CN109022469B - Construction method of yeast expression vector, method for preparing xylanase by using yeast expression vector and application of xylanase - Google Patents

Abstract

The invention discloses a construction method of a yeast expression vector, which comprises the following steps of constructing a pMD-Xyn vector by xylanase gene segments, carrying out enzyme digestion on the pMD-Xyn vector by using restriction enzymes, recycling the xylanase gene segments by glue, carrying out enzyme digestion on a pPICZ alpha A vector by using the restriction enzymes, connecting the xylanase gene segments recycled by the glue with the pPICZ alpha A vector after enzyme digestion, introducing escherichia coli competent cells DH5 alpha, and transforming and constructing the pPICZ alpha A-Xyn vector. The invention constructs a yeast expression vector containing xylanase genes based on that the mushroom bacteria can generate xylanase in the straw fermentation process to effectively degrade the main component xylan of lignocellulose in the straw, and provides theoretical basis and technical support for the commercial production of xylanase and the utilization of ruminant of straw feed.

Description

Construction method of yeast expression vector, method for preparing xylanase by using yeast expression vector and application of xylanase

Technical Field

The invention belongs to the field of enzyme preparation, relates to preparation of xylanase, and particularly relates to a construction method of a yeast expression vector, a method for preparing xylanase by using the yeast expression vector and application of the xylanase.

Background

A large amount of crop straws are produced in the agricultural field of China every year, and rice straws, corn straws and wheat straws are typical representatives. The straws contain a large amount of carbohydrates such as cellulose and hemicellulose, and are important feed sources for ruminants (Zhaoyangmeng et al, component analysis and material report of straws of several crops, 2011 (16): 122-. However, in the production, these straws are not widely used in livestock breeding industry, and most of them are directly burned (Cao, etc., estimation and scientific report of the discharge amount of the open-air burned straws in farmland in China 2007 (15): 1826 and 183) or decomposed and returned to the field, which not only wastes resources, but also seriously pollutes the environment. The reason for this is that lignocellulose in straw is complex in structure and has low rumen digestibility, and although a large amount of microorganisms capable of degrading crude fiber exist in rumen, the degradation rate of straw is still lower than 50%, and if the microorganisms are not used properly, animal feed intake is affected, and the production performance is reduced (Vallejo, L.H., et al.Effect of xylanase consumption on intake, differentiation and nutritional assessment in rambououville sheet. journal of Agricultural Science,2016.154(6): 1110-. In the past, rape straws are treated by acidification, alkalization and the like, but residual acid and alkali can cause damage to animals and pollute the environment (Zhang Wenje and the like, research progress of straw treatment methods, Chinese animal husbandry and veterinarian, 2011 (07): 30-33). Compared with the chemical method, the enzyme preparation capable of degrading cellulose or hemicellulose is green, safe and pollution-free, and the palatability and the utilization rate of the feed can be improved. Xylan is the major component of hemicellulose, and can account for more than 60% of hemicellulose of rice, corn and wheat straws (Sun, R.C., J.Tomkinson. characteristics of hemicellulose expressed by cellulose and cellulose Polymers,2002.50(3): 263-derived Polymers; Kari, K., et al. conversion of rice straw to sugars by cellulose & biomass, 2006.30(3): 247-253; unity, P., et al. conversion and hydrolysis of hemicellulose conversion of hemicellulose, 145 & 145: 50) (patent 2013.50). Therefore, increasing rumen xylan digestibility is often used in production to increase straw utilization by ruminants. Xylanases degrade xylans into soluble sugars, making the addition of xylanases the most common method of enhancing rumen digestion of xylans as well as hemicelluloses. However, despite the many studies, the effect of xylanases in ruminant production is inconsistent from study to study. In some studies, xylanases have been shown to enhance the rate of rumen fermentation and degradation in vitro of straw, corn stover, wheat straw (He Z. X., et al. effectiveness of exogenous microorganisms for enhancing vision in development of utilities. journal of Agricultural Science,2015,153(3): 538) 553), but these effects have not been shown in other studies (Giraldo, L.A., et al. in vision training for achieving flexibility by the microorganism with exogenous fibers S. interference series S. Se A S. III, ens, 263: 263). There are many reasons for this inconsistency, but the origin, activity and usage of xylanase are the most important reasons (Beauchemin, K.A., et al. use of Exogenous fibrous Enzymes to advanced Feed inactivation by Enzymes, 2003.81 (14. sup. 2): E37-E47).

Therefore, the search for xylanase capable of effectively degrading straw in rumen environment is a problem to be solved urgently at present.

Disclosure of Invention

In view of the above, the invention provides a construction method of a yeast expression vector and a method and application for preparing xylanase thereof, a gene sequence for coding the lentinus edodes xylanase is successfully amplified by utilizing a modern molecular technology, the sequence is not completely the same as any reported lentinus edodes xylanase gene sequence through comparison, an expression vector pPICZ alpha A-Xyn capable of expressing the xylanase in vitro of yeast is constructed, the xylanase can be prepared by utilizing the vector and pichia pastoris, and further technical support is provided for the application of the xylanase in production.

In order to achieve the purpose, the invention adopts the following technical scheme:

a construction method of a yeast expression vector, wherein the yeast expression vector contains xylanase genes, and the construction method comprises the following steps:

(1) performing in-vitro amplification by adopting PCR (polymerase chain reaction) to obtain a lentinus edodes xylanase gene fragment, wherein the sequence of the lentinus edodes xylanase gene fragment is SEQ ID NO: 1;

(2) connecting a lentinus edodes xylanase gene fragment with a pMD18-T vector, transforming escherichia coli to construct a recombinant pMD-Xyn vector, wherein the gene sequence of the pMD18-T vector is SEQ ID NO: 3;

(3) carrying out double enzyme digestion on the pMD-Xyn vector by using restriction enzymes EcoR I and Xba I, and recovering xylanase gene fragments by glue;

(4) carrying out double digestion on the pPICZ alpha A vector by using restriction enzymes EcoR I and Xba I;

(5) connecting the xylanase gene segment recovered from the glue in the step 3 with the pPICZ alpha A vector subjected to enzyme digestion in the step 4, introducing an escherichia coli competent cell DH5 alpha, transforming escherichia coli to construct a pPICZ alpha A-Xyn vector, and extracting the pPICZ alpha A-Xyn vector from recombinant escherichia coli by using a plasmid extraction kit, wherein the gene sequence of the pPICZ alpha A-Xyn vector is SEQ ID NO: 2.

the target gene separated or synthesized in vitro is connected with a carrier through recombination by using a recombinant DNA technology, and is introduced into a receptor cell without the gene, so that the receptor cell produces the target gene protein. Based on that the shiitake mushroom fungus can effectively degrade lignocellulose of the straws in the straw fermentation process, a xylanase gene of the straws is extracted, and a yeast expression vector containing the xylanase gene is constructed, so that theoretical basis and technical support are provided for the commercial production of xylanase and the utilization of ruminants of straw feed.

Further, the method of introducing E.coli competent cell DH 5. alpha. in step (5) was heat shock method.

The heat shock method can introduce the recombinant DNA molecules into the escherichia coli receptor cells for replication, proliferation and expression to obtain target genes, and can verify the effect of the escherichia coli competent cells, and the method is simple and easy to operate and has high transformation efficiency.

The invention also provides a method for preparing xylanase by using the yeast expression vector, which comprises the following steps:

(1) extracting the pPICZ alpha A-Xyn vector, and performing linearization by using restriction endonuclease Sac I;

the above linearized system is: 10 XQuickCut buffer 5. mu.L, Sac I1. mu.L, plasmid 8. mu.L, sterile water 36. mu.L, incubation at 37 ℃ for 15 min;

(2) transferring the linearized pPICZ alpha A-Xyn vector into pichia pastoris X33 through an electroporator, and then placing the pichia pastoris X33 into YPD culture medium containing sorbitol and bleomycin for screening to obtain recombinant yeast colonies containing xylanase genes;

the conditions for transferring the yeast into the commercial yeast X33 by the electroporator are as follows: the voltage is 2-2.5 kv; the time is 4-6 ms;

(3) adding the screened recombinant yeast colony containing xylanase gene into BMGY culture medium, performing shake culture at 25-30 ℃ until the bacterial colony is turbid, centrifugally collecting thalli, adding the thalli into BMMY culture medium containing bleomycin, performing culture for 2-3 days, and adding methanol every day to maintain the final concentration of methanol to be 0.5-1.5%;

after the culture is finished, centrifuging the culture solution, filtering the culture solution through a 0.45-micron filter membrane, and then carrying out concentration through a concentration tube and Ni column affinity chromatography to obtain purified xylanase;

the MGY culture medium comprises the following components in parts by weight: 1 part of yeast powder, 2 parts of peptone, 1.34 parts of yeast nitrogen source base and 4 multiplied by 10 parts of biotin ^-51 part of glycerol with the pH value of 6.0; also comprises adding 100mmol sodium phosphate buffer solution into each liter of culture medium;

the BMMY culture medium containing bleomycin comprises the following components in parts by weight: 1 part of yeast powder, 2 parts of peptone, 1.34 parts of yeast nitrogen source base and 4 multiplied by 10 parts of biotin ^-51 part of methanol with pH of 6.0; also comprises adding 100mmol sodium phosphate buffer solution into each liter of culture medium, and adding 12-60 μ g bleomycin into each milliliter of culture medium.

The invention successfully constructs an expression vector pPICZ alpha A-Xyn, has higher enzyme activity when being expressed in pichia pastoris, and the optimum action temperature of the produced xylanase is matched with the temperature environment (39-42 ℃) of rumen, so the xylanase can be used for the production of ruminants. In addition, the xylanase produced by the invention can keep nearly 60% of activity at 80 ℃, has the characteristic of high temperature resistance, can be used for high-temperature granulation of feed, and increases the utilization approach of the xylanase.

The invention also provides a method for improving the rumen utilization rate of crop straws by using xylanase, which comprises the following steps: 500 mug of xylanase prepared according to the claims 5-9 is added in each kilogram of straw feed.

Aiming at the practical problem of low utilization rate of straw feed in ruminant production, the invention clones and expresses xylanase capable of effectively improving straw rumen utilization rate by using modern molecular technology, has high activity and high temperature resistance, and can be used as feed additive for commercial production and application.

Drawings

FIG. 1 is an electrophoretogram of Xyn amplified product of PCR of the present invention;

FIG. 2 is a PCR electrophoretogram of the pMD-Xyn vector of the present invention;

FIG. 3 is a PCR electrophoretogram of pPICZ alpha A-Xyn vector of the present invention;

FIG. 4 is a PCR electrophoretogram of the recombinant yeast of the present invention;

FIG. 5 shows xylanase activity secreted by recombinant yeast of the present invention;

FIG. 6 is a diagram showing the purification, SDS-PAGE and Western blot of the xylanase of the invention;

FIG. 7 is a graph showing the results of temperature dependence of xylanases of the invention;

FIG. 8 is a graph showing the results of pH dependence of xylanases of the invention;

FIG. 9 shows the hydrolysis of crop straw by xylanase of the invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the following examples of the present invention, E.coli competent cell DH5 α was purchased from Tiangen Biochemical technology (Beijing) Ltd. (CB 101-01); the pichia pastoris and the pPICZ alpha A vector are stored in a laboratory; a fungus total RNA extraction and purification kit (SK8655), a DNA gel recovery kit (SK8743), a PCR product purification kit (SK8741) and a plasmid small-scale extraction kit (SK8791) are purchased from bio-engineering, Inc., a cDNA synthesis kit (6210A), T4-DNA ligase (2011A), Premix Taq (Ex Taq Version 2.0) PCR mixed solution (RR003A), restriction enzyme EcoR I (1611), Sac I (1627), Xba I (1634) and pMD 19-T cloning vector kit (6013) are purchased from Dalibao bioengineering.

Example 1

Designing and synthesizing a primer: based on the characteristics of pPICZ. alpha.A vector and the gene sequence of xylanase in NCBI (Lentinula edodes xylanase (xyn11a) mRNA, complete cds, GenBank: AF411252.1, https:// www.ncbi.nlm.nih.gov/nuccore/AF411252.1), primers were designed:

F：CCGGAATTCGTCTTTGACAACTCGAC；

R：GCTCTAGAAAGAGACACTGAGAATAGTACG，

adding restriction enzyme EcoR I and Xba I sites at two ends of the primer respectively during design; the expected size of the amplified xylanase gene fragment is 807bp (containing the enzymatic cleavage site).

Example 2

Extraction of total RNA of the lentinus edodes: taking mushroom fungus growing on a solid culture medium, inoculating the mushroom fungus to a culture dish containing rape straws, taking mushroom hyphae after growing for 20 days, and extracting mushroom total RNA according to the specification of a fungus column type total RNA kit.

The specific method comprises the following steps:

1. mu.L of Buffer rlysis-FG was added to a 1.5ml RNase-free centrifuge tube for use.

2. Grinding 25-50mg of fresh fungal hyphae into powder with liquid nitrogen, adding into the above 1.5ml centrifuge tube, shaking immediately, mixing, and standing at room temperature for 5 min.

3. The supernatant was centrifuged at 12000rpm at 4 ℃ for 3min and transferred to a 1.5ml RNase-free centrifuge tube.

4. 1/2 volumes of absolute ethanol were added and mixed well.

5. Putting the adsorption column into a centrifuge tube, adding all the solution into the adsorption column by a liquid transfer device, standing for 1min, centrifuging for 1min at the room temperature of 12000rpm, and pouring out waste liquid in the collection tube.

6. Placing the adsorption column back into the centrifuge tube, adding 500 μ L GT solution, standing for 1min, centrifuging at room temperature 10000rpm for 1min, and pouring off the waste liquid in the collecting tube.

7. The adsorption column was returned to the centrifuge tube, 500. mu.L of NT solution was added, left to stand for 1min, centrifuged at 10000rpm at room temperature for 1min, and the waste liquid in the collection tube was decanted.

8. The column was returned to the collection tube and centrifuged at 12000rpm for 2min at room temperature.

9. Putting the adsorption column into a centrifugal tube without RNase, adding 30-50 mu of LDEPC-treated ddH2O in the center of an adsorption film, standing for 2min, centrifuging at 12000rpm at room temperature for 2min, and storing the obtained RNA solution at-70 ℃ for subsequent experiments.

Example 3

RT-PCR amplifies xylanase gene, which is carried out by two steps:

1. reverse transcription was performed according to the cDNA synthesis kit: random 6mers 1 μ l, dNTP mix 1 μ l, RNA 8 μ l, after incubation for 5min at 65 ℃, rapidly cooling on solid crushed ice, adding 5. about. PrimeScript Buffer 4 μ l, RNase inhibitor 0.5 μ l, PrimeScript RTase 1 μ l, water 4.5 μ l, then incubating for 45min at 45 ℃, and finally incubating for 15min at 70 ℃;

2. and (3) RT-PCR amplification: reaction system: premix EX Taq 25. mu.l, cDNA 2. mu.l, primers 1. mu.l each, and sterile water 21. mu.l. Circulation parameters: 94 ℃ for 10s, 55 ℃ for 30s and 72 ℃ for 1 min; the cycle is 30 times, the electrophoresis detection result after amplification is shown in figure 1, and the result shows that the band is consistent with the size of the target fragment.

Example 4

Construction of pMD-Xyn vector:

(1) purifying and recovering PCR products by using a glue recovery kit (bio-engineering, Inc., model SK8743) according to the instruction method;

the method comprises the following steps: preparing agarose gel by using TBE buffer solution, and carrying out agarose gel electrophoresis on target DNA; cutting the agarose gel containing the target DNA band under an ultraviolet lamp, and completely absorbing the liquid on the surface of the gel by using a paper towel; cutting the rubber blocks, weighing the weight of the rubber blocks, calculating the volume of the rubber blocks (1 mg ═ 1 mu L), and adding a rubber block melting solution DR-I buffer into the rubber blocks, wherein the adding amount is 3 times of the volume of the rubber blocks; mixing, heating at 75 deg.C to melt the rubber block, and intermittently shaking to melt the rubber block (about 6-10 min); adding DR-II buffer into the glue block melting solution, adding 1/2 with the amount of DR-I buffer, and mixing uniformly. When DNA fragments smaller than 400bp are separated, isopropanol with the final concentration of 20 percent is added into the solution; placing Spin Column in the kit on the Collection Tube; transferring the solution into Spin Column, centrifuging at 3600r/min for 1min, and removing the filtrate; adding 500 mu L of RinseA into Spin Column, centrifuging at 3600r/min for 30s, and removing the filtrate; adding 700 mu L of RinseB into Spin Column, centrifuging at 3600r/min for 30s, and removing the filtrate; repeating the previous step, and centrifuging at 12000r/min for 1 min; placing Spin Column on new centrifuge tube of 1.5mL, adding 25 μ L water cargo eluate in the center of Spin Column membrane, and standing at room temperature for 1 min; centrifuging at 12000r/min for 1min to elute DNA; detecting by agarose gel electrophoresis;

(2) respectively taking 4 mu l of xylanase target fragments recovered from glue, uniformly mixing 5 mu l of connecting buffer solution and 1 mu l of pMD18-T vector, and incubating overnight in a water bath at 16 ℃; adding 10 μ l of the incubation solution into 200 μ l of Escherichia coli competent cell DH5 α, gently mixing, and ice-cooling for 30 min; accurately heating at 42 deg.C for 90s, and ice-cooling for 2 min; adding LB liquid culture medium (1% peptone, 0.5% yeast extract, 1% sodium chloride) 800. mu.l, and culturing at 37 deg.C for 1 h; plating an Amp-containing solid LB medium (1% peptone, 0.5% yeast extract, 1% sodium chloride, 1.5% agar powder) plate, and culturing at 37 ℃ overnight; and (3) selecting white colonies, adding the white colonies into a liquid LB culture medium containing Amp, carrying out overnight culture at 37 ℃, and extracting the recombinant vector plasmid by using a plasmid extraction kit after the culture medium is turbid.

Identification of recombinant cloning vectors: and performing PCR amplification on the extracted recombinant plasmid by using a xylanase primer to identify whether the target fragment is successfully inserted into the pMD18-T vector. The result shows that 807bp of target fragment is amplified from the plasmid transferred with xylanase gene as shown in FIG. 2, which shows that xylanase gene has been successfully transferred into pMD18-T vector.

Example 5

Construction of pPICZ alpha A-Xyn vector: the recombinant pMD-Xyn vector and the pPICZ alpha A vector are subjected to double enzyme digestion by using EcoR I and Xba I restriction enzymes respectively, wherein the enzyme digestion system is as follows: 10 XQuickCut buffer 5 u L, EcoR I1 u L, Xba I1 u L, plasmid 8 u L, sterile water 35 u L, 37 degrees C were incubated for 15 min. Recovering xylanase gene segment from pMD-Xyn vector; purifying the enzyme-digested pPICZ alpha A vector; mu.l of xylanase target fragment, 5. mu.l of T4 ligase and buffer, 1. mu.l of purified pPICZ alpha A carrier are mixed evenly and incubated overnight in water bath at 16 ℃. Coli competent cells DH 5. alpha. were transformed, and positive clones were selected in LB medium containing Amp in the same manner as in example 4. And (3) selecting white colonies, adding the white colonies into a liquid LB culture medium containing Amp, shaking at 37 ℃ for overnight culture, and extracting the pPICZ alpha A-Xyn vector by using a plasmid extraction kit after the culture medium is turbid.

Identification of pPICZ alpha A-Xyn vector: PCR verification was performed (same as in example 4). The result obtained a 807bp band, which is consistent with the target fragment in FIG. 3, indicating that the expression vector was successfully constructed. The pPICZ alpha A-Xyn vector is used as a template, the alpha-factor and 3' AOX primers on the pPICZ alpha A vector are used for PCR amplification and sequencing, and the result shows that the similarity of the amplified xylanase gene and the mRNA of the reference lentinus edodes xylanase reaches 99 percent (see a gene sequence table of a PCR amplification lentinus edodes xylanase gene product), which indicates that the fragment is a gene fragment of the xylanase.

Example 6

Transforming pichia pastoris: carrying out enzyme cutting linearization on the pPICZ alpha A-Xyn vector by using restriction endonuclease Sac I, wherein the enzyme cutting system is as follows: 10 XQuickCut buffer 5. mu.L, Sac I1. mu.L, plasmid 8. mu.L, sterile water 36. mu.L, incubated at 37 ℃ for 15 min. Purifying the enzyme digestion product by using a PCR product purification kit; the linearized pPICZ alpha A-Xyn vector was transferred into Pichia pastoris X33 competent cells using an electroporator, cultured in YPD medium containing bleomycin (1% yeast extract, 2% peptone, 2% glucose), and positive clones were screened using PCR, as shown in FIG. 4.5 white colonies were picked and added to 2ml BMGY medium (1% yeast extract, 2% peptone, 1.34% yeast nitrogen base, 4X 10^-5% biotin, 100mM potassium phosphate buffer pH 6.0, 1% glycerol) in a test tube, shaking overnight at 30 deg.C. Meanwhile, the wild type pichia pastoris X33 strain which is not transferred with the exogenous gene is synchronously cultured as a control. Then 2ml of the culture was centrifuged and the pellet was transferred to a medium containing 10ml BMMY (1% yeast extract, 2% peptone, 1.34% yeast nitrogen base, 4X 10^-5% biotin, 100mM potassium phosphate buffer pH 6.0, 0.5% methanol) in a 100ml conical flask, and incubated overnight at 30 ℃ for 3 days with shaking. Protein expression was induced daily with methanol supplemented to a final concentration of 1%. The cultured bacterial liquid is centrifuged to obtain a culture supernatant. The obtained supernatant was concentrated and buffer-replaced through an ultrafiltration tube.

Screening yeast strains for recombinant xylanase genes: the activity of each concentrated bacterial solution was measured. The reaction system is xylanase concentrated solution, 1 percent xylan and 100mM sodium acetate buffer solution (pH4.5), and the concentration of reducing sugar is measured after shake culture for 1h at 40 ℃. The result shows that the control group has no activity, xylanase activity is detected in 5 tubes of recombinant yeast liquid transferred into the pPICZ alpha A-Xyn carrier treatment group, wherein the concentration of reducing sugar released by the 4# bacterial liquid is the highest, namely the activity is the highest, as shown in figure 5.

Example 7

The selected recombinant strain # 4 was re-inoculated into 25 ml of BMGY medium in a flask and cultured overnight with shaking at 30 ℃ according to the method of example 6. Then, the bacterial liquid was centrifuged, and the precipitate was transferred to a flask containing 100ml of BMMY medium and having a volume of 1 liter, and cultured overnight at 30 ℃ for 3 days with shaking. Protein expression was induced daily with methanol supplemented to a final concentration of 1%. The cultured bacterial liquid is centrifuged to obtain a culture supernatant. The obtained supernatant was concentrated through an ultrafiltration tube. The concentrate was added to a Binding Buffer (containing 0.05M sodium dihydrogenphosphate and 0.3M sodium chloride) at pH 8.0 and subjected to affinity chromatography on a 5ml nickel column and a low pressure chromatography system at a flow rate of 1.0 ml/min. The xylanase bound to the nickel column was first washed with Washing buffer (containing 0.05M imidazole, 0.05M sodium dihydrogen phosphate and 0.3M sodium chloride) at pH 8.0 and finally collected with Elution buffer (containing 0.25M imidazole, 0.05M sodium dihydrogen phosphate and 0.3M sodium chloride) to obtain the purified xylanase.

The molecular weight and purity of xylanase were determined by SDS-PAGE and Western blot on the control concentrated in example 6, the bacterial solution # 4 and the purified solution of example 7, and the results are shown in FIG. 6. The results show that the recombinant xylanase of the invention has two isomers with molecular weights of 59kDa and 44kDa respectively.

Example 8

Characterization of xylanase: the reaction system of xylanase in example 7 and 1% xylan, 100mM sodium acetate buffer (pH4.5) was placed in a water bath at 20-80 deg.C, cultured with shaking for 1h, and the reducing sugar concentration was measured to determine the temperature dependence of xylanase. The results show that xylanase is most active at 40 ℃ and are shown in FIG. 7. When the temperature is increased to 80 ℃, the xylanase can still keep 59 percent of the maximum activity although the activity of the xylanase is reduced, which indicates that the xylanase has high temperature resistance. Similarly, the reaction system is placed in a buffer solution with the pH value of 3.5-8.0, shake culture is carried out for 1h at the temperature of 40 ℃, the concentration of reducing sugar is measured, and the dependence of xylanase on the pH value is determined. The results show that the xylanase of the invention has an optimum pH of 4.0, and the results are shown in FIG. 8.

Example 9

Hydrolysis of crop straws by xylanase: 20mg of rice straw, wheat straw and corn straw were weighed into 9 centrifuge tubes (3 replicates per straw), 2ml of 0.1M sodium hydrogen phosphate buffer containing the recombinant xylanase of example 1 was added, shake-cultured at 40 ℃ for 24h, and the reducing sugar concentration was determined. The control group was not added with xylanase, and the results were shown in FIG. 9, which shows that xylanase increases the concentration of reducing sugar produced by hydrolysis of rice straw, wheat straw, corn straw by 28.9%, 16.2% and 24.3% compared with the control group. The xylanase in the invention can obviously promote the hydrolysis of straws of three crops such as rice straws, wheat straws, corn straws and the like.

Example 10

Influence of xylanase on rumen degradation of crop straws: a120 ml serum bottle of 18 cells was prepared, and 6 cells were filled with 0.5g of rice straw, 6 cells with 0.5g of wheat straw, and 6 cells with 0.5g of corn straw. For each straw, 3 were added with 150-. 60ml of mixed rumen fluid (taken from 3 beef cattle with rumen fistula, the rumen fluid taken out is mixed with buffer solution according to the proportion of 1: 2) is added into each bottle, shaking culture is carried out for 48h at 39 ℃, the fiber degradation rate of the straws and the synthesis amount of VFA and microbial protein in fermentation liquor are analyzed, and the results are recorded as shown in Table 1.

TABLE 1 influence of xylanases on rumen degradation of crop straws

SEM: the mean value is standard error.

The results show that the xylanase in the invention promotes the degradation rate of 3 straw neutral detergent fibers, and increases the generation amount of total volatile fatty acid, the molar ratio of acetic acid and the synthesis amount of microbial protein. The above results show that the xylanase of the invention can be used for rumen degradation of crop straws.

Sequence listing

<110> university of agriculture in Jiangxi

<120> construction method of yeast expression vector, and method for preparing xylanase and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 789

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtctttgaca actcgactga ggtcataggc aaacgaagta tcccgaacgg agaaggaacc 60

aataatggct acttctactc agtttattcc gataccaccg ttacagggac ttacacgaat 120

ggtccaggtg gagaatacac ccttacatgg ggtggatcag gagacgtcgt agtagggaag 180

ggatggaacc caggaggccc gatgtctgtc gagtacagtg gtacttactc ccccaacgga 240

aactcgtatc tttcagtgta cggctggatg acgagtcccc ttgttgagta ttacattact 300

gactctttcg gtgattacaa tcccagcact ggcggaactc acctggggac ttgcacaagt 360

gacggaggag tctacgatat atacacccaa acccgcacga atgcgccgtc aattcaaggg 420

actgccacat tccaacagta ctggtccatc cgccaaactc atcgggtcgg tggcaccgtc 480

accacgggca accactactc ctgctgggag tcagtcggtt tgcctctagg cacgttcaac 540

tacatgatcc tcgcgaccga aggatactct tcaagcggga cctccactat cacggtcggc 600

caaggcactg gaacaggttc atcagctcct tctgggcctt cttcaacgac tactacccct 660

ccgactgctc ctacaggagg aacagtcgct cagtggggtc aatgtggtgg cataggatat 720

tccggcccga caacatgcgc ttctccgtat acatgcactg ttgccaacgc gtactattct 780

cagtgtctc 789

<210> 2

<211> 4327

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420

gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt 540

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900

caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt 960

tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga 1020

agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga 1080

tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa 1140

tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aaagagaggc 1200

tgaagctgaa ttcgtctttg acaactcgac tgaggtcata ggcaaacgaa gtatcccgaa 1260

cggagaagga accaataatg gctacttcta ctcagtttat tccgatacca ccgttacagg 1320

gacttacacg aatggtccag gtggagaata cacccttaca tggggtggat caggagacgt 1380

cgtagtaggg aagggatgga acccaggagg cccgatgtct gtcgagtaca gtggtactta 1440

ctcccccaac ggaaactcgt atctttcagt gtacggctgg atgacgagtc cccttgttga 1500

gtattacatt actgactctt tcggtgatta caatcccagc actggcggaa ctcacctggg 1560

gacttgcaca agtgacggag gagtctacga tatatacacc caaacccgca cgaatgcgcc 1620

gtcaattcaa gggactgcca cattccaaca gtactggtcc atccgccaaa ctcatcgggt 1680

cggtggcacc gtcaccacgg gcaaccacta ctcctgctgg gagtcagtcg gtttgcctct 1740

aggcacgttc aactacatga tcctcgcgac cgaaggatac tcttcaagcg ggacctccac 1800

tatcacggtc ggccaaggca ctggaacagg ttcatcagct ccttctgggc cttcttcaac 1860

gactactacc cctccgactg ctcctacagg aggaacagtc gctcagtggg gtcaatgtgg 1920

tggcatagga tattccggcc cgacaacatg cgcttctccg tatacatgca ctgttgccaa 1980

cgcgtactat tctcagtgtc tctttctaga acaaaaactc atctcagaag aggatctgaa 2040

tagcgccgtc gaccatcatc atcatcatca ttgagtttgt agccttagac atgactgttc 2100

ctcagttcaa gttgggcact tacgagaaga ccggtcttgc tagattctaa tcaagaggat 2160

gtcagaatgc catttgcctg agagatgcag gcttcatttt tgatactttt ttatttgtaa 2220

cctatatagt ataggatttt ttttgtcatt ttgtttcttc tcgtacgagc ttgctcctga 2280

tcagcctatc tcgcagctga tgaatatctt gtggtagggg tttgggaaaa tcattcgagt 2340

ttgatgtttt tcttggtatt tcccactcct cttcagagta cagaagatta agtgagacct 2400

tcgtttgtgc ggatccccca cacaccatag cttcaaaatg tttctactcc ttttttactc 2460

ttccagattt tctcggactc cgcgcatcgc cgtaccactt caaaacaccc aagcacagca 2520

tactaaattt tccctctttc ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg 2580

gaaaagaaaa aagagaccgc ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt 2640

ttatcacgtt tctttttctt gaaatttttt tttttagttt ttttctcttt cagtgacctc 2700

cattgatatt taagttaata aacggtcttc aatttctcaa gtttcagttt catttttctt 2760

gttctattac aacttttttt acttcttgtt cattagaaag aaagcatagc aatctaatct 2820

aaggggcggt gttgacaatt aatcatcggc atagtatatc ggcatagtat aatacgacaa 2880

ggtgaggaac taaaccatgg ccaagttgac cagtgccgtt ccggtgctca ccgcgcgcga 2940

cgtcgccgga gcggtcgagt tctggaccga ccggctcggg ttctcccggg acttcgtgga 3000

ggacgacttc gccggtgtgg tccgggacga cgtgaccctg ttcatcagcg cggtccagga 3060

ccaggtggtg ccggacaaca ccctggcctg ggtgtgggtg cgcggcctgg acgagctgta 3120

cgccgagtgg tcggaggtcg tgtccacgaa cttccgggac gcctccgggc cggccatgac 3180

cgagatcggc gagcagccgt gggggcggga gttcgccctg cgcgacccgg ccggcaactg 3240

cgtgcacttc gtggccgagg agcaggactg acacgtccga cggcggccca cgggtcccag 3300

gcctcggaga tccgtccccc ttttcctttg tcgatatcat gtaattagtt atgtcacgct 3360

tacattcacg ccctcccccc acatccgctc taaccgaaaa ggaaggagtt agacaacctg 3420

aagtctaggt ccctatttat ttttttatag ttatgttagt attaagaacg ttatttatat 3480

ttcaaatttt tctttttttt ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa 3540

ccttgcttga gaaggttttg ggacgctcga aggctttaat ttgcaagctg gagaccaaca 3600

tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt 3660

tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc 3720

gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct 3780

ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg 3840

tggcgctttc tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca 3900

agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact 3960

atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta 4020

acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta 4080

actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct 4140

tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt 4200

tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga 4260

tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca 4320

tgagatc 4327

<210> 3

<211> 2693

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcatgc ctgcaggtcg 420

acgattatct ctagaggatc cccgggtacc gagctcgaat tcgtaatcat ggtcatagct 480

gtttcctgtg tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat 540

aaagtgtaaa gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc 600

actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg 660

cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct 720

gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt 780

atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc 840

caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga 900

gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata 960

ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 1020

cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg 1080

taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 1140

cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 1200

acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 1260

aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaagaacagt 1320

atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg 1380

atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac 1440

gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca 1500

gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac 1560

ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac 1620

ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt 1680

tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt 1740

accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt 1800

atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc 1860

cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa 1920

tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg 1980

tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt 2040

gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc 2100

agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt 2160

aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg 2220

gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac 2280

tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc 2340

gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt 2400

tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg 2460

aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag 2520

catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa 2580

acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat 2640

tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc gtc 2693

Claims (9)

1. A construction method of a yeast expression vector is characterized by comprising the following steps:

(1) performing in-vitro amplification by adopting PCR (polymerase chain reaction) to obtain a lentinus edodes xylanase gene fragment, wherein the sequence of the lentinus edodes xylanase gene fragment is SEQ ID NO: l;

(2) constructing a pMD-Xyn vector by using the lentinus edodes xylanase gene fragment;

(3) carrying out enzyme digestion on the pMD-Xyn vector by using restriction enzyme, and recovering xylanase gene fragments by glue;

(4) utilizing restriction endonuclease to cut the pPICZ alpha A vector;

(5) connecting the xylanase gene segment recovered from the glue in the step 3 with the pPICZ alpha A vector subjected to enzyme digestion in the step 4, introducing an escherichia coli competent cell DH5 alpha, transforming escherichia coli to construct a pPICZ alpha A-Xyn vector, and extracting the pPICZ alpha A-Xyn vector from recombinant escherichia coli by using a plasmid extraction kit;

the pPICZ alpha A-Xyn carrier gene sequence is SEQ ID NO: 2;

the method for constructing the pMD-Xyn vector in the step (2) comprises the following steps: connecting xylanase gene fragments with a pMD18-T vector, transforming escherichia coli to construct a pMD-Xyn vector, wherein the gene sequence of the pMD18-T vector is SEQ ID NO: 3.

2. the method of claim 1, wherein the restriction enzymes are EcoR I and Xba I.

3. The method of claim 1, wherein the E.coli competent cell DH5 α is introduced in step (5) by heat shock.

4. A method for preparing xylanase by using yeast expression vector is characterized by comprising the following steps:

(1) linearizing a pPICZ α A-Xyn vector as claimed in any one of claims 1 to 3 using the restriction enzyme Sac I:

(2) transferring the linearized pPICZ alpha A-Xyn vector into pichia pastoris X33 through an electroporator, and then placing the pichia pastoris X33 into YPD culture medium containing sorbitol and bleomycin for screening to obtain recombinant yeast colonies containing xylanase genes;

(3) adding the recombinant yeast colony containing xylanase gene into BMGY culture medium, performing shake culture at 25-30 ℃ until the bacterial colony is turbid, centrifuging to collect thalli, adding the thalli into BMMY culture medium containing bleomycin, culturing for 2-3 days, and adding methanol every day to maintain the final concentration of methanol to be 0.5-1.5%;

after the culture is finished, the culture solution is centrifuged, filtered by a 0.45 mu m filter membrane, concentrated by a concentration tube and subjected to Ni column affinity chromatography to obtain the purified xylanase.

5. The method for preparing xylanase by using yeast expression vector as claimed in claim 4, wherein the linearized system in step (1) is: 10 XQuickCut buffer 5. mu.L, Sac I1. mu.L, plasmid 8. mu.L, sterile water 36. mu.L, incubated at 37 ℃ for 15 min.

6. The method for preparing xylanase by using yeast expression vector according to claim 4, wherein the conditions for transferring into commercial yeast X33 by electroporator in step (2) are: the voltage is 2-2.5 kv; the time is 4-6 ms.

7. The method for preparing xylanase by using yeast expression vector as claimed in claim 4, wherein the BMGY medium composition in step (3) comprises the following components in parts by weight: 1 part of yeast powder, 2 parts of peptone, 1.34 parts of yeast nitrogen source base and 4 multiplied by 10 parts of biotin^-51 part of glycerol with the pH value of 6.0; also comprises adding 100mmol sodium phosphate buffer solution per liter of culture medium.

8. The method for preparing xylanase by using yeast expression vector as claimed in claim 4, wherein the bleomycin-containing BMMY medium in step (3) comprises the following components in parts by weight: 1 part of yeast powder, 2 parts of peptone, 1.34 parts of yeast nitrogen source base and 4 multiplied by 10 parts of biotin^-51 part of methanol with pH of 6.0; also includes adding 100mmol sodium phosphate buffer solution per liter culture medium, and adding 12-60 μ g bleomycin per liter culture medium.

9. A method for improving the rumen utilization rate of crop straws by using xylanase is characterized by comprising the following steps: adding 500 μ g of xylanase prepared according to any one of claims 4-8 in each gram of straw feed.

Images