about 6 times of that of the common GFP protein, and the fluorescent signal of the bacteria can be enhanced to the maximum extent. Thirdly, the promoter used is the promoter NPTII promoter of the bacteria Carna resistance gene, and the NPTII promoter is a strong promoter in the bacteria and can continuously activate the transcription of downstream genes. Fourthly, a ribosome binding sequence is integrated between the NPTII promoter and the downstream gene of the vector, messenger RNA can be promoted to be bound to the ribosome, translation of downstream fluorescent protein is obviously improved, and the quantity of the fluorescent protein of bacteria is increased. Therefore, the method has important significance for ensuring the normal growth of the soybeans under the condition of moderate low phosphorus in the field and improving the tolerance of the soybeans to the moderate low phosphorus.

Drawings

FIG. 1 is a schematic diagram of a red fluorescence-stable expression vector pRBC-NPTIIpro-Tdtomato of Rhizobium bradyrhizobium.

FIG. 2 labeling of bradyrhizobium with pRBC-NPTIipro-Tdtomato vectorBradyrhizobium elkaniiThe fluorescence analysis of (3).

FIG. 3. colonization of soybean roots with labeled bradyrhizobia.

FIG. 4 shows the results of fluorescence observation of fluorescently labeled bradyrhizobia within nodules.

Detailed Description

Example 1 construction of vectors

The original vector was first used, the NPTII promoter from pET-28a was amplified using the primers NPTIipro-F: CAGTGCCAAGCTTGCATGCCACGCTGCCGCAAGCA and NPTIipro-R: CCATGATTA CGAATTCACTAGTATCCTGTCTCTTGATC, and the PCR product was fused by one-step cloningSphI andSpeIan endonuclease cut pRBC vector (pRBC is added on the basis of an original vector pMG103 by modifying a multiple cloning site of the pMG103SphI andEcoRi cleavage site added with SpeI endonuclease cleavage site) to obtain intermediate vector pRBC-NPTIipro. Meanwhile, a fluorescent protein gene Tdtomato is cloned from the carrier pCMV-Tdtomato by using a primer Tdtomato-F: GATCAAGAGACAGGATACTAGTGGAGGAAGAAAAAATGGTGAGCAAGGGCG and a primer Tdtomato-F: AGCTATGACCATGATTACGAATTCTT ACTTGTACAGCTCGTC, and a segment of ribosome binding site GGAGGAAGAAAAA is added in front of the Tdtomato gene. Simultaneously, Tdtomato is connected to the Tdtomato through a one-step cloning modeSpeI andEcoRand (3) obtaining a final vector pRBC-NPTIIpro-Tdtomato on a pRBC-NPTIIpro vector cut by the endonuclease I, transferring the constructed vector into Escherichia coli DH5 alpha by an Escherichia coli heat shock transformation method (42 ℃ for 90 seconds and 3 minutes on ice), and carrying out sequencing identification on the vector, wherein the sequence of the vector is shown as SEQ ID NO. 1.

Example 2 labeling of bradyrhizobium with pRBC-NPTIIpro-Tdtomato vectorBradyrhizobium elkanii

1) Coli DH 5. alpha. carrying pRBC-NPTIIpro-Tdtomato vector was scale-up cultured on a medium containing kanamycin antibiotic (100 mg/L), DNA of the plasmid vector pRBC-NPTIIpro-Tdtomato was extracted using a plasmid extraction kit, and the DNA concentration was detected at about 300-500 ng.

2) Preparing slow-growing rhizomatous competence: YMA solid medium plate activated bradyrhizobiumBradyrhizobium elkanii Culturing at 30 deg.C for 18-36 hr. A single colony was picked on the plate and transferred to a tube containing 2 mL of YMA-containing liquid medium. Shaking culture (180 rmp) was carried out at 30 ℃ for 12 hours. Diluting the bacterial liquid cultured in the last step into 100 mL of liquid YMA culture medium (triangular flask) in a volume ratio of 1:100 under aseptic conditions, culturing at 30 ℃ for about 6-12 hours (200 rpm) with vigorous shaking until the OD value is 0.5-0.6 (OD 600), transferring the bacterial liquid into a sterile 50 mL EP tube under aseptic conditions, standing on ice for 20 minutes, and cooling the culture to 0 ℃; after centrifugation at 7000 rpm at 4 ℃ for 8 minutes, the upper medium was decanted to recover the cells (leaving the medium as little as possible); after the cells at the bottom of the tube after recovery are resuspended by 10 mL of deionized water precooled by ice, the cells are centrifuged at 6000rpm at 4 ℃ for 10 minutes to collect thalli; repeating the above step for 2-3 times (to make the ions in the cells residualLeave as little as possible); resuspend with 2 mL of pre-cooled 10% glycerol (2 mL glycerol per 50 mL of initial culture); finally, the mixture is subpackaged into 1.5 mL centrifuge tubes (50 mu L of each tube), and the mixture is frozen by liquid nitrogen and then stored in a refrigerator at minus 80 ℃ for later use.

3) And (3) during electric shock transformation, dissolving the competent cells on ice, adding 3-5 mu L of plasmid and plasmid DNA with the concentration of about 300 ng, placing for 3 minutes, transferring into an electric shock transformation cup precooled at the temperature of-20 ℃, and transferring the bacterial liquid in the electric shock transformation cup into a 2.0 mL sterile centrifuge tube after electric shock. An additional 800. mu.L of M408 liquid medium was added. After culturing at 30 ℃ for 45 minutes, spreading the culture solution on a plate containing the corresponding antibiotic, culturing at 30 ℃ for 36 hours, observing the growth condition of colonies, and then placing the plate on a body type fluorescence microscope to select positive clones according to fluorescence brightness. As a result, as shown in FIG. 2, the plate of the colonies of Rhizobium emits significant red fluorescence at the excitation wavelength of red fluorescence, while the white light-emitting bacterium of the slow rhizobium having pRBC-NPTIipro-Tdtomato vector showed a macroscopic red color, indicating that the pRBC-NPTIipro-Tdtomato vector can emit visible red fluorescence in the slow rhizobiumBradyrhizobium elkaniiA large amount of red fluorescent protein was produced.

Example 3 Slow Rhizobium Using fluorescent labelingBradyrhizobium elkaniiObserve the colonization of the soybean root system

Colonization of fluorescence-labeled bradyrhizobium on soybean root system: culturing of fluorescently labeled bradyrhizobiaBradyrhizobium elkaniiCentrifuging at 6000rpm until OD600 = 1.0 for 10 min, collecting thallus, re-suspending the thallus with sterile water until the thallus OD600 = 0.3, soaking soybean roots of 5-day-old seedlings in the thallus re-suspending liquid for 2 hours. And continuously culturing for 7-10 days with sand under low nitrogen, digging out the soybean root system, removing the sand, and observing the colonization of rhizobia on the soybean root system under a laser confocal microscope. The result is shown in figure 3, obvious red fluorescence emitted by rhizobia can be seen on the root hair and the root surface of the root system of soybean, and the result indicates that the bradyrhizobia marked by the pRBC-NPTIipro-Tdtomato vector can be directly used for observing the colonization research of the rhizobia on the plant root system。

Example 4 study of interaction of fluorescent-labeled bradyrhizobia with soybean

Culturing fluorescently-labeled bradyrhizobiumBradyrhizobium elkaniiCentrifuging at 6000rpm until OD600 = 1.0, collecting thallus, re-suspending thallus with sterile water until thallus OD600 = 0.3, soaking soybean root system of 5 days old in thallus re-suspending liquid, and standing for 2 hr. The culture was continued for 30 days under low nitrogen. And collecting mature nodules, slicing the nodules, and observing the rhizobia with the fluorescence marks in the nodules by using a laser confocal microscope. The result is shown in FIG. 4, after soybean infection by rhizobium marked by red fluorescence and propagation for multiple generations, obvious red fluorescence can be observed in the formed soybean rhizobium through a fluorescence microscope, and the result shows that pRBC-NPTIIpro-Tdtomato vector can stably exist in bradyrhizobium and has strong red fluorescence after passage for multiple generations. The pRBC-NPTIipro-Tdtomato vector can be used for researching the interaction between the bradyrhizobium and the leguminous plants.

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Fujian university of agriculture and forestry

<120> slow-growing rhizobium stable red fluorescent labeling vector and application thereof

<130> 5

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 7427

<212> DNA

<213> Artificial sequence

<400> 1

gaggtctgcc tcgtgaagaa ggtgttgctc gagcgggtca tgaacaccct gccagatcga 60

gaatcccgaa cttggcgcgc ggtattcttc aaggccctgc ctgaggtgat ggaggatttt 120

gggggcgact ggctacaagc aactggcgaa cggcgaaatc cgttcgagcg ggtggaacag 180

acgaagccaa taggaaggcc ataggcgcgt ttttatagac ttgaagcccg gaagtccgtc 240

cacacccaaa aaatcgctgt gcgaggcgct gtggctgtcc tgtgttgcct tcgatgaaag 300

gcgaaacttg ccctcatcat ggcagtcccc cctagtctgg tccttaaagc ggtcaagggc 360

gatgccggag ggagcccttg agggcttgtg gggactaggc ttctttccct ttttcaatcg 420

tctttttgaa gactgcttgt tctgaagatt ctgaaaagtg ttaggaagaa gtgttctgca 480

atgttctgta gtgttctgtt ctatatagcg ccaccaagtc tgcggtagag cgctaccaag 540

tctgcggaaa gccgccacca agtctgcggt agaagaagcg aaaacgccac caagtctgcg 600

gtagagtgcc accaagtctg cggtggcggc ggaataagcc cttgaaatta ttgagtcccg 660

ggaacagtaa ggcgccacca agtctgcgga gctaagtggt tgcgtttgcg gctacttttt 720

gcgcacacgg atcgcaggta atgccagcac ggcggggtcg gctggttcga tggaaatgcc 780

gtattgcgtg agcttgagag gcagctttgg cagcacttcc ttgatgtgtg tcagctcctc 840

gatcagctgc gcccggaacg cgcgaggccg agtgaaacct tggccaaatt gttcgctgag 900

agccttccaa ctcatggtca ccgggtggcg aatattgtga aggcgatagc ctagccagaa 960

atacaaatcg agcttgcgag ctgagcctgc gaaggctcga accgcattag cattcaaggg 1020

gagcgcacgc tgctgtaggc tctcaaagaa taccgggttg aacgtgacgg tactgggcca 1080

aagcgagcgt tggtcaagat gcggcggtag ccacacctca acctcatcga acggattgac 1140

ggttttggtt tttgccctca ccccgtccca cacactcacc cgcattgtgc aagccgccag 1200

tgcgttaatt tgttctttga aggcggtgag cgggcctttg cgtcccccgc tgtccgaaaa 1260

tcccatctcg cgcacaaagg cagtaaagct ctcggcgatt tcgatagtag gtgttttctg 1320

ccggatggct tccgaacaaa ggtgcatcat caccagtcgg gcttttggcc cgaaaggcag 1380

cggttgaagg attttcttgc cttctccgtc tcgcaggaat ccggcggaca aatccagcgc 1440

catattgccc tgcttccgtt cgaactcgcg cacttcgaga ggttgacggt cgtaaggcat 1500

accgcaaacg gcaagcacgc tgtgcaaatg ccgaacgtcg gcgggcgatg gcggtgagtt 1560

ttcgataact tcgcggatga tggaacggcg gcggcgctcg cgtggcattg cgtcaagctc 1620

agccttgcgc ttttcagcgg cggcctgttc ctcgtctcgc ttttgctggc gggtgatgag 1680

cacgctgact tgggcatcaa acgcaaactt accccgcgct ttttcaagct cggcgcgcaa 1740

atcttcatcc cggatcagcg attcgtcata cttgcccata ggcacagagt agctgatttg 1800

ctgcggtctc cctaggcgcc tgcctgccta tagggcaatt acgtacagca ttatagcgtt 1860

gtggcgttgt aacgctatag cattgcaatg ctaggacttg cgcttggccg tctcggagtg 1920

gccgcgccta gcaatcacag catcgactcc ctcgacgatg aggtcatgca cctttttgcg 1980

ctcgacaaag gcgatctctc gcagccgatc atgagccgct tggccaaata gatactggag 2040

cgcactacag gagaggcttc agatggggga ggagcggctt ttggcgcgcg catcttcacc 2100

accctggatt tcgacggagc cggagcgtca ggctccacct cgggggtgat ttctagccct 2160

tcgatgatag gggggcgctt tttcggcggg ctcatgcgac ggctttcgtt ttgagtttgt 2220

gctggatgga tctccagagt ccgcgggcct cctcggccgc cttgccgctg ggagcgtact 2280

cggtgacccc ctgccctgcc gcgatggcat cctgaaagtc agccctagaa accatcaatg 2340

gctctgcaag tgatcccagg gctgacaatc ccacggcggc ctcgctggcg cgcccgctgc 2400

gggtgatcgg ggggcactgg ttgagaacaa acaggaatgg ccgctgcagc ttgagaagcg 2460

cttggatggt cggccgggtt gcctgaatgt ctaggcgcgt cggcctagca ggcactaggg 2520

agaggtcggc tgcctgcatg gcgagagagg tggcggtgct ggcgacaccc gggcaatcga 2580

ggatggcgag ggtgtacccc ttccctgcca gcgccttcag gatttgaggg agctggggca 2640

ccttgtcagg cggaagggca tcaacggcgg gcttctcccg ctgggcctga gcccgttgat 2700

ctccccaagc tgcaagcgaa ccttgcgggt caaggtcgag ggcaatcacg gattcccctg 2760

cctctgtggc cgcgacggca atggcagcag cgagggtagt ttttcccgcg ccgcccttct 2820

gcgtgaccag agcaattgtc ttcatgcctg cactatagca ttaaggcact aaagcgtcaa 2880

agcgccatag cggcatagcg gcatagcggc atagcgctaa aatgctatag cattattaaa 2940

tacagcgcta cagcgctata atgctgcaac ggttaggacc gcaatttgcg ccccgggccg 3000

gttgcgctat cgaccagctc aattaactgc tcgggctcgg acgcgaacca cgcgaagctg 3060

ccccaagcca aggagtcgag ggagccacgg ttgatgagag ctttgttgta ggtggaccag 3120

ttggtgattt tgaacttttg ctttgccacg gaacggtctg cgttgtcggg aagatgcgtg 3180

atctgatcct tcaactcagc aaaagttcga tttattcaac aaagccacgt tgtgtctcaa 3240

aatctctgat gttacattgc acaagataaa aatatatcat catgaacaat aaaactgtct 3300

gcttacataa acagtaatac aaggggtgtt atgagccata ttcaacggga aacgtcttgc 3360

tcgaagccgc gattaaattc caacatggat gctgatttat atgggtataa atgggctcgc 3420

gataatgtcg ggcaatcagg tgcgacaatc tatcgattgt atgggaagcc cgatgcgcca 3480

gagttgtttc tgaaacatgg caaaggtagc gttgccaatg atgttacaga tgagatggtc 3540

agactaaact ggctgacgga atttatgcct cttccgacca tcaagcattt tatccgtact 3600

cctgatgatg catggttact caccactgcg atccccggga aaacagcatt ccaggtatta 3660

gaagaatatc ctgattcagg tgaaaatatt gttgatgcgc tggcagtgtt cctgcgccgg 3720

ttgcattcga ttcctgtttg taattgtcct tttaacagcg atcgcgtatt tcgtctcgct 3780

caggcgcaat cacgaatgaa taacggtttg gttgatgcga gtgattttga tgacgagcgt 3840

aatggctggc ctgttgaaca agtctggaaa gaaatgcata agcttttgcc attctcaccg 3900

gattcagtcg tcactcatgg tgatttctca cttgataacc ttatttttga cgaggggaaa 3960

ttaataggtt gtattgatgt tggacgagtc ggaatcgcag accgatacca ggatcttgcc 4020

atcctatgga actgcctcgg tgagttttct ccttcattac agaaacggct ttttcaaaaa 4080

tatggtattg ataatcctga tatgaataaa ttgcagtttc atttgatgct cgatgagttt 4140

ttctaatcag aattggttaa ttggttgtaa cactggcaga gcattacgct gacttgacgg 4200

gacggcggct ttgttgaata aatcgcattc gccattcagg ctgcgcaact gttgggaagg 4260

gcgatcggtg cgggcctctt cgctattacg ccagctggcg aaagggggat gtgctgcaag 4320

gcgattaagt tgggtaacgc cagggttttc ccagtcacga cgttgtaaaa cgacggccag 4380

tgccaagctt gcatgccacg ctgccgcaag cactcagggc gcaagggctg ctaaaggaag 4440

cggaacacgt agaaagccag tccgcagaaa cggtgctgac cccggatgaa tgtcagctac 4500

tgggctatct ggacaaggga aaacgcaagc gcaaagagaa agcaggtagc ttgcagtggg 4560

cttacatggc gatagctaga ctgggcggtt ttatggacag caagcgaacc ggaattgcca 4620

gctggggcgc cctctggtaa ggttgggaag ccctgcaaag taaactggat ggctttcttg 4680

ccgccaagga tctgatggcg caggggatca agatctgatc aagagacagg atactagtgg 4740

aggaagaaaa aatggtgagc aagggcgagg aggtcatcaa agagttcatg cgcttcaagg 4800

tgcgcatgga gggctccatg aacggccacg agttcgagat cgagggcgag ggcgagggcc 4860

gcccctacga gggcacccag accgccaagc tgaaggtgac caagggcggc cccctgccct 4920

tcgcctggga catcctgtcc ccccagttca tgtacggctc caaggcgtac gtgaagcacc 4980

ccgccgacat ccccgattac aagaagctgt ccttccccga gggcttcaag tgggagcgcg 5040

tgatgaactt cgaggacggc ggtctggtga ccgtgaccca ggactcctcc ctgcaggacg 5100

gcacgctgat ctacaaggtg aagatgcgcg gcaccaactt cccccccgac ggccccgtaa 5160

tgcagaagaa gaccatgggc tgggaggcct ccaccgagcg cctgtacccc cgcgacggcg 5220

tgctgaaggg cgagatccac caggccctga agctgaagga cggcggccac tacctggtgg 5280

agttcaagac catctacatg gccaagaagc ccgtgcaact gcccggctac tactacgtgg 5340

acaccaagct ggacatcacc tcccacaacg aggactacac catcgtggaa cagtacgagc 5400

gctccgaggg ccgccaccac ctgttcctgg ggcatggcac cggcagcacc ggcagcggca 5460

gctccggcac cgcctcctcc gaggacaaca acatggccgt catcaaagag ttcatgcgct 5520

tcaaggtgcg catggagggc tccatgaacg gccacgagtt cgagatcgag ggcgagggcg 5580

agggccgccc ctacgagggc acccagaccg ccaagctgaa ggtgaccaag ggcggccccc 5640

tgcccttcgc ctgggacatc ctgtcccccc agttcatgta cggctccaag gcgtacgtga 5700

agcaccccgc cgacatcccc gattacaaga agctgtcctt ccccgagggc ttcaagtggg 5760

agcgcgtgat gaacttcgag gacggcggtc tggtgaccgt gacccaggac tcctccctgc 5820

aggacggcac gctgatctac aaggtgaaga tgcgcggcac caacttcccc cccgacggcc 5880

ccgtaatgca gaagaagacc atgggctggg aggcctccac cgagcgcctg tacccccgcg 5940

acggcgtgct gaagggcgag atccaccagg ccctgaagct gaaggacggc ggccgctacc 6000

tggtggagtt caagaccatc tacatggcca agaagcccgt gcaactgccc ggctactact 6060

acgtggacac caagctggac atcacctccc acaacgagga ctacaccatc gtggaacagt 6120

acgagcgctc cgagggccgc caccacctgt tcctgtacgg catggacgag ctgtacaagt 6180

aagaattcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt 6240

ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc 6300

taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc 6360

cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tggcgaactt 6420

ttgctgagtt gaaggatcag atcacgcatc ttcccgacaa cgcagaccgt tccgtggcaa 6480

agcaaaagtt caaaatcagt aaccgtcagt gccgataagt tcaaagttaa acctggtgtt 6540

gataccaaca ttgaaacgct gatcgaaaac gcgctgaaaa acgctgctga atgtgcgagc 6600

ttcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt 6660

atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa 6720

gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc 6780

gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag 6840

gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt 6900

gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg 6960

aagcgtggcg ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg 7020

ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg 7080

taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac 7140

tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg 7200

gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt 7260

taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg 7320

tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc 7380

tttgatcttt tctacggggt ctgacgctca gtggaacgat ccgtcga 7427

<210> 2

<211> 35

<212> DNA

<213> Artificial sequence

<400> 2

cagtgccaag cttgcatgcc acgctgccgc aagca 35

<210> 3

<211> 38

<212> DNA

<213> Artificial sequence

<400> 3

ccatgattac gaattcacta gtatcctgtc tcttgatc 38

<210> 4

<211> 51

<212> DNA

<213> Artificial sequence

<400> 4

gatcaagaga caggatacta gtggaggaag aaaaaatggt gagcaagggc g 51

<210> 5

<211> 42

<212> DNA

<213> Artificial sequence

<400> 5

agctatgacc atgattacga attcttactt gtacagctcg tc 42

Claims (2)

1. A slow rhizobium stable red fluorescent labeling vector is characterized in that the sequence of the vector is shown in SEQ ID NO. 1.

2. The use of the bradyrhizobium stable red fluorescent marker vector of claim 1 to study bradyrhizobium interaction with soybean.

Images