CN106755059B - Backbone plasmid vector for genetic engineering and application - Google Patents

Abstract

The invention discloses a backbone plasmid vector for genetic engineering, which comprises a crRNA expression frame and a Cpf1 nuclease expression frame, wherein the crRNA expression frame and the Cpf1 nuclease expression frame are positioned in the same binary vector, and the crRNA expression frame is sequentially composed of a rice U3 promoter, a spectinomycin resistance gene and a Poly-T terminator; the LbCpf1 nuclease expression frame consists of a ZmUBI promoter, an LbCpf1 coding sequence modified by rice preferred codons and a 35s terminator in sequence. The invention also provides a recombinant vector containing a target sequence constructed by using the plasmid vector and application thereof in rice gene targeting. The backbone plasmid vector can be used for effectively targeting genes of target fragments to obtain rice plants with random insertion and/or random deletion on the target fragments in the target genes.

Description

Backbone plasmid vector for genetic engineering and application

Technical Field

The invention belongs to the field of plant gene engineering, and particularly relates to a gene engineering vector for plant gene targeting and application of the gene engineering vector in rice gene modification.

Background

Rice is one of the most important crops in the world. The yield and quality of rice are closely related to national economy and life, and the continuous cultivation of varieties with more excellent agronomic characters is crucial to rice production. Compared with the traditional breeding method, with the continuous development of biotechnology, the gene targeting technology which is gradually matured in recent years provides a convenient and efficient means for the optimization of key characters such as rice yield, quality and the like. The traditional gene targeting method comprises a homologous recombination technology, a zinc finger nuclease technology (ZFN), a transcription factor activator Technology (TALEN) and a CRISPR/Cas9 technology, wherein the homologous recombination technology has extremely low targeting efficiency in plants, and both the ZFN and TALEN technologies have the technical problems of complex construction of genetic engineering vectors, long period, high cost, unsuitability for transient transformation and the like, so that the practicability of the gene targeting technology in the rice breeding improvement process is greatly limited. The CRISPR/Cas9 technology has certain limitation on target site selection, and the deletion or insertion of a single base is easy to form in repair after the cleavage, so that the acquisition of the mutant is influenced to a certain extent.

The CRISPR/Cpf1 technology developed in the last 2 years provides a new means for gene targeting. The CRSIPR/Cpf1 system is an innate immune system that is present in bacteria. Cpf1 is capable of processing crRNA precursors alone and then using the mature crRNA to specifically recognize and cleave DNA. By using the principle, in eukaryotic cells, through artificial synthesis of crRNA with a target site combined with Cpf1 and specifically recognized, Cpf1 can be guided to cut a target site sequence in a genome, and random base insertion or deletion can occur in the cut site after a cell initiates a DNA repair mechanism, so that site-specific gene targeting is realized. At present, CRISPR/Cpf1 targeted gene targeting of the genome has been successfully achieved in rats. There have been no reports of gene targeting using the CRISPR/Cpf1 system in plants.

Disclosure of Invention

The invention provides a gene engineering backbone carrier for rice gene targeting.

In particular, in one aspect, the present invention provides a backbone plasmid vector for genetic engineering, characterized in that,

comprises a crRNA expression frame and a Cpf1 nuclease expression frame, wherein the nucleotide sequence of the crRNA expression frame is shown as the 107 th to 1716 th positions of Seq ID No.1, and the nucleotide sequence of the Cpf1 nuclease expression frame is shown as the 1746 th to 7878 th positions of Seq ID No. 1.

Preferably, in the backbone plasmid vector, a, the crRNA expression cassette comprises: the nucleotide sequence of the rice U3 promoter is shown as 107 th to 487 th sites of Seq ID No. 1; a spectinomycin resistance gene (SpR) whose nucleotide sequence is shown in SeqID No.1 at positions 495 to 1701; and a Poly-T terminator, the nucleotide sequence of which is shown in position 1709 to 1716 of Seq ID No.1,

b. the Cpf1 nuclease expression cassette comprises: the maize ZmUBI promoter, the nucleotide sequence of which is shown in Seq ID No.1, positions 1746-3777; the rice codon-preferred modified Cpf1 coding sequence has the nucleotide sequence as shown in Seq ID No.1 at positions 3786 to 7607 and the nucleotide sequence as shown in Seq ID No.1 at positions 7614 to 7878.

Preferably, the backbone plasmid vector further comprises: c. left and right border sequences of T-DNA, wherein the nucleotide sequence of the left border sequence is shown as position 10127 to 10150 of Seq ID No.1, the nucleotide sequence of the right border sequence is shown as position 1 to 25 of Seq ID No.1, and the crRNA expression cassette and the Cpf1 expression cassette are located between the left border sequence and the right border sequence.

In another aspect, the present invention provides a backbone plasmid vector for genetic engineering, wherein the nucleotide sequence of the backbone plasmid vector is as set forth in Seq ID No.1, herein designated pHUN 611.

In another aspect, the present invention provides a method for constructing a recombinant vector for targeting a target gene of rice, the method comprising the steps of:

selecting a double-stranded target fragment according to the coding sequence of the target gene, wherein the target fragment is located on the target gene, and one strand of the double-stranded target fragment has the following 5' TTTN- (N)_X-3' structure, (N)_XOne nucleotide sequence { N ] of X number₁,N₂……N_x}，N₁,N₂……N_xEach represents any one of bases A, G, C, T, and N in TTTN also represents any one of bases A, G, C, T (preferably, X is 25);

integrating the target fragment into the backbone plasmid vector to form crRNA with the target fragment.

Preferably, the vector construction comprises,

synthesizing 5' -GGCA- (N) according to the sequence of the target sequence_X-3 ' characteristic forward oligonucleotide strand and having 5 ' -AAAA- (N ')_X-3' characteristic of the reverse oligonucleotide strand, wherein (N) in the forward oligonucleotide strand_XAnd in the reverse oligonucleotide (N')_XHas reverse complementary characteristics; cutting the backbone plasmid vector by BsaI endonuclease, replacing spectinomycin resistance gene with double-stranded nucleotide formed after annealing the forward oligonucleotide chain and the reverse oligonucleotide chain, and screening to form a recombinant vector for targeting the rice target gene through kanamycin forward selection and spectinomycin negative selection.

In another aspect, the present invention provides a use of the above recombinant vector in rice gene targeting, comprising the steps of,

transferring the recombinant vector into a rice cell, so that the rice cell simultaneously contains crRNA and Cpf1 nuclease aiming at a target gene; under the combined action of crRNA and Cpf1 nuclease, the double-stranded target segment of the target gene is sheared to induce the DNA repair function of the rice cell, and the random insertion and/or random deletion of the target segment in the target gene is realized.

Preferably, the transformation into rice cells refers to transient protoplast transformation or stable Agrobacterium-mediated transformation of the recombinant vector into rice cells or tissues.

Preferably, the use is for obtaining rice plants having random insertions and/or random deletions in the target fragment.

In another aspect, the present invention provides a method for obtaining a host bacterium, which comprises introducing the recombinant vector according to claim 6 into a target colony.

The backbone vector of the genetic engineering is a binary vector containing a T-DNA boundary sequence, and comprises 2 expression frames in two boundaries of the T-DNA: the Cpf1 gene expression cassette and the crRNA expression cassette, and may also include a hygromycin resistance gene expression cassette. The vector backbone sequence outside the T-DNA boundary may contain a structure such as a kanamycin resistance gene (FIG. 1).

In the present invention, BsaI endonuclease recognition sites (cleavage sites are shown at 495 th and 1701 th positions of Seq ID No. 1) are respectively present at both ends of the SpR gene in reverse arrangement for inserting the target fragment.

The invention also provides a transformant containing the recombinant vector, wherein the used host is a microorganism, specifically escherichia coli and agrobacterium.

One purpose of the invention is to use the recombinant vector to realize random insertion and/or random deletion of target segments of a target gene. Specifically, the recombinant vector is transferred into rice cells, so that the cells simultaneously contain crRNA and Cpf1 nuclease aiming at a target gene; under the combined action of crRNA and Cpf1 nuclease, the double-stranded target segment of the target gene is cut to induce the DNA repair function of rice cells, and finally the random insertion and/or random deletion of the target segment in the target gene is realized.

In the application, the crRNA is formed by connecting an RNA segment which can be complementarily combined with the target segment and a skeleton segment combined with cpf 1. The RNA segment which can be complementarily combined with the target segment in the crRNA is the RNA segment which can be complementarily combined with the 5' TTTN- (N)_X-3' middle (N)_XComplementary binding of RNA fragments.

The Cpf1 nuclease is a protein translated from an RNA fragment transcribed from the DNA represented by nucleotides 3786 to 7607 in SEQ ID No. 1.

The method for transferring the recombinant vector into the rice cells comprises the following steps: the DNA sequence of the recombinant vector is directly introduced into plant cells, such as PEG-mediated transient protoplast transformation or Agrobacterium-mediated stable callus transformation.

The regenerated plant is obtained by differentiating and regenerating transformed rice cells or tissues, such as protoplasts or callus. The application can obtain rice plants with random insertion and/or random deletion on target segments in target genes.

In order to realize the targeting of the CRISPR/Cpf1 system in a rice genome, the invention adopts a rice U3 promoter to express a combination of crRNA and a ZmUBI promoter to drive rice to prefer a Cpf1 gene modified by codon, successfully realizes the gene targeting in rice and obtains a corresponding rice mutant plant. Meanwhile, the invention presets a crRNA expression frame and a Cpf1 expression frame on the same plasmid skeleton in advance, thereby simplifying the process of constructing the recombinant targeting vector aiming at a certain gene.

In one implementation, the backbone plasmid vector of the present invention has the following nucleotide sequence (same as seq id No.1 in the sequence listing):

gtttacccgccaatatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatccaagctcaagctaagctcacgtgacggaattaagcttaagggatctttaaacatacgaacagatcacttaaagttcttctgaagcaacttaaagttatcaggcatgcatggatcttggaggaatcagatgtgcagtcagggaccatagcacaagacaggcgtcttctactggtgctaccagcaaatgctggaagccgggaacactgggtacgttggaaaccacgtgatgtgaagaagtaagataaactgtaggagaaaagcatttcgtagtgggccatgaagcctttcaggacatgtattgcagtatgggccggcccattacgcaattggacgacaacaaagactagtattagtaccacctcggctatccacatagatcaaagctgatttaaaagagttgtgcagatgatccgtggcaagagaccaacccagtggacataagcctgttcggttcgtaagctgtaatgcaagtagcgtatgcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggcttgttatgactgtttttttggggtacagtctatgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaaacatcatgggggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataatgtctagctagaaattcgttcaagccgacgccgcttcgcggcgcggcttaactcaagcgttagatgcactaagcacataattgctcacagccaaactatcaggtcaagtctgcttttattatttttaagcgtgcataataagccggtctcattttttttagtagtagcatctgacggtggggaagcttgatatcgaattcctgcagtgcagcgtgacccggtcgtgcccctctctagagataatgagcattgcatgtctaagttataaaaaattaccacatattttttttgtcacacttgtttgaagtgcagtttatctatctttatacatatatttaaactttactctacgaataatataatctatagtactacaataatatcagtgttttagagaatcatataaatgaacagttagacatggtctaaaggacaattgagtattttgacaacaggactctacagttttatctttttagtgtgcatgtgttctcctttttttttgcaaatagcttcacctatataatacttcatccattttattagtacatccatttagggtttagggttaatggtttttatagactaatttttttagtacatctattttattctattttagcctctaaattaagaaaactaaaactctattttagtttttttatttaataatttagatataaaatagaataaaataaagtgactaaaaattaaacaaataccctttaagaaattaaaaaaactaaggaaacatttttcttgtttcgagtagataatgccagcctgttaaacgccgtcgacgagtctaacggacaccaaccagcgaaccagcagcgtcgcgtcgggccaagcgaagcagacggcacggcatctctgtcgctgcctctggacccctctcgagagttccgctccaccgttggacttgctccgctgtcggcatccagaaatgcgtggcggagcggcagacgtgagccggcacggcaggcggcctcctcctcctctcacggcacggcagctacgggggattcctttcccaccgctccttcgctttcccttcctcgcccgccgtaataaatagacaccccctccacaccctctttccccaacctcgtgttgttcggagcgcacacacacacaaccagatctcccccaaatccacccgtcggcacctccgcttcaaggtacgccgctcgtcctccccccccccccctctctaccttctctagatcggcgttccggtccatggttagggcccggtagttctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacctgtacgtcagacacgttctgattgctaacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgcagacgggatcgatttcatgattttttttgtttcgttgcatagggtttggtttgcccttttcctttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttctagatcggagtagaattctgtttcaaactacctggtggatttattaattttggatctgtatgtgtgtgccatacatattcatagttacgaattgaagatgatggatggaaatatcgatctaggataggtatacatgttgatgcgggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctagatcggagtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatggatggaaatatcgatctaggataggtatacatgttgatgtgggttttactgatgcatatacatgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataataaacaagtatgttttataattattttgatcttgatatacttggatgatggcatatgcagcagctatatgtggatttttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgttacttctgcagcccgggggatccccaatacttgtatggccgcggccgcatgtccaagctggagaagtttacaaactgttacagcctctccaaaaccctcaggtttaaagcgatcccggtgggcaagacccaggagaacatcgacaacaagaggctcctggtggaagacgagaagcgcgccgaagactacaagggcgtgaagaagctgctcgataggtactacctcagctttattaacgacgtgctgcacagcatcaaactcaagaatctcaacaactacatctccctcttccgcaaaaagacccgcaccgagaaggagaacaaggagctggagaacctggagatcaacctccgcaaggaaatcgccaaagcgttcaagggcaatgaagggtacaagagcctcttcaagaaagacatcatcgaaactatcctcccagagtttctcgatgacaaggacgagatcgcgctggtgaactcctttaacgggttcacaaccgcgtttaccggcttctttgataacagggaaaatatgttctccgaggaggccaagtccaccagcatcgccttcaggtgtatcaacgagaacctcacccgctacatttccaatatggacattttcgagaaggtggatgcgatcttcgataagcacgaggtgcaggagatcaaagagaagattctcaattccgattatgacgtcgaggatttcttcgaaggggagttctttaattttgtgctcacacaagagggcattgacgtgtacaacgcgattatcgggggcttcgtcacagagtccggggagaagattaaggggctgaatgagtacatcaatctgtacaatcagaagaccaagcagaaactgccgaaattcaagccgctctacaagcaagtcctgtccgatagggaaagcctctccttctacggcgagggctataccagcgacgaggaggtgctggaagtcttccgcaacacactgaataagaatagcgagattttctcctccatcaagaagctcgagaagctctttaagaactttgacgagtacagctccgccgggattttcgtgaagaacgggccggcgatcagcaccatctccaaggacatctttggcgagtggaacgtcatcagggacaagtggaacgccgagtacgacgacatccacctgaagaagaaggcggtggtgaccgagaagtatgaggacgatcgcaggaagtccttcaaaaaaatcggctccttcagcctcgaacagctccaggagtatgccgatgcggatctgtccgtcgtcgagaagctgaaggaaatcatcattcagaaggtcgacgagatctataaagtgtacgggtccagcgagaagctgttcgacgccgactttgtgctcgagaagtccctcaaaaagaatgacgccgtggtggccattatgaaagacctgctcgactccgtgaagtccttcgaaaattacattaaagcgttctttggggaggggaaggaaactaacagggatgagtccttctatggcgactttgtcctcgcgtacgacatcctgctgaaggtcgaccacatttacgacgcgatccgcaactacgtgacacagaagccgtactccaaagacaagttcaagctgtacttccagaacccgcaatttatggggggctgggacaaggataaagagacagactaccgcgcgacaattctccgctatggctccaaatactatctggccatcatggacaagaagtacgcgaagtgcctgcagaagatcgacaaagacgacgtcaatggcaactatgaaaagatcaactacaagctgctgccgggcccgaacaagatgctcccgaaggtgttcttcagcaagaagtggatggcctactacaatccaagcgaggatattcagaaaatctataaaaacgggaccttcaagaagggggacatgtttaacctcaacgactgccacaagctcattgatttcttcaaggatagcatttcccgctacccgaaatggtccaatgcgtacgattttaacttctccgagacagaaaagtacaaagacatcgcgggcttttacagggaggtggaggagcaagggtataaagtttcttttgaatccgcgagcaagaaggaagtcgacaagctcgtcgaggagggcaagctctacatgttccaaatttataacaaggacttttccgacaagagccatgggaccccaaacctccacaccatgtacttcaaactgctctttgacgagaacaaccacgggcaaatcaggctgagcggcggcgccgaattattcatgcgcagggcctccctcaagaaggaagagctggtcgtccatccagccaattccccgatcgcgaacaagaacccggacaatccgaaaaagaccaccaccctgtcctacgacgtctacaaggacaaacgcttcagcgaagaccagtacgaattacacatcccaattgcgattaataagtgcccaaagaatatcttcaaaattaatacagaggtcagggtgctgctcaaacacgacgacaatccgtatgtcatcggcattgacaggggcgagcgcaatctgctctatatcgtggtcgtggatgggaagggcaatattgtggagcagtactccctgaacgagattatcaacaacttcaatgggattaggattaagaccgactatcacagcctgctcgacaagaaagaaaaagagaggtttgaggcccgccaaaactggacctccattgagaatatcaaagaattaaaggccggctatatttcccaagtcgtccacaagatctgcgagctggtggagaaatatgacgccgtgattgcgctcgaagacttaaattctgggttcaagaactcccgcgtgaaggtggaaaaacaggtgtatcagaaattcgagaaaatgctgatcgacaaactcaattatatggtggataagaagtccaacccgtgtgccacagggggcgcgctgaagggctatcagatcaccaacaagttcgagagcttcaagagcatgagcacccagaacgggtttattttctacatcccggcgtggctcacctccaagattgacccgagcaccggcttcgtgaacctcctgaagacaaagtatacctccattgccgacagcaagaagtttatctcctccttcgaccgcattatgtatgtgccggaggaggacctcttcgagttcgccctcgactacaaaaacttcagccgcacagatgcggattacatcaagaagtggaagctgtactcctacgggaacaggatccgcatcttcaggaatccaaaaaaaaataacgtctttgactgggaggaagtgtgcctgacatccgcctacaaggaactgttcaataaatacggcatcaattaccagcagggcgacattcgcgccctcctctgtgagcagtccgacaaagcgttttactccagcttcatggccctcatgtccctgatgctccaaatgaggaatagcatcacagggcgcaccgacgtcgacttcctcatcagcccggtgaagaactccgacgggatcttttacgactcccgcaactatgaggcgcaagagaatgcgatcctcccgaagaacgccgatgcgaacggggcctataatatcgccaggaaagtgctctgggccatcgggcagttcaaaaaggcggaggatgagaagctcgacaaggtgaaaattgccatttccaacaaggagtggctggagtacgcgcagacctccgtgaagcacaaaaggccggcggccacgaaaaaggccggccaggcaaaaaagaaaaagggatcctacccatacgatgttccagattacgcttatccctacgacgtgcctgattatgcatacccatatgatgtccccgactatgcctaagagctccggccgggagcatgcgacgtcgatctaactgactagccgcggccatgctagagtccgcaaaaatcaccagtctctctctacaaatctatctctctctatttttctccagaataatgtgtgagtagttcccagataagggaattagggttcttatagggtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtgacctgaattcgaggcggtttgcgtattggctagagcagcttgccaacatggtggagcacgacactctcgtctactccaagaatatcaaagatacagtctcagaagaccaaagggctattgagacttttcaacaaagggtaatatcgggaaacctcctcggattccattgcccagctatctgtcacttcatcaaaaggacagtagaaaaggaaggtggcacctacaaatgccatcattgcgataaaggaaaggctatcgttcaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgataacatggtggagcacgacactctcgtctactccaagaatatcaaagatacagtctcagaagaccaaagggctattgagacttttcaacaaagggtaatatcgggaaacctcctcggattccattgcccagctatctgtcacttcatcaaaaggacagtagaaaaggaaggtggcacctacaaatgccatcattgcgataaaggaaaggctatcgttcaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagaccttcctctatataaggaagttcatttcatttggagaggacacgctgaaatcaccagtctctctctacaaatctatctctctcgagctttcgcagatcccggggggcaatgagatatgaaaaagcctgaactcaccgcgacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacctgatgcagctctcggagggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgtttatcggcactttgcatcggccgcgctcccgattccggaagtgcttgacattggggagtttagcgagagcctgacctattgcatctcccgccgtgcacagggtgtcacgttgcaagacctgcctgaaaccgaactgcccgctgttctacaaccggtcgcggaggctatggatgcgatcgctgcggccgatcttagccagacgagcgggttcggcccattcggaccgcaaggaatcggtcaatacactacatggcgtgatttcatatgcgcgattgctgatccccatgtgtatcactggcaaactgtgatggacgacaccgtcagtgcgtccgtcgcgcaggctctcgatgagctgatgctttgggccgaggactgccccgaagtccggcacctcgtgcacgcggatttcggctccaacaatgtcctgacggacaatggccgcataacagcggtcattgactggagcgaggcgatgttcggggattcccaatacgaggtcgccaacatcttcttctggaggccgtggttggcttgtatggagcagcagacgcgctacttcgagcggaggcatccggagcttgcaggatcgccacgactccgggcgtatatgctccgcattggtcttgaccaactctatcagagcttggttgacggcaatttcgatgatgcagcttgggcgcagggtcgatgcgacgcaatcgtccgatccggagccgggactgtcgggcgtacacaaatcgcccgcagaagcgcggccgtctggaccgatggctgtgtagaagtactcgccgatagtggaaaccgacgccccagcactcgtccgagggcaaagaaatagagtagatgccgaccggatctgtcgatcgacaagctcgagtttctccataataatgtgtgagtagttcccagataagggaattagggttcctatagggtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtactaaaatccagatcccccgaattaattcggcgttaattcagtacattaaaaacgtccgcaatgtgttattaagttgtcactagtcaggttaactcaattcggcgttaattcagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccgggacggcgtcagcgggagagccgttgtaaggcggcagactttgctcatgttaccgatgctattcggaagaacggcaactaagctgccgggtttgaaacacggatgatctcgcggagggtagcatgttgattgtaacgatgacagagcgttgctgcctgtgatcacttaagtaactaactaacaggaagagtttgtagaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcttagtagttagacgtccccgagatccatgctagaccatgaatccagaagcccgagaggttgccgcctttcgggctttttctttttcaaaaaaaaaaatttataaaacgatctgttgcggccggccgccgggttgtgggcaaaggcgctcgacggtgggcaaccgcttgcggttgtccacgggcggagccggtgcgcgtagcgcattgtccacaagccaagggcgaccaataattgatatatatattcataattgaaaagctaattgaacatactacttgctgtaactacttgccggagcgaggggtgtttgcaagctgttgatctgaaagggctattagcgttctcacgtgcctttttgattagcgatttcacgtgaccttattagcgatttcacgtactccgattagcgatttcacgtaccctgattagcgatttcacgtggatagtttttggagcgggccggaaagccccgtgaatcaaggctttgcggggcattagcggtttcacgtggataactaccctctatccacaggcttccggggataaaaaagcccgctcgacggcgggctgttggatggggatctagcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctaccgggtctgacgctcagtggaacggggcccaatctgaataatgttacaaccaattaaccaattctgattagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagtttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcagggacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgtttttccggggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaagcgatagattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcctcgacgtttcccgttgaatatggctcataacaccccttgtattactgtttatgtaagcagacagttttattgttcatgatgatatatttttatcttgtgcaatgtaacatcagagattttgagacacgggccagagctgcagtttgatcccgaggggaaccctgtggttgacatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgttattctaataaacgctcttttctcttag

technical effects

The backbone vector of the present invention integrates the crRNA expression cassette and the Cpf1 nuclease expression cassette into a binary vector. The vector construction steps are simplified; 2. the SPR gene is integrated on the vector, so that antibiotic screening conditions are provided for vector identification, and the identification step is simplified.

Drawings

FIG. 1 is a vector diagram of backbone plasmid vector pHUN611 in one embodiment of the present invention;

FIG. 2 is a diagram showing the results of a site-directed mutagenesis assay of rice endogenous BEL gene using the recombinant pHUN611-BEL vector transferred into protoplasts, wherein WT represents a wild-type gene, "-" represents a sequence in which a deletion mutation has occurred, "+" represents a sequence in which an insertion mutation has occurred, and the number following "-/+" represents the number of nucleotides deleted or inserted;

FIG. 3 is a partial result diagram of the sequencing test of the site-directed mutagenesis of the endogenous BEL gene of rice in regenerated plants after PEG-mediated protoplast transfer using the PHUN611-BEL recombinant vector, wherein WT represents the wild-type gene, "-" represents the sequence in which the deletion mutation has occurred, "+" represents the sequence in which the insertion mutation has occurred, and the number following "-/+" represents the number of nucleotides deleted or inserted;

FIG. 4 is a partial graph showing the results of site-directed mutagenesis of endogenous BEL gene in rice in transgenic plants obtained by Agrobacterium-mediated stable transformation using the pHUN4c16-BEL recombinant vector, wherein WT represents a wild-type gene, "-" represents a sequence in which deletion mutation has occurred, "+" represents a sequence in which insertion mutation has occurred, and the numbers following "-/+" represent the number of nucleotides deleted or inserted;

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples facilitate a better understanding of the invention, but do not limit the invention.

Examples

Design of backbone plasmid vectors

In particular, the present invention contemplates a backbone plasmid vector comprising a crRNA expression cassette and a Cpf1 nuclease expression cassette, the crRNA expression cassette comprising: a rice U3 promoter, a spectinomycin resistance gene and a Poly-T terminator. The Cpf1 nuclease expression cassette includes: a maize ZmUBI promoter, a rice preferred codon-engineered Cpf1 coding sequence, and a 35s terminator. The above sequences are unique parts of the backbone plasmid vector, which may also include the general structure of some conventional vectors, and will not be described again here. One implementation of the backbone plasmid vector designed by the present invention is shown in Seq ID No. 1. The vector may be constructed in a manner conventional in the art.

Preparation of recombinant vector for rice BEL gene targeting.

1.1 selection of the nucleotide sequence at position 2463-2487 in the Rice BEL Gene (LOC _ Os03g55240)TTTGGAAGAGAGTGACTGCGCTAGCAATC, (the 5' TTTN- (N) is underlined)_X-TTTG moiety in 3' structure) as targeting site.

1.2, synthesizing (Huada Gene Co.) a forward oligonucleotide chain (BEL KO1P 1) and a complementary reverse oligonucleotide chain (BEL KO1P2) at the selected target site,

the specific sequence is as follows:

wherein the part not underlined is a sequence or a complementary sequence of the above target site from which TTTN is removed, and the underlined part is a cohesive end for ligation to a vector.

1.3, annealing both strands of BEL KO1P1 and BEL KO1P2 by an annealing program to form double-stranded DNA having cohesive ends as an insert for constructing a recombinant vector.

1.4, the pHUN611 vector was digested with BsaI endonuclease (NEB) at 37 ℃ for 2 hours, and the digestion system was inactivated at 65 ℃ for 20 minutes, to serve as a backbone fragment for constructing a recombinant vector.

1.5, the recombinant vector backbone fragment and the insert fragment were ligated with T4 ligase (NEB) and transformed into E.coli. Positive transformants were obtained by selecting plaques with kanamycin resistance and no spectinomycin resistance. After sequencing verification, positive plasmids are extracted to form recombinant vector plasmids for targeting rice BEL gene CRISPR/Cpf1, and the recombinant vector plasmids are named as pHUN 611-BEL.

Example 2 targeting of rice BEL Gene mediated by transient transformation of protoplasts.

2.1, the pHUN611-BEL plasmid is transformed into Nipponbare protoplasts of rice by the PEG Method, and the specific procedures for transformation of rice protoplasts are described in the experimental methods disclosed in Zhang et al A high level efficiency plasmid green plasmid for transformation gene expression and growing light/chloroplast-related process plant Method (2011).

2.2, extracting the genome DNA 48 hours after the protoplast transformation of the rice by using a plant genome miniprep kit (Tiangen Biochemical Co.). Using the DNA as a template, and performing PCR amplification on a sequence containing a target region by using Phusion high fidelity DNA polymerase (NEB company), wherein primers used for the PCR amplification are as follows:

Bel KO1 genome check FP:GTGGAGGTCGACATGACTGAAG

BelKO1 genome check RP:TTGCACATTCATACAAATTGGT

2.3, the PCR amplified fragment obtained was recovered by electrophoresis, cloned into pEASY-T vector (all-type gold), sequenced with M13F primer, and analyzed for mutations at the target site. Sequencing results show that 40 clones in 120 tested clones carry mutation on BEL gene target sequences, and the mutation efficiency is 33.3%; the form of the mutation includes insertion and/or deletion of a base. Partial results are shown in FIG. 2.

2.4, transforming the pHUN611-BEL plasmid into a rice Nipponbare protoplast by using a PEG method, and obtaining a regenerated rice plant. Specific procedures for Transformation and regeneration of Rice protoplasts reference is made to the experimental procedures disclosed in the document Hayashimoto et al A polyethylene glycol-media protocol Transformation System for Production of FertileTransgenic Rice plants plant Physiology (1990).

2.5, extracting the genome DNA of the obtained 60 regenerated plants by using a plant genome miniprep kit (Tiangen Biochemical company). Using this DNA as a template, a sequence containing the target region was PCR-amplified using Phusion high fidelity DNA polymerase (NEB) using the primers Bel KO1 genome check FP and Bel KO1 genome check RP described above.

2.6, PCR amplified fragments obtained by using Bel KO1 genome check FP as primer pair were directly sequenced, and mutations at the target sites were analyzed. Sequencing results show that 9 plants in 60 tested plants have mutation on the BEL gene target sequence, and the mutation efficiency is 15.0%; the form of the mutation includes insertion and/or deletion of a base. Partial results are shown in FIG. 3.

Example 3 targeting of the Agrobacterium-stabilized transgene mediated Rice BEL Gene.

3.1, transferring the pHUN611-BEL recombinant vector into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (component supervision and inspection test center for rice group preservation of transgenic biological products of department of agriculture of the academy of agricultural sciences of Anhui province) by using a freeze-thaw method to obtain a positive clone.

3.2, after the glumes of the mature seeds are removed, the seeds are soaked in 70% alcohol for 1min, and the alcohol is poured off. Seeds were soaked for 40min (150r/min) with 1 drop of Tween20 in 50% sodium hypochlorite (stock solution available chlorine concentration greater than 4%). And pouring off sodium hypochlorite, and washing for 5 times by using sterile water until the solution is clear and has no sodium hypochlorite taste. The seeds were soaked in sterile water overnight. The embryos were peeled off with a scalpel along the aleurone layer of the seeds and inoculated on callus induction medium. And after dark culture for 11 days at the temperature of 30 ℃, separating the callus from endosperm and embryo, and pre-culturing the primary callus with good bud removal state and vigorous division for 3-5 days for agrobacterium transformation.

3.3 Agrobacterium tumefaciens introduced with the recombinant expression vector as described above is used for Agrobacterium-mediated genetic transformation, such as those proposed with reference to Yongbo Duan (Yongbo Duan, ChengungZhai, et al. an infection and high-throughput protocol for Agrobacterium transformed base on phosphomanosis enzyme porous selection in Japonica attachment (Oryza sativa L.) [ J ]. Plant Report, 2012.DOI 10.1007/s00299-012 1275-3). 34 pHUN611-BEL plants (pHUN611-BEL transgenic rice plants) were obtained in total.

3.4, extracting the genome DNA of the obtained 34 pHUN611-BEL transgenic rice plants by using a plant genome minification kit (Tiangen Biochemical company). Using this DNA as a template, a sequence containing the target region was PCR-amplified using Phusion high fidelity DNA polymerase (NEB) using the primers Bel KO1 genome check FP and Bel KO1 genome check RP described above.

3.5, directly sequencing the PCR amplified fragment obtained by using Bel KO1 genome check FP as a primer pair, and analyzing the mutation of the target site. Sequencing results show that 14 plants among 34 tested plants have mutation on the BEL gene target sequence, and the mutation efficiency is 41.2%; the form of the mutation includes insertion and/or deletion of a base. Partial results are shown in FIG. 4.

As is apparent from FIG. 4, gene targeting at specific sites of rice can be achieved by using the vector of the present invention for gene targeting.

Sequence listing

<110> institute of Paddy Rice of agricultural science institute of Anhui province

<120> backbone plasmid vector for genetic engineering and application

<130>HCI20160266

<160>5

<170>PatentIn version 3.5

<210>1

<211>13069

<212>DNA

<213> backbone plasmid vector

<400>1:

gtttacccgc caatatatcc tgtcaaacac tgatagttta aactgaaggc gggaaacgac 60

aatctgatcc aagctcaagc taagctcacg tgacggaatt aagcttaagg gatctttaaa 120

catacgaaca gatcacttaa agttcttctg aagcaactta aagttatcag gcatgcatgg 180

atcttggagg aatcagatgt gcagtcaggg accatagcac aagacaggcg tcttctactg 240

gtgctaccag caaatgctgg aagccgggaa cactgggtac gttggaaacc acgtgatgtg 300

aagaagtaag ataaactgta ggagaaaagc atttcgtagt gggccatgaa gcctttcagg 360

acatgtattg cagtatgggc cggcccatta cgcaattgga cgacaacaaa gactagtatt 420

agtaccacct cggctatcca catagatcaa agctgattta aaagagttgt gcagatgatc 480

cgtggcaaga gaccaaccca gtggacataa gcctgttcgg ttcgtaagct gtaatgcaag 540

tagcgtatgc gctcacgcaa ctggtccaga accttgaccg aacgcagcgg tggtaacggc 600

gcagtggcgg ttttcatggc ttgttatgac tgtttttttg gggtacagtc tatgcctcgg 660

gcatccaagc agcaagcgcg ttacgccgtg ggtcgatgtt tgatgttatg gagcagcaac 720

gatgttacgc agcagggcag tcgccctaaa acaaagttaa acatcatggg ggaagcggtg 780

atcgccgaag tatcgactca actatcagag gtagttggcg tcatcgagcg ccatctcgaa 840

ccgacgttgc tggccgtaca tttgtacggc tccgcagtgg atggcggcct gaagccacac 900

agtgatattg atttgctggt tacggtgacc gtaaggcttg atgaaacaac gcggcgagct 960

ttgatcaacg accttttgga aacttcggct tcccctggag agagcgagat tctccgcgct 1020

gtagaagtca ccattgttgt gcacgacgac atcattccgt ggcgttatcc agctaagcgc 1080

gaactgcaat ttggagaatg gcagcgcaat gacattcttg caggtatctt cgagccagcc 1140

acgatcgaca ttgatctggc tatcttgctg acaaaagcaa gagaacatag cgttgccttg 1200

gtaggtccag cggcggagga actctttgat ccggttcctg aacaggatct atttgaggcg 1260

ctaaatgaaa ccttaacgct atggaactcg ccgcccgact gggctggcga tgagcgaaat 1320

gtagtgctta cgttgtcccg catttggtac agcgcagtaa ccggcaaaat cgcgccgaag 1380

gatgtcgctg ccgactgggc aatggagcgc ctgccggccc agtatcagcc cgtcatactt 1440

gaagctagac aggcttatct tggacaagaa gaagatcgct tggcctcgcg cgcagatcag 1500

ttggaagaat ttgtccacta cgtgaaaggc gagatcacca aggtagtcgg caaataatgt 1560

ctagctagaa attcgttcaa gccgacgccg cttcgcggcg cggcttaact caagcgttag 1620

atgcactaag cacataattg ctcacagcca aactatcagg tcaagtctgc ttttattatt 1680

tttaagcgtg cataataagc cggtctcatt ttttttagta gtagcatctg acggtgggga 1740

agcttgatat cgaattcctg cagtgcagcg tgacccggtc gtgcccctct ctagagataa 1800

tgagcattgc atgtctaagt tataaaaaat taccacatat tttttttgtc acacttgttt 1860

gaagtgcagt ttatctatct ttatacatat atttaaactt tactctacga ataatataat 1920

ctatagtact acaataatat cagtgtttta gagaatcata taaatgaaca gttagacatg 1980

gtctaaagga caattgagta ttttgacaac aggactctac agttttatct ttttagtgtg 2040

catgtgttct cctttttttt tgcaaatagc ttcacctata taatacttca tccattttat 2100

tagtacatcc atttagggtt tagggttaat ggtttttata gactaatttt tttagtacat 2160

ctattttatt ctattttagc ctctaaatta agaaaactaa aactctattt tagttttttt 2220

atttaataat ttagatataa aatagaataa aataaagtga ctaaaaatta aacaaatacc 2280

ctttaagaaa ttaaaaaaac taaggaaaca tttttcttgt ttcgagtaga taatgccagc 2340

ctgttaaacg ccgtcgacga gtctaacgga caccaaccag cgaaccagca gcgtcgcgtc 2400

gggccaagcg aagcagacgg cacggcatct ctgtcgctgc ctctggaccc ctctcgagag 2460

ttccgctcca ccgttggact tgctccgctg tcggcatcca gaaatgcgtg gcggagcggc 2520

agacgtgagc cggcacggca ggcggcctcc tcctcctctc acggcacggc agctacgggg 2580

gattcctttc ccaccgctcc ttcgctttcc cttcctcgcc cgccgtaata aatagacacc 2640

ccctccacac cctctttccc caacctcgtg ttgttcggag cgcacacaca cacaaccaga 2700

tctcccccaa atccacccgt cggcacctcc gcttcaaggt acgccgctcg tcctcccccc 2760

ccccccctct ctaccttctc tagatcggcg ttccggtcca tggttagggc ccggtagttc 2820

tacttctgtt catgtttgtg ttagatccgt gtttgtgtta gatccgtgct gctagcgttc 2880

gtacacggat gcgacctgta cgtcagacac gttctgattg ctaacttgcc agtgtttctc 2940

tttggggaat cctgggatgg ctctagccgt tccgcagacg ggatcgattt catgattttt3000

tttgtttcgt tgcatagggt ttggtttgcc cttttccttt atttcaatat atgccgtgca 3060

cttgtttgtc gggtcatctt ttcatgcttt tttttgtctt ggttgtgatg atgtggtctg 3120

gttgggcggt cgttctagat cggagtagaa ttctgtttca aactacctgg tggatttatt 3180

aattttggat ctgtatgtgt gtgccataca tattcatagt tacgaattga agatgatgga 3240

tggaaatatc gatctaggat aggtatacat gttgatgcgg gttttactga tgcatataca 3300

gagatgcttt ttgttcgctt ggttgtgatg atgtggtgtg gttgggcggt cgttcattcg 3360

ttctagatcg gagtagaata ctgtttcaaa ctacctggtg tatttattaa ttttggaact 3420

gtatgtgtgt gtcatacatc ttcatagtta cgagtttaag atggatggaa atatcgatct 3480

aggataggta tacatgttga tgtgggtttt actgatgcat atacatgatg gcatatgcag 3540

catctattca tatgctctaa ccttgagtac ctatctatta taataaacaa gtatgtttta 3600

taattatttt gatcttgata tacttggatg atggcatatg cagcagctat atgtggattt 3660

ttttagccct gccttcatac gctatttatt tgcttggtac tgtttctttt gtcgatgctc 3720

accctgttgt ttggtgttac ttctgcagcc cgggggatcc ccaatacttg tatggccgcg 3780

gccgcatgtc caagctggag aagtttacaa actgttacag cctctccaaa accctcaggt 3840

ttaaagcgat cccggtgggc aagacccagg agaacatcga caacaagagg ctcctggtgg 3900

aagacgagaa gcgcgccgaa gactacaagg gcgtgaagaa gctgctcgat aggtactacc 3960

tcagctttat taacgacgtg ctgcacagca tcaaactcaa gaatctcaac aactacatct 4020

ccctcttccg caaaaagacc cgcaccgaga aggagaacaa ggagctggag aacctggaga 4080

tcaacctccg caaggaaatc gccaaagcgt tcaagggcaa tgaagggtac aagagcctct 4140

tcaagaaaga catcatcgaa actatcctcc cagagtttct cgatgacaag gacgagatcg 4200

cgctggtgaa ctcctttaac gggttcacaa ccgcgtttac cggcttcttt gataacaggg 4260

aaaatatgtt ctccgaggag gccaagtcca ccagcatcgc cttcaggtgt atcaacgaga 4320

acctcacccg ctacatttcc aatatggaca ttttcgagaa ggtggatgcg atcttcgata 4380

agcacgaggt gcaggagatc aaagagaaga ttctcaattc cgattatgac gtcgaggatt 4440

tcttcgaagg ggagttcttt aattttgtgc tcacacaaga gggcattgac gtgtacaacg 4500

cgattatcgg gggcttcgtc acagagtccg gggagaagat taaggggctg aatgagtaca 4560

tcaatctgta caatcagaag accaagcaga aactgccgaa attcaagccg ctctacaagc 4620

aagtcctgtc cgatagggaa agcctctcct tctacggcga gggctatacc agcgacgagg 4680

aggtgctgga agtcttccgc aacacactga ataagaatag cgagattttc tcctccatca 4740

agaagctcga gaagctcttt aagaactttg acgagtacag ctccgccggg attttcgtga 4800

agaacgggcc ggcgatcagc accatctcca aggacatctt tggcgagtgg aacgtcatca 4860

gggacaagtg gaacgccgag tacgacgaca tccacctgaa gaagaaggcg gtggtgaccg 4920

agaagtatga ggacgatcgc aggaagtcct tcaaaaaaat cggctccttc agcctcgaac 4980

agctccagga gtatgccgat gcggatctgt ccgtcgtcga gaagctgaag gaaatcatca 5040

ttcagaaggt cgacgagatc tataaagtgt acgggtccag cgagaagctg ttcgacgccg 5100

actttgtgct cgagaagtcc ctcaaaaaga atgacgccgt ggtggccatt atgaaagacc 5160

tgctcgactc cgtgaagtcc ttcgaaaatt acattaaagc gttctttggg gaggggaagg 5220

aaactaacag ggatgagtcc ttctatggcg actttgtcct cgcgtacgac atcctgctga 5280

aggtcgacca catttacgac gcgatccgca actacgtgac acagaagccg tactccaaag 5340

acaagttcaa gctgtacttc cagaacccgc aatttatggg gggctgggac aaggataaag 5400

agacagacta ccgcgcgaca attctccgct atggctccaa atactatctg gccatcatgg 5460

acaagaagta cgcgaagtgc ctgcagaaga tcgacaaaga cgacgtcaat ggcaactatg 5520

aaaagatcaa ctacaagctg ctgccgggcc cgaacaagat gctcccgaag gtgttcttca 5580

gcaagaagtg gatggcctac tacaatccaa gcgaggatat tcagaaaatc tataaaaacg 5640

ggaccttcaa gaagggggac atgtttaacc tcaacgactg ccacaagctc attgatttct 5700

tcaaggatag catttcccgc tacccgaaat ggtccaatgc gtacgatttt aacttctccg 5760

agacagaaaa gtacaaagac atcgcgggct tttacaggga ggtggaggag caagggtata 5820

aagtttcttt tgaatccgcg agcaagaagg aagtcgacaa gctcgtcgag gagggcaagc 5880

tctacatgtt ccaaatttat aacaaggact tttccgacaa gagccatggg accccaaacc 5940

tccacaccat gtacttcaaa ctgctctttg acgagaacaa ccacgggcaa atcaggctga 6000

gcggcggcgc cgaattattc atgcgcaggg cctccctcaa gaaggaagag ctggtcgtcc 6060

atccagccaa ttccccgatc gcgaacaaga acccggacaa tccgaaaaag accaccaccc 6120

tgtcctacga cgtctacaag gacaaacgct tcagcgaaga ccagtacgaa ttacacatcc 6180

caattgcgat taataagtgc ccaaagaata tcttcaaaat taatacagag gtcagggtgc 6240

tgctcaaaca cgacgacaat ccgtatgtca tcggcattga caggggcgag cgcaatctgc 6300

tctatatcgt ggtcgtggat gggaagggca atattgtgga gcagtactcc ctgaacgaga 6360

ttatcaacaa cttcaatggg attaggatta agaccgacta tcacagcctg ctcgacaaga 6420

aagaaaaaga gaggtttgag gcccgccaaa actggacctc cattgagaat atcaaagaat 6480

taaaggccgg ctatatttcc caagtcgtcc acaagatctg cgagctggtg gagaaatatg 6540

acgccgtgat tgcgctcgaa gacttaaatt ctgggttcaa gaactcccgc gtgaaggtgg 6600

aaaaacaggt gtatcagaaa ttcgagaaaa tgctgatcga caaactcaat tatatggtgg 6660

ataagaagtc caacccgtgt gccacagggg gcgcgctgaa gggctatcag atcaccaaca 6720

agttcgagag cttcaagagc atgagcaccc agaacgggtt tattttctac atcccggcgt 6780

ggctcacctc caagattgac ccgagcaccg gcttcgtgaa cctcctgaag acaaagtata 6840

cctccattgc cgacagcaag aagtttatct cctccttcga ccgcattatg tatgtgccgg 6900

aggaggacct cttcgagttc gccctcgact acaaaaactt cagccgcaca gatgcggatt 6960

acatcaagaa gtggaagctg tactcctacg ggaacaggat ccgcatcttc aggaatccaa 7020

aaaaaaataa cgtctttgac tgggaggaag tgtgcctgac atccgcctac aaggaactgt 7080

tcaataaata cggcatcaat taccagcagg gcgacattcg cgccctcctc tgtgagcagt 7140

ccgacaaagc gttttactcc agcttcatgg ccctcatgtc cctgatgctc caaatgagga 7200

atagcatcac agggcgcacc gacgtcgact tcctcatcag cccggtgaag aactccgacg 7260

ggatctttta cgactcccgc aactatgagg cgcaagagaa tgcgatcctc ccgaagaacg 7320

ccgatgcgaa cggggcctat aatatcgcca ggaaagtgct ctgggccatc gggcagttca 7380

aaaaggcgga ggatgagaag ctcgacaagg tgaaaattgc catttccaac aaggagtggc 7440

tggagtacgc gcagacctcc gtgaagcaca aaaggccggc ggccacgaaa aaggccggcc 7500

aggcaaaaaa gaaaaaggga tcctacccat acgatgttcc agattacgct tatccctacg 7560

acgtgcctga ttatgcatac ccatatgatg tccccgacta tgcctaagag ctccggccgg 7620

gagcatgcga cgtcgatcta actgactagc cgcggccatg ctagagtccg caaaaatcac 7680

cagtctctct ctacaaatct atctctctct atttttctcc agaataatgt gtgagtagtt 7740

cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 7800

cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 7860

accaaaatcc agtgacctga attcgaggcg gtttgcgtat tggctagagc agcttgccaa 7920

catggtggag cacgacactc tcgtctactc caagaatatc aaagatacag tctcagaaga 7980

ccaaagggct attgagactt ttcaacaaag ggtaatatcg ggaaacctcc tcggattcca 8040

ttgcccagct atctgtcact tcatcaaaag gacagtagaa aaggaaggtg gcacctacaa 8100

atgccatcat tgcgataaag gaaaggctat cgttcaagat gcctctgccg acagtggtcc 8160

caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc caaccacgtc 8220

ttcaaagcaa gtggattgat gtgataacat ggtggagcac gacactctcg tctactccaa 8280

gaatatcaaa gatacagtct cagaagacca aagggctatt gagacttttc aacaaagggt 8340

aatatcggga aacctcctcg gattccattg cccagctatc tgtcacttca tcaaaaggac 8400

agtagaaaag gaaggtggca cctacaaatg ccatcattgc gataaaggaa aggctatcgt 8460

tcaagatgcc tctgccgaca gtggtcccaa agatggaccc ccacccacga ggagcatcgt 8520

ggaaaaagaa gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg atatctccac 8580

tgacgtaagg gatgacgcac aatcccacta tccttcgcaa gaccttcctc tatataagga 8640

agttcatttc atttggagag gacacgctga aatcaccagt ctctctctac aaatctatct 8700

ctctcgagct ttcgcagatc ccggggggca atgagatatg aaaaagcctg aactcaccgc 8760

gacgtctgtc gagaagtttc tgatcgaaaa gttcgacagc gtctccgacc tgatgcagct 8820

ctcggagggc gaagaatctc gtgctttcag cttcgatgta ggagggcgtg gatatgtcct 8880

gcgggtaaat agctgcgccg atggtttcta caaagatcgt tatgtttatc ggcactttgc 8940

atcggccgcg ctcccgattc cggaagtgct tgacattggg gagtttagcg agagcctgac 9000

ctattgcatc tcccgccgtg cacagggtgt cacgttgcaa gacctgcctg aaaccgaact 9060

gcccgctgtt ctacaaccgg tcgcggaggc tatggatgcg atcgctgcgg ccgatcttag 9120

ccagacgagc gggttcggcc cattcggacc gcaaggaatc ggtcaataca ctacatggcg 9180

tgatttcata tgcgcgattg ctgatcccca tgtgtatcac tggcaaactg tgatggacga 9240

caccgtcagt gcgtccgtcg cgcaggctct cgatgagctg atgctttggg ccgaggactg 9300

ccccgaagtc cggcacctcg tgcacgcgga tttcggctcc aacaatgtcc tgacggacaa 9360

tggccgcata acagcggtca ttgactggag cgaggcgatg ttcggggatt cccaatacga 9420

ggtcgccaac atcttcttct ggaggccgtg gttggcttgt atggagcagc agacgcgcta 9480

cttcgagcgg aggcatccgg agcttgcagg atcgccacga ctccgggcgt atatgctccg 9540

cattggtctt gaccaactct atcagagctt ggttgacggc aatttcgatg atgcagcttg 9600

ggcgcagggt cgatgcgacg caatcgtccg atccggagcc gggactgtcg ggcgtacaca 9660

aatcgcccgc agaagcgcgg ccgtctggac cgatggctgt gtagaagtac tcgccgatag 9720

tggaaaccga cgccccagca ctcgtccgag ggcaaagaaa tagagtagat gccgaccgga 9780

tctgtcgatc gacaagctcg agtttctcca taataatgtg tgagtagttc ccagataagg 9840

gaattagggt tcctataggg tttcgctcat gtgttgagca tataagaaac ccttagtatg 9900

tatttgtatt tgtaaaatac ttctatcaat aaaatttcta attcctaaaa ccaaaatcca 9960

gtactaaaat ccagatcccc cgaattaatt cggcgttaat tcagtacatt aaaaacgtcc 10020

gcaatgtgtt attaagttgt cactagtcag gttaactcaa ttcggcgtta attcagtaca 10080

ttaaaaacgt ccgcaatgtg ttattaagtt gtctaagcgt caatttgttt acaccacaat 10140

atatcctgcc accagccagc caacagctcc ccgaccggca gctcggcaca aaatcaccac 10200

tcgatacagg cagcccatca gtccgggacg gcgtcagcgg gagagccgtt gtaaggcggc 10260

agactttgct catgttaccg atgctattcg gaagaacggc aactaagctg ccgggtttga 10320

aacacggatg atctcgcgga gggtagcatg ttgattgtaa cgatgacaga gcgttgctgc 10380

ctgtgatcac ttaagtaact aactaacagg aagagtttgt agaaacgcaa aaaggccatc 10440

cgtcaggatg gccttctgct tagtttgatg cctggcagtt tatggcgggc gtcctgcccg 10500

ccaccctccg ggccgttgct tcacaacgtt caaatccgct cccggcggat ttgtcctact 10560

caggagagcg ttcaccgaca aacaacagat aaaacgaaag gcccagtctt ccgactgagc 10620

ctttcgtttt atttgatgcc tggcagttcc ctactctcgc ttagtagtta gacgtccccg 10680

agatccatgc tagaccatga atccagaagc ccgagaggtt gccgcctttc gggctttttc 10740

tttttcaaaa aaaaaaattt ataaaacgat ctgttgcggc cggccgccgg gttgtgggca 10800

aaggcgctcg acggtgggca accgcttgcg gttgtccacg ggcggagccg gtgcgcgtag 10860

cgcattgtcc acaagccaag ggcgaccaat aattgatata tatattcata attgaaaagc 10920

taattgaaca tactacttgc tgtaactact tgccggagcg aggggtgttt gcaagctgtt 10980

gatctgaaag ggctattagc gttctcacgt gcctttttga ttagcgattt cacgtgacct 11040

tattagcgat ttcacgtact ccgattagcg atttcacgta ccctgattag cgatttcacg 11100

tggatagttt ttggagcggg ccggaaagcc ccgtgaatca aggctttgcg gggcattagc 11160

ggtttcacgt ggataactac cctctatcca caggcttccg gggataaaaa agcccgctcg 11220

acggcgggct gttggatggg gatctagcgg taatacggtt atccacagaa tcaggggata 11280

acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 11340

cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 11400

caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 11460

gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 11520

tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt 11580

aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 11640

ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 11700

cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 11760

tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc tgcgctctgc 11820

tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 11880

ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 11940

aagaagatcc tttgatcttt tctaccgggt ctgacgctca gtggaacggg gcccaatctg 12000

aataatgtta caaccaatta accaattctg attagaaaaa ctcatcgagc atcaaatgaa 12060

actgcaattt attcatatca ggattatcaa taccatattt ttgaaaaagc cgtttctgta 12120

atgaaggaga aaactcaccg aggcagttcc ataggatggc aagatcctgg tatcggtctg 12180

cgattccgac tcgtccaaca tcaatacaac ctattaattt cccctcgtca aaaataaggt 12240

tatcaagtga gaaatcacca tgagtgacga ctgaatccgg tgagaatggc aaaagtttat 12300

gcatttcttt ccagacttgt tcaacaggcc agccattacg ctcgtcatca aaatcactcg 12360

catcaaccaa accgttattc attcgtgatt gcgcctgagc gagacgaaat acgcgatcgc 12420

tgttaaaagg acaattacaa acaggaatcg aatgcaaccg gcgcagggac actgccagcg 12480

catcaacaat attttcacct gaatcaggat attcttctaa tacctggaat gctgtttttc 12540

cggggatcgc agtggtgagt aaccatgcat catcaggagt acggataaaa tgcttgatgg 12600

tcggaagagg cataaattcc gtcagccagt ttagtctgac catctcatct gtaacatcat 12660

tggcaacgct acctttgcca tgtttcagaa acaactctgg cgcatcgggc ttcccataca 12720

agcgatagat tgtcgcacct gattgcccga cattatcgcg agcccattta tacccatata 12780

aatcagcatc catgttggaa tttaatcgcg gcctcgacgt ttcccgttga atatggctca 12840

taacacccct tgtattactg tttatgtaag cagacagttt tattgttcat gatgatatat 12900

ttttatcttg tgcaatgtaa catcagagat tttgagacac gggccagagc tgcagtttga 12960

tcccgagggg aaccctgtgg ttgacatgca catacaaatg gacgaacgga taaacctttt 13020

cacgcccttt taaatatccg ttattctaat aaacgctctt ttctcttag 13069

<210>2

<211>68

<212>DNA

<213>BEL KO1 P1

<400>2:

ggcagtcaaa agaccttttt aatttctact cttgtagatg aagagagtga ctgcgctagc 60

aatcgctc 68

<210>3

<211>68

<212>DNA

<213>BEL KO1 P2

<400>3:

aaaagagcga ttgctagcgc agtcactctc ttcatctaca agagtagaaa ttaaaaaggt 60

cttttgac 68

<210>4

<211>22

<212>DNA

<213>Bel KO1 genome check FP

<400>4:

gtggaggtcg acatgactga ag 22

<210>5

<211>22

<212>DNA

<213>Bel KO1 genome check RP

<400>5:

ttgcacattc atacaaattg gt 22

Claims (9)

1. A backbone plasmid vector for genetic engineering, characterized in that,

consists of a crRNA expression frame and a Cpf1 nuclease expression frame, wherein the nucleotide sequence of the crRNA expression frame is shown as the 107 th to 1716 th positions of Seq ID No.1, and the nucleotide sequence of the Cpf1 nuclease expression frame is shown as the 1746 th to 7878 th positions of Seq ID No. 1.

2. The backbone plasmid vector of claim 1, wherein a, the crRNA expression cassette comprises: the nucleotide sequence of the rice U3 promoter is shown as 107 th to 487 th sites of Seq ID No. 1; a spectinomycin resistance gene whose nucleotide sequence is shown in Seq ID No.1 at positions 495 to 1701; and a Poly-T terminator, the nucleotide sequence of which is shown in position 1709 to 1716 of Seq ID No.1,

b. the Cpf1 nuclease expression cassette comprises: the maize ZmUBI promoter, the nucleotide sequence of which is shown in Seq ID No.1, positions 1746-3777; LbCpf1, the nucleotide sequence of which is shown at 3786-7607 of Seq ID No.1 and the nucleotide sequence of which is shown at 7614-7878 of Seq ID No. 1.

3. The backbone plasmid vector of claim 2, wherein the backbone plasmid vector further comprises: c. left and right border sequences of T-DNA, wherein the nucleotide sequence of the left border sequence is shown as position 10127 to 10150 of Seq ID No.1, the nucleotide sequence of the right border sequence is shown as position 1 to 25 of Seq ID No.1, and the crRNA expression cassette and the Cpf1 expression cassette are located between the left border sequence and the right border sequence.

4. The backbone plasmid vector of claim 1, wherein the backbone plasmid vector further comprises a hygromycin resistance gene expression cassette.

5. A construction method of a recombinant vector for targeting a rice target gene is characterized by comprising the following steps:

selecting a double-stranded target fragment according to the coding sequence of the target gene, wherein the target fragment is located on the target gene, and one strand of the double-stranded target fragment has 5' TTTN- (N)_X-3' structure, (N)_XOne nucleotide sequence { N ] of X number₁,N₂……N_x}，N₁,N₂……N_xEach represents any one of bases A, G, C, T, and N in TTTN also represents any one of bases A, G, C, T;

integrating the target fragment into the backbone plasmid vector of any one of claims 1-4 to form crRNA bearing the target fragment.

6. The method for constructing a recombinant vector according to claim 5, wherein the method comprises: synthesizing 5' -GGCA- (N) according to the sequence of the target sequence_X-3 ' characteristic forward oligonucleotide strand and having 5 ' -AAAA- (N ')_X-3' characteristic of the reverse oligonucleotide strand, wherein (N) in the forward oligonucleotide strand_XAnd in the reverse oligonucleotide (N')_XHas reverse complementary characteristics; cutting the backbone plasmid vector by BsaI endonuclease, replacing spectinomycin resistance gene with double-stranded nucleotide formed after annealing the forward oligonucleotide chain and the reverse oligonucleotide chain, and screening to form a recombinant vector for targeting the rice target gene through kanamycin forward selection and spectinomycin negative selection.

7. The use of the recombinant vector constructed by the method of claim 6 for rice gene targeting, comprising the steps of,

transferring the recombinant vector into a rice cell to ensure that the cell simultaneously contains crRNA and Cpf1 nuclease aiming at a target gene; under the combined action of crRNA and Cpf1 nuclease, the double-stranded target segment of the target gene is sheared to induce the DNA repair function of the rice cell, and the random insertion and/or random deletion of the target segment in the target gene is realized.

8. The use according to claim 7, wherein the rice cell transformation is transient protoplast transformation or stable Agrobacterium-mediated transformation of the recombinant vector into a rice cell or tissue, and the use is used to obtain rice plants with random insertions and/or random deletions into the target fragment.

9. A method for obtaining a host bacterium, comprising introducing the recombinant vector obtained by the method of claim 5 into a target colony.

Images