CN111454967B - Rape BnMAN7 gene and application thereof - Google Patents

Abstract

The invention provides a rapeBnMAN7Gene and application thereof, belonging to the field of plant genetic engineering and biotechnology; the rapeBnMAN7The gene is related to the dehiscence character of the pod, the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the rape pod dehiscence resistance related gene obtained by cloning in the inventionBnMAN7The inhibition of the expression of the gene can enhance the pod crack resistance and provide a new breeding material for further cultivating a new variety of rape with pod crack resistance; further constructed pHellsgate12-BnMAN7Obtained by transforming rape with recombinant vectorBnMAN7Suppression of expression lines, for the studyBnMAN7The gene provides raw materials for the research on the pod shatter resistance of rape, provides theoretical guidance for the crop pod shatter resistance breeding, and is beneficial to cultivating new species which are easy to be harvested mechanically and have high yield.

Description

RapeBnMAN7Gene and application thereof

Technical Field

The invention relates to a rapeBnMAN7Genes and application thereof, belonging to the field of plant genetic engineering and biotechnology.

Background

The yield of the cabbage type rape seeds is high, and the cabbage type rape seeds are mainly planted in the middle and lower reaches of Yangtze river in China, are one of the most widely planted oil crops in China and account for about 20% of the world yield. However, because the mechanization degree of rape production in China is not high and the production cost is high, domestic consumption requirements cannot be met, and a large amount of oil consumption still depends on import. Therefore, the method improves the rape production efficiency and increases the rape yield, and is an important target for rape research in China.

Dehiscence of the siliques can cause a large amount of seeds to fall off before harvesting, so that the yield is greatly reduced, meanwhile, the fallen seeds generate a large amount of self-growing seedlings, when the conditions of water, fertilizer, gas, heat and the like are suitable, the seedlings are sown earlier than the rape in the current year to emerge, the space is strived for and the nutrients in the soil are consumed, and the dehiscent siliques are not beneficial to mechanical harvesting. Compared with other crops, the rape pod is easy to crack, the yield loss caused by cracking reaches about 20 percent, and the yield loss can even reach 50 percent under adverse climatic conditions. Dehiscence of the siliques not only causes loss of yield but also is not conducive to mechanical harvesting of the rape. Pod resistance characteristics of the brassica napus are not greatly changed, no pod resistance variety exists at present, and although pod resistance characteristics exist in other related species, interspecific hybridization hardly removes the influence of poor agronomic characteristics.

Cellulases and hemicellulases are a class of hydrolases involved in processes associated with abscission and dehiscence in plants. Cellulases have many tissue-specific expression patterns in plants that are associated with developmental processes, such as tissue expansion, fruit ripening, or organ abscission; hemicellulase mainly comprises enzymes such as xylanase, glucanase, mannase and the like, and can decompose hemicellulose into small molecular polysaccharides or monosaccharides.

At present, researches on the aspects of rape pod shattering resistance are few at home and abroad, and a related gene participating in pod shattering in rape needs to be searched urgently, in order to solve the problems, the related gene for regulating and controlling the pod shattering of the rape is searched and the function of the related gene is researched, so that the related gene is the basis for cultivating mechanized harvest varieties and is also the main target of molecular breeding.

Disclosure of Invention

The invention aims to solve one of the technical problems, and therefore, the invention provides the rapeBnMAN7Genes and their use.

The invention firstly provides an application of rape BnMAN7 gene in enhancing pod shatter resistance of rape, wherein the nucleotide sequence of the rape BnMAN7 gene is shown as SEQ ID NO. 1; the protein amino acid sequence coded by the rape BnMAN7 gene is shown as SEQ ID NO. 2.

Specifically, byBnMAN7Silencing or inhibiting expression of genes to improve craze resistance of oilseed rape pods, particularly by targetingBnMAN7Silencing or inhibiting expression of a specific sequence fragment (the nucleotide sequence of which is shown as SEQ ID NO. 9) of the gene improves the cracking resistance of the rape pod.

The invention provides a recombinant expression vector, which containsBnMAN7A section of specific sequence in the gene, the nucleotide sequence of which is shown as SEQ ID NO. 9; the specific preparation method of the recombinant vector comprises the following steps: will be provided withBnMAN7Cloning of the specific sequence into the portal vectorBnMAN7-pENTR, and entry vectorBnMAN7-pENTR is mixed with the target vectors pHellsgate12 and Gateway ™ LR clone ™ enzyme to obtain a mixtureBnMAN7Inhibition of recombinant expression vector pHellsgate12- BnMAN7。

The invention also provides application of the recombinant vector in improving the pod shatter resistance of rape.

The invention also provides a transformant, which is a recombinant vector pHellsgate12-BnMAN7Transforming host bacteria to obtain; the host bacterium is agrobacterium GV3101.

The invention also provides a method for improving the pod cracking resistance of rape, which specifically comprises the following steps:

the rape is treatedBnMAN7Connecting the gene to an expression vector to construct a recombinant expression vector; transforming the recombinant vector into microorganisms for culture expression, and then carrying out dip dyeing on the rape by using an hypocotyl transformation method on the obtained transformant; the microorganism is agrobacterium GV3101.

The invention has the advantages that:

(1) The gene adopted by the invention is obtained by cloning in a rape cDNA library, and the method has high reliability, high speed and high efficiency on obtaining the target gene.

(2) The invention adopts the agrobacterium-mediated hypocotyl transformation method to transform the rape, the agrobacterium is used as a natural vector system, the success rate is high, and the mechanism of the system is most clearly researched. In the invention, the selected hypocotyl has strong regeneration capability and is easy to be infected by agrobacterium, and the method has high transformation efficiency and high speed.

(3) Rape pod crack resistance related gene cloned in the inventionBnMAN7The inhibition of the expression of the gene can enhance the pod crack resistance, and provides a new breeding material for further breeding new varieties of rape with pod crack resistance.

(4) Genes related to the present inventionBnMAN7The application of the method in improving the pod cracking resistance has important guiding and reference significance for the production and breeding of plants which are easy to crack like pods of rape and soybean. pHellsgate 12-containing protein constructed by the inventionBnMAN7Obtained by transforming rape with recombinant vectorBnMAN7Suppression of expression lines, for the studyBnMAN7The gene provides raw materials for the research on the pod shatter resistance of rape, provides theoretical guidance for the crop pod shatter resistance breeding, and is beneficial to cultivating new species which are easy to be harvested mechanically and have high yield.

Drawings

Fig. 1 shows conserved domain features of BnMAN7 protein.

FIG. 2 isBnMAN7The comparison result with the amino acid sequence of homologous protein of other species, wherein A is the protein sequence of Brassica napus, B is the protein sequence of Brassica napus, C is the protein sequence of radish, D is the protein sequence of Garlic mustard, E is the protein sequence of Arabidopsis thaliana, and F is the geneBnMAN7The protein sequence of (a); the black areas in the figure show identical amino acids and the grey areas show similar amino acids.

FIG. 3 is a schematic view ofBnMAN7Analyzing the expression pattern of gene tissue.

FIG. 4 shows the plant transformation recombinant expression vector pHellsgate12-BnMAN7Schematic diagram of the structure of the T-DNA insertion region of (1).

FIG. 5 shows a schematic representation of a rape plantBnMAN7The PCR identification result of the gene suppression expression strain, wherein M is DL2000 DNA Marker and + is positive control; #1, #2, #3, #4 are independent transformation lines, H ₂ O is blank control, WT is negative control.

FIG. 6 shows the qPCR detection of gene suppression expression strains and wild-type strainsBnMAN7Comparison of expression levels; wild type controls were included; #1, #2, #34 is an independent transformation line.

FIG. 7 is a drawing showingBnMAN7Prokaryotic expression vector pGEX-4T-1-BnMAN7Schematic representation.

FIG. 8 is a drawing showingBnMAN7And (5) detecting the activity of the hemicellulase.

FIG. 9 shows the wild type andBnMAN7the test results of the tensile strength of the silique of the positive transformation plants are shown as #2 and #3BnMAN7And (5) positively transforming plants.

Detailed Description

The technical solution of the present invention is further described with reference to the following examples and drawings, but the examples are for better explaining the present invention and are not to be construed as limiting the present invention.

The reagents or materials referred to in the present invention are, unless otherwise specified, commercially available.

Example 1.BnMAN7Obtaining of genes

According to the hemicellulase gene of Arabidopsis thalianaMANNANASE7The information (nucleotide sequence is shown as SEQ ID NO.20, the accession number of the GENEBANK database is BT008749.1, the amino acid sequence is shown as SEQ ID NO.21, the accession number of the GENEBANK database is AAP 49511.1), the rape gene is screened in the database, and finally BnaA07g12590D (nucleotide sequence is shown as SEQ ID NO. 1) is confirmed as a research object, the gene is further cloned from the No.11 of the cabbage type rape (seeds are purchased from oil science and technology Limited company in Wuhan province), the function of the gene is researched, the cloned gene is named asBnMAN7The method comprises the following specific steps:

(1) Plant material cultivation:

the double No.11 plants in the cabbage type rape (seeds are purchased from oil planting science and technology limited in Wuhan, and planted in the laboratory) are used as experimental materials, and the growth conditions are as follows: temperature of 20 deg.C+2 ℃; humidity is 60-90%; the light cycle is 8h of illumination and 16h of darkness every day; the illumination intensity is 44 mu mol m ^-2 s ^-1 。

(2) Extraction of rape total RNA and cDNA Synthesis:

extracting the total RNA of the rape by a Trizol reagent quick extraction method: freezing a small amount of sample in a mortar by using liquid nitrogen, quickly grinding the sample into powder, adding the powder into a 1.5mL EP tube precooled on ice containing 1mL Trizol, fully shaking and uniformly mixing the powder, and centrifuging the mixture at the temperature of 4 ℃ and the speed of 12,000rpm for 10min; taking about 800 mu L of supernatant, placing in a new EP tube with precooling capacity of 1.5mL, adding 300 mu L of chloroform, after violent shaking, placing at room temperature for 3min, and then centrifuging at 4 ℃ and 12,000rpm for 10min; about 300. Mu.L of the supernatant was put into a new 1.5mL EP tube, added with an equal volume of isopropanol and shaken gently to precipitate RNA sufficiently, and centrifuged at 12000rpm for 10min at 4 ℃; discarding the supernatant, adding 800 μ L75% ethanol, washing thoroughly, centrifuging at 12,000rpm at 4 deg.C for 5min; discarding the supernatant, drying the precipitate, and adding 50 μ L DEPC water to dissolve the precipitate; finally, the integrity of the total RNA was checked by electrophoresis on a 1% agarose gel and the RNA content was determined on a spectrophotometer. And stored at-70 ℃ until use.

The cDNA synthesis is performed by taking total RNA as a template according to Hiscript ^® The instructions of QRT SuperMix reverse transcription kit (purchased from tokyo kezan biotechnology limited) were used for reverse transcription experiments: firstly, removing genome DNA, and preparing the following mixed solution in a centrifuge tube for removing RNase: about 500ng of template RNA,4 XgDNA wiper Mix 2. Mu.L, and RNase free ddH ₂ And O to the total volume of 8 mu L, gently sucking and beating the mixture by using a pipette, and uniformly mixing the mixture at 42 ℃ for 2min, wherein the first step of reaction is finished. Then, a reverse transcription system is prepared, 2 mu L of 5 xqRT SuperMix II is added into the reaction tube of the first step reaction, and the mixture is gently pipetted and uniformly mixed. Then, reverse transcription reaction was performed at 25 ℃ for 10min, followed by reaction at 50 ℃ for 30min and reaction at 85 ℃ for 5min. The reaction product selects the cabbage type rape reference geneActin(GenBank: AF 111812.1) as an internal reference for identificationActinThe primer sequence is as follows:

Actin-F(SEQ ID NO.3)：5’- TGTTGCTATCCAGGCTGTTCTTTC-3’

Actin-R(SEQ ID NO.4)：5’- GATAGCGTGAGGAAGAGCATAACC-3’，

the cDNA sample of the reference gene (127 bp from gene to gene) can be amplified by PCR identification and stored at-20 ℃ for later use.

(3) Cloning of BnMAN7 gene cDNA sequence:

according toBnaA07g12590D Designing a primer for cloning, wherein the amplification sequences are respectively as follows:

Man7-F(SEQ ID NO.5) ：5’- ATGAAGCCTCTGTGTCTGGTTA-3’

Man7-R(SEQ ID NO.6) ：5’- TCAGTTTAGACCTCCTTTTCTTAC-3’

using cDNA of No.11 in Brassica napus as a template, amplifying a target fragment by using high fidelity polymerase KOD-Plus-Neo (Toyo textile (Shanghai) Biotech Co., ltd.) according to the following reaction conditions: at 94 ℃ for 2min, at 35 cycles (98 ℃,10s, 59 ℃,30s, 68 ℃,35 s) and at 68 ℃ for 10min, amplifiedBnMAN7Gene coding sequence, electrophoresis gel running of 1% agarose gel, identification of target fragment amplification result, target product size of 1281bp, and recovery kit E, Z, N, A with gel. ^® The Gel Extraction Kit (available from Omega Bio-Tek) recovered the PCR product, and the recovered product was ligated to pMD19-T vector (available from Baori doctor technology, beijing, ltd.) in the following manner: 4.5 mu L of target fragment, 0.5 mu L of pMD-19T vector and 5 mu L of Solution I (Bao bioengineering (Dalian) Co., ltd.) were ligated at 16 ℃ overnight to construct a plasmidBnMAN7pMD19-T vector. Then transforming into Escherichia coli DH5 alpha competent cell (purchased from Nanjing Nuojingzan biotechnology limited), selecting bacteria, carrying out PCR identification of bacteria liquid, sending positive clone to bioengineering (Shanghai) member limited company for sequencing, obtaining target gene by sequencing, and naming or recording asBnMAN7The nucleotide sequence of the protein is shown as SEQ ID NO.1, the encoded protein is shown as SEQ ID NO. 2.

(4) BnMAN7 gene sequence structure domain and homology analysis thereof:

the sequence has an open reading frame length of 1281bp through sequencing, 426 amino acids are coded, the CDD database of NCBI is used for predicting the conserved structural domain characteristics of the protein, and the result shows that the protein belongs to glycosyl hydrolase superfamily (figure 1).

The prediction of the software WoLFPSORT shows that BnMAN7 is positioned outside cells and is closely related to the function of the BnMAN7 secreted outside the cells to trigger the degradation of cell walls.

Analysis by PROTSCALE software shows that BnMAN7 has hydrophilicity of-0.392 and instability index of 38.59, which indicates that BnMAN7 is a relatively stable hydrophilic protein.

The TMPRED analysis predicted BnMAN7 to have 3 transmembrane domains and the signalalp analysis showed it to have a signal peptide, which was predicted to be a secreted protein.

Alignment of various amino acid sequences using Mega5.1 software revealed that the sequences were homologous to 5 other hemicellulases at the amino acid level, as shown in FIG. 2, in which A, B, C, D, E are at the Gene Bank accession numbers and names: a represents a protein sequence of cabbage type rape (XP _ 013653747.1), B represents a protein sequence of cabbage type rape (XP _ 009103527.1), C represents a protein sequence of radish (XP _ 018441000.1), D represents a protein sequence of allium sativum lindl (ARH 02326.1), E represents a protein sequence of arabidopsis thaliana (NP _ 201447.1), and F represents a protein sequence of a gene BnMAN7 in the figure. The black regions show the same amino acids and the grey regions show similar amino acids, where A has 97.65% homology to F, B has 98.36% homology to F, C has 95.58% homology to F, and D has 93.46% homology to F. E has 88.97% homology to F. Show that the invention relates toBnMAN7The gene may have a function or characteristic of a hemicellulase.

Example 2.BnMAN7Analysis of tissue-specific expression patterns of genes

To explore the geneBnMAN7Differential expression in various tissues of the brassica napus is detected by adopting a q-PCR technologyBnMAN7Expression patterns in cabbage type rape roots, stems, stem tips, leaves, flowers, flower buds, young siliques (15 days after flowering), mature siliques (50 days after flowering). The plant material used in this example was canola 11, each tissue material was collected and immediately frozen with liquid nitrogen and stored in an ultra-low temperature freezer at-70 ℃ for future use. RNA from various tissues of Brassica napus was obtained and cDNA was synthesized according to the method described in example 1.

In thatBnMAN7Designing a real-time fluorescent quantitative PCR primer in a non-conserved region of a gene sequence, wherein the primer sequence is as follows:

qman7-F（SEQ ID NO.7）：5’- AGACTCGAACGAGCAATCCC -3’

qman7-R（SEQ ID NO.8）：5’- CGCAGACTCGTAAATCTTGCC -3’

the cabbage type rape Actin gene is used as an internal reference gene, the reverse transcription first strand cDNA is used as a template, and the specific operation method is carried out according to AceQ QpcrSYBR Green Master Mix kit instructions. The fluorescent quantitative reaction system was 20. Mu.L, and the reaction mixture was prepared in a 1.5mL EP tube, and then dispensed into the PCR reaction Tubes Strip Tubes, and finally the template (i.e., cDNA of each tissue) was added. qPCR reaction system: 2 x SYBR Premix Ex Taq II 10 μ L,2 μ M qman 7-F2 μ L,2 μ M qman 7-R2 μ L, ROX Reference Dye I0.4 μ L, double distilled water 3.6 μ L, template 2 μ L. Reaction conditions are as follows: 95 ℃ for 5min; then, the temperature is 95 ℃ for 10s, the temperature is 56 ℃ for 30s, and 40 cycles are carried out; 15s at 95 ℃; 1min at 60 ℃;95 ℃ for 10s. The cDNA of each sample was diluted 10-fold as template, 3 replicates per sample, and 3 biological replicates per set of experiments. Experimental data utilization 2 ^－△△CT The method is used for analysis, the relative expression quantity of the gene is calculated, and graph pad Prism software is used for mapping.

FIG. 3 is a drawing showingBnMAN7The results of the analysis of the expression pattern of the gene tissue, in whichBnMAN7Differential expression in various tissues and organs of rape, and the expression level in rape roots is used as a control group. FIG. 3 was analyzed by T-test, where p is denoted<0.05, represents p<0.01, represents p<0.001 denotes p<0.0001. As can be seen from the figures, it is,BnMAN7the expression is carried out in different tissues and organs of rape, the expression in the young siliques is higher than that in the mature siliques,BnMAN7the expression level in the flower is highest, which is about 7 times of the expression level in the root, and the result is that the flower is subsequently expressedBnMAN7Provides a theoretical basis for the research.

Example 3 inhibitionBnMAN7Acquisition of Gene-expressed transgenic oilseed rape plants

(1) Suppression ofBnMAN7Construction of expressed RNAi vectors:

constructed as in step (3) of example 1BnMAN7amplifying-pMD 19-T recombinant plasmid as templateBnMAN7158bp specific fragment on the gene, which is a non-conservative fragment of the gene, and the interference of the sequence of the fragment can cause the gene to be silent and lose the function,the specific nucleotide sequence of the fragment is shown as SEQ ID NO.9, and specifically comprises the following steps:

ATGAAGCCTCTGTGTCTGGTTACAATCCTATCGATCCTGATCCAACAAAGCTATTTGAAGCTCGGAGCAGATGCGTTTTCGAGAGATGGGTTCGTGAGAACGAAAGGTGTTCAGTTTAGCCTCAATGGCTATCCTTATTACGCTAATGGCTTCAATGC

the primer sequences used for amplification are respectively:

Iman7-F（SEQ ID NO.10）：5’- CACCATGAAGCCTCTGTGTCTGGTTA-3’

Iman7-R（SEQ ID NO.11）：5’- GCATTGAAGCCATTAGCGTA-3’

the primers were synthesized by Shanghai Biotech.

Amplification was performed using the high fidelity enzyme KOD-Plus-Neo (available from Toyo Boseki Biotech Ltd.) in the reaction system: 10 XPCR Buffer for KOD-Plus-Neo 5. Mu.L, 2mMdNTP 5. Mu.L, 25mM MgSO ₄ 3 µL，10 µM IMan7-F 1.5 µL，10µM IMan7-R 1.5µL，BnMAN70.5 muL of pMD19-T recombinant plasmid, 1 muL of KOD-Plus-Neo (1.0U/muL), and 32.5 muL of double-distilled water.

The reaction procedure is as follows:

94 ℃ for 2min,35 cycles (98 ℃,10s, 57 ℃,30s, 68 ℃,10 s), 68 ℃ for 10min.

The PCR product is subjected to agarose gel electrophoresis, and the target band is recovered from the gel and the concentration of the target band is determined.

Then according to pENTR ^TM /D-TOPO ^TM The Cloning Kit instructions, in a molar ratio of 2 ^TM /D-TOPO ^TM The amount of the target fragment and pENTR vector added into the system is accurately calculated by the vector carried in the Cloning Kit so as to ensure the highest connection efficiency.

The linking system is as follows: fragments of interest, i.e. amplifiedBnMAN71.5. Mu.L of 158bp specific fragment (150 ng/. Mu.L), 0.5. Mu.L of Salt solution, 1. Mu.L of pENTR vector (15-20 ng/. Mu.L) on the gene, the system was ligated at 22 ℃ for 2 hours, the reaction system was transformed into E.coli DH 5. Alpha. Competence, cultured overnight at 37 ℃, single clones were picked for amplification culture, and then picked up with primers Iman7-F and Iman7-RAnd (4) carrying out PCR identification on the obtained monoclonal antibody, and sequencing the positive clone.

Amplifying and culturing the positive clone with correct sequencing result to extract plasmid to obtain entry vectorBnMAN7-pENTR. The vector was introduced into the door according to the instructions of the Gateway LR clone TM II Enzyme Mix kitBnMAN7-pENTR will be used in an amount equal to that of expression vector pHellsgate12 (from Australian CSIRO: http:// www. Pi. CSIRO. Au/rnai/vectors. Htm)BnMAN7From entry carrierBnMAN7-substitution in pENTR to the final expression vector pHellsgate12.

The reaction system is 10 μ L:BnMAN70.5. Mu.L of pENTR vector plasmid (130 ng/. Mu.L), 0.5. Mu.L of pHellsgate12 vector (150 ng/. Mu.L), 2. Mu.L of LR Mix enzyme, and 7. Mu.L of TE buffer (pH 8.0), ligating the system at 25 ℃ for 3h, adding 1. Mu.L of protein kinase K at 37 ℃ for reaction for 10min, transforming E.coli DH 5. Alpha. Competence, picking single clone for expansion culture, and performing PCR identification.

In order to ensure the accuracy of the identification result, 2 identification methods are adopted in the identification process, and 2 pairs of identification primers respectively comprise:

Iman7-R（SEQ ID NO.11）：5’- GCATTGAAGCCATTAGCGTA-3’

pH12-12517F（SEQ ID NO.12）：5’-CTAACAGAACTCGCCGTGAAGACT-3’

and Iman7-R (SEQ ID NO. 11): 5' GCATTGAAGCCATAGCTAGCGTA-3

pH12-17618R（SEQ ID NO.13）：5’-CTGCTGAGCCTCGACATG-3’

The PCR system was identified as follows:

the reaction system of pH12-12517F and Iman7-R is as follows: 2 XPremix Taq 10 mu L,10 mu M pH12-12517F 0.5 mu L, iman 7-R0.5 mu L, monoclonal bacteria liquid 2 mu L, and double distilled water 7 mu L.

Iman7-R and pH12-17618R reaction system: 2 XPremix Taq 10 muL, 10 muM PH12-17618R 0.5 muL, 10 muM Iman 7-R0.5 muL, monoclonal bacteria liquid 2 muL, double distilled water 7 muL.

The reaction procedure was as follows:

94 ℃ C, 3min,28 cycles (94 ℃,30s, 55 ℃,30s, 72 ℃,1 min), 72 ℃ C, 10min.

The PCR amplification result shows that the size of the target band obtained by the amplification of the primers of pH12-12517F and Iman7-R is 712bp, and the size of the target band obtained by the amplification of the primers of Iman7-R and pH12-17618R is 918bp. The 2 bands are all fragments containing 158bp, and the 2 fragments contained in the obtained product simultaneously indicate that the replacement is successful.

Carrying out amplification culture on the positive clones identified correctly and improving plasmids, then transforming the plasmids into agrobacterium GV3101 competent cells (purchased from Shanghai Weidi organism Co., ltd.), carrying out bacteria liquid PCR identification on the picked single colonies by using primers of pH12-12517F, pH12-17618R and Iman7-R, carrying out amplification culture on the positive clones identified correctly, and then storing the positive clones in an ultra-low temperature refrigerator at-70 ℃ to finally obtain the bacillus subtilisBnMAN7Inhibition of expression vector pHellsgate12- BnMAN7The T-DNA region of the vector is shown in FIG. 4.

(2) Recombinant plasmid pHellsgate12- BnMAN7The genetic transformation of the rape is as follows:

seed disinfection and sowing: selecting seeds of No.11 rape in the brassica napus, and removing mildewed, broken seeds, bacteria-carrying seeds and impurities; soaking seeds in 75% alcohol for 10s, pouring off alcohol, washing with sterile water for 4-5 times, adding bleaching agent with effective chlorine content of 15%, and sterilizing for 7min; and (4) washing the seeds with sterile water until the seeds are washed clean by disinfectant, otherwise, the germination activity of the seeds is influenced. Sowing the sterilized seeds on a sowing culture medium M0 (containing MS and sucrose), sowing 15-20 seeds in each bottle, then placing the bottles in a sterile culture room, and carrying out dark culture at 25 ℃ for 5-6 days.

Wherein the M0 seeding culture medium is prepared as follows: 1L of seeding medium M0 comprises: 2.21 MS powder (containing organic components, available from Duchefa Biochemie company), agar powder 8g, sucrose 20g, pH 5.8,121 deg.C, 15min for sterilization, and packaging into sterilized bottles.

Activating and preparing agrobacterium: the preserved agrobacterium GV3101 containing recombinant plasmid is selected to streak and activate on a plate, cultured for 2 days at 28 ℃, then a positive single colony is selected to be inoculated into 3-5mL LB liquid culture medium (prepared according to a conventional formula) containing corresponding antibiotics (50 mg/L rifampicin, 50mg/L gentamicin and 100mg/L spectinomycin), and shake culture is carried out at 28 ℃ and 220r/min for 36-48 h. Then inoculating the strain into 100mL LB liquid culture medium containing corresponding antibiotics according to the inoculation amount of 1 percent until the final concentration OD600 value of the strain liquid is about 0.8. Sucking the cultured bacteria liquid into 2mL of a centrifuge tube, centrifuging for 5-10min at 5,000r/min, pouring out the supernatant, re-suspending with an equal volume of an agrobacterium suspension culture medium DM (containing MS and sucrose), centrifuging, discarding the supernatant, re-suspending with the same volume of DM, and diluting 2mL of the bacteria liquid with 18mL of DM culture medium to serve as a staining solution for later use.

Wherein, the preparation of the strain suspension culture medium DM is as follows: the 1L DM includes: 4.42g of MS powder and 30g of cane sugar, and the pH value is adjusted to 5.8. Sterilizing at 121 deg.C for 15min, cooling to room temperature, and adding 1ml AS (acetosyringone) with concentration of 100 mmol/L.

Preparing and dip-dyeing explants: cutting 5-6 sections of seedling hypocotyls by using tweezers and a dissection knife, wherein the length is about 0.8-1cm, obliquely cutting the explants at 45 degrees as much as possible when cutting the explants (increasing wound area of the hypocotyls, increasing contact area of bacterial liquid and the hypocotyls, and facilitating infection), and shaking the cut explants 4-6 times in a liquid basic culture medium M1 (the cutting effect is better, so that the explants can keep activity and are beneficial to infection) after being placed in prepared staining solution, and the explants are infected for 20min (the time cannot be long, otherwise the explants are easy to die), wherein the staining is proper to be carried out by 80-100 explants per dish per 20mL of bacterial liquid.

After the completion of the dip dyeing, the bacterial liquid was removed as much as possible by using sterile filter paper, and the hypocotyls were transferred to a solid basal medium (containing MS, sucrose, mannitol, agar powder, hormone 2,4-D and kinetin) 20 per dish and cultured in the dark at 25 ℃ for 2 days. Transferring to a screening medium M2 (containing Kan antibiotic with a final concentration of 50mg/L in addition to the basic medium components) after 2 days, and culturing at 25 deg.C by illumination (16 h/8 h in day/night); transferring to budding culture medium M3 (containing main components of MS, glucose, xylose and ethanesulfonic acid) after 3 weeks, and subculturing every 2-3 weeks until green buds grow; transferring into rooting medium M4 (the main components comprise B5 medium and sucrose) for rooting, and culturing in low-temperature vernalization incubator for 2-4 weeks (the temperature is less than or equal to 4 deg.C, the humidity is 60-90%, the light cycle is 16h and 8h in dark every day, and the light intensity is 150 μmol M ^-2 s ^-1 . ) (ii) a Vernalization completionThen transplanting to a nutrition pot, putting into a phytotron for culturing until harvesting; wherein the temperature of the artificial climate chamber is 20 +/-2 ℃, the humidity is 60-90%, the light cycle is 16h and 8h of darkness per day, and the light intensity is 150 mu mol m ^-2 s ^-1 。

Wherein, 1L of liquid culture medium M1 is prepared: 4.42g MS powder, 30g sucrose, 18g mannitol, pH value adjusted to 5.8,121 ℃, after 15min sterilization, 1ml 2,4-D with concentration of 1mg/ml, 1ml KT (kinetin) with concentration of 0.3mg/ml and 1ml AS (acetosyringone) with concentration of 100mmol/L are added.

1L of solid basal medium is prepared: 4.42g MS powder, 30g sucrose, 18g mannitol, 8g agar powder, adjusting pH value to 5.8, sterilizing at 121 deg.C for 15min, adding 1ml biological 2,4-D with concentration of 1mg/ml and 1ml KT (kinetin) with concentration of 0.3 mg/ml.

Preparation of 1L screening medium M2: 4.42g MS powder, 30g sucrose, 18g mannitol, 8g agarose, adjusting pH to 5.8,121 ℃, after 15min sterilization, adding 1.5mL STS, 1mL Timentin (concentration is 300mg/mL Timentin), 1mL Kan (concentration is 50mg/mL kanamycin); wherein the Silver Thiosulfate (STS) is prepared by mixing 0.1M AgNO according to a volume ratio of 1 ₃ Dissolved in 0.1M sodium thiosulfate. The reagent should be prepared immediately before use, and precipitate will be generated after a long time.

Preparing 1L of germination medium M3: 4.42g MS powder, 10g glucose, 8g agarose, 0.25g xylose, 0.6g MES (ethane sulfonic acid), pH adjusted to 5.8,121 ℃,15min after sterilization, 1mL ZT (trans-zeatin with a concentration of 0.5 mg/mL), 1mL IAA (indoleacetic acid with a concentration of 0.5 mg/mL), 1mL Timentin (Timentin with a concentration of 300 mg/mL), 1mL kan (kanamycin with a concentration of 50 mg/mL) were added.

1L rooting medium M4 preparation: 3.86g of B5 medium (purchased conventionally), 20g of sucrose and 6g of agar powder, adjusting the pH value to 6, sterilizing at 121 ℃ for 15min, and adding 166 mu L of timentin with the concentration of 300 mg/ml.

(3) Suppression ofBnMAN7PCR identification of gene-expressed transformed rape plants:

the numbers of 4 transformed rapes obtained are respectively numbered from #1 to #4, wild type and #1 to #4 genomes are extracted, and whether the transformation is successful is identified by adopting a PCR technology. The primer sequence used for identification is designed according to a section of sequence (known published sequence) of kanamycin inherent on the recombinant expression vector pHellsgate12, and specifically comprises the following steps:

Kan-F（SEQ ID NO.14）：5’-ATTCGGCTATGACTGGGC-3’

Kan-R（SEQ ID NO.15）：5’- CAAGAAGGCGATAGAAGGCG-3’

the positive control is the carrier plasmid pHellsgate12 containing the specific target fragment of 158bp BnMAN7WT as negative control, and H as blank control ₂ O。

The system and reaction procedure for PCR amplification are as follows:

an amplification system: 2 XPremix Taq 10 μ L,10 μ M Kan-F1 μ L, kan-R1 μ L, genome 1 μ L, double distilled water 7 μ L.

Reaction procedure: 94 ℃ 3min,34 cycles (94 ℃,30s, 60 ℃,30s, 72 ℃,45 s), 72 ℃ 10min.

FIG. 5 shows a schematic representation of a rape plantBnMAN7The PCR identification result of the gene suppression expression strain, wherein M is DL2000 DNA Marker, and + is positive control; #1, #2, #3, #4 are independent transformation lines, H ₂ O is blank control, WT is negative control. The detection result shows that the #1, #2, #3, #4 and the positive control in the embodiment can amplify the target band; and the negative control and the blank control have no electrophoresis band, the amplified band is recovered and sent to be sequenced, and the sequencing result is consistent with the sequence of the target fragment, which indicates that the transgenic rape genome already contains the target gene fragment.

(4) In transgenic plantsBnMAN7Detection of relative expression amount

Leaves of wild plants and transgenic plants #1, #2, #3 and #4 were respectively temporarily stored in liquid nitrogen and stored at-70 ℃ for later use. RNA was extracted from different plant leaves and cDNA was synthesized according to the procedure of example 1.

Wild type and transgenic plants were subjected to the qPCR test procedure of example 2BnMAN7The expression level was measured and the results were analyzed, plotted using GraphPad Prism software, and tested for differential significance (t tests), qP in FIG. 6In CR detection gene suppression expression strains and wild type strainsBnMAN7Comparison of expression levels; wild type controls are included in the figure; #1, #2, #3, #4 are independent transformation lines. Analysis of FIG. 6 by T-test denotes p<0.05, represents p<0.01, represents p<0.001 denotes p<0.0001, it can be seen from FIG. 6 that the expression levels of #1 and #4 were not decreased and may be false positive in lines #2 and #3BnMAN7The expression amount is obviously reduced compared with the wild type, and the degradation of cell walls is correspondingly reduced, so that the expression amount has a certain inhibiting effect on the dehiscence of the silique.

Example 5.BnMAN7Detection of enzymatic Activity

(1) Construction of prokaryotic expression vector and protein induction expression

Constructed according to the specifications of Clon express II One Step Cloning Kit (purchased from Nanjing Novoverx Biotech Co., ltd.). The method comprises the following steps: the empty vector PGEX-4T-1 (purchased from Shanghai Starfish Biotech, inc.) was digested with the restriction endonucleases BamHI and XmaI (purchased from Bao bioengineering, inc.) to obtain a linearized vector. Designing primers according to specification of Clonexpress II One Step Cloning Kit, and introducing homologous sequences and enzyme cutting sites at two ends of a linearized vector into the 5' end of the primers respectively to amplify genesBnMAN7The full-length sequence of (a),

upstream primer Yuman7F2 (seq. Id No. 16):

5’-GGTTCCGCGTGGATCCATGAAGCCTCTGTGTGGT-3' (the underlined part is BamHI enzyme cutting site; the pre-underlined part is a linear vector terminal homologous sequence adjacent to the BamHI enzyme cutting site; and the post-underlined part is a gene specific upstream primer);

downstream primer Yuman7R2 (seq. Id No. 17):

5’- CTCGAGTCGACCCGGGTCAGTTTAGACCTTCTTTTCTT-3' (the underlined part is XmaI enzyme cutting site; the pre-underlined part is a linearized vector terminal homologous sequence adjacent to the XmaI enzyme cutting site; and the post-underlined part is a gene-specific downstream primer).

Then, the BnMAN7-pMD19-T recombinant plasmid constructed in the step (3) of example 1 was used as a template to amplify the gene of the inserted fragmentBnMAN7The full-length sequence of (1).

And (3) recombination reaction: the reaction system was formulated on ice: linearized vector pGEX-4T-1. Mu.L (257.16 ng), insert 1. Mu.L (39.36 ng), 5 × CEII Buffer 4. Mu.L, exnase II 2. Mu.L, 10. Mu.L in double distilled water. Gently sucking and beating the mixture by using a pipettor, and mixing the mixture evenly, and centrifuging the mixture for a short time to collect reaction liquid to the bottom of a reaction tube; reacting at 37 ℃ for 30min; cooled to 4 ℃ or immediately placed on ice to cool. Then transforming the product of the recombination reaction into an escherichia coli competent cell DH5 alpha, selecting a monoclonal for amplification culture, and then identifying a bacterial liquid by PCR, wherein the used universal primers are as follows:

pGEX5'(SEQ.ID.NO.18)：5’- GGGCTGGCAAGCCACGTTTGGTG-3’

pGEX3'(SEQ.ID.NO.19): 5’- CCGGGAGCTGCATGTGTCAGAGG-3’

sequencing the identified positive bacterial colony for verification (biological engineering, shanghai, inc.), and extracting plasmid from bacterial liquid with correct sequencingBnMAN7Prokaryotic expression vector pGEX-4T-1-BnMAN7(FIG. 7). The constructed prokaryotic expression vector pGEX-4T-1-BnMAN7Transformed into expression bacteria BL21 competent cells, and stored at-70 ℃ for later use.

Protein induction expression: expression bacteria BL21 containing recombinant plasmid pGEX-4T-1-BnMAN7 and empty vector pGEX-4T-1, respectively, were subjected to scale-up culture in 3mL of a liquid medium containing ampicillin at a final concentration of 50. Mu.g/mL at 37 ℃,200rpm,12-16h, and then cultured at 37 ℃ and 200rpm in 100mL of a liquid medium containing ampicillin at a final concentration of 50. Mu.g/mL until OD600 became 0.6, and IPTG (isopropyl-. Beta. -D-thiogalactoside, an inducer for bacterial endoproteins) was added at a final concentration of 0.4mmol/L,18 ℃,200rpm, and induced for 20h.

The liquid culture medium is prepared as follows: 1L of liquid medium comprises 5g of yeast extract, 10g of peptone and 10g of sodium chloride, and the final concentration of ampicillin is 50 mu g/mL.

(2) DNS (3, 5-dinitrosalicylic acid) chromogenic method detectionBnMAN7Hemicellulase Activity

The bacteria are broken by ultrasonic to release protein, and the temperature is kept low during breaking to prevent protein degradation. The specific steps are carried out according to a DNS color developing method: recombinant plasmid is preparedThe equivalent amount of protein obtained by inducing the granule pGEX-4T-1-BnMAN7 and the empty vector pGEX-4T-1 reacts with the xylan as a substrate, the temperature is kept at 50 ℃ for different time: 0.5h, 1.5h, 2.5h, 3.5h and 4.5h, then adding an equal volume DNS color developing agent, boiling water bath for 10min, then using sterile water to fix the volume to the equal volume so as to kill protein bacteria liquid as blank control, using a spectrophotometer to detect OD490 absorption value, and then obtaining hemicellulase activity according to a standard curve or a calculation formula. As shown in FIG. 8, the recombinant plasmid pGEX-4T-1 was contained relative to the protein obtained in the empty vector-BnMAN7The gene BnMAN7 shows hemicellulase activity, proves that the gene BnMAN7 does have the hemicellulase activity and has degradation capacity on cell walls, and the presumption that the inhibition of the expression of the gene can possibly enhance the pod dehiscence resistance, indicates that the gene has certain degradation capacity on the hemicellulose which is the main component of the cell walls, and can enhance the pod dehiscence resistance by inhibiting the expression of the gene in rape.

Example 6.

In this example, the tensile strength method was selected to detect the pod shatter resistance of positive plants. The tension cracking method is to determine the tension required for cracking the horn to identify the cracking resistance of the horn. In this example, a physicometer is selected to record stress curve during dehiscence of siliques, and then to determine dehiscence resistance of siliques, and the specific method is "quantitative determination of dehiscence of siliques of rape" (Tan Xiaoli et al, journal of agricultural engineering, 2006).

Statistical analysis is carried out on the experimental data of wild-type siliques and positive plant silique cracking force detection, as shown in fig. 9, the force required by positive plants #2 and #3 siliques to crack is found to be larger than that of the wild type, particularly, the #3 has larger difference significance compared with the wild type, the siliques of the plants are shown to have stronger crack resistance, and further, the situation that the siliques of the plants have stronger crack resistance is further explainedBnMAN7The gene has a regulating effect on pod shatter resistance.

The present invention is not limited to the above-described embodiments, and any obvious improvements, substitutions or modifications can be made by those skilled in the art without departing from the spirit of the present invention.

Sequence listing

<110> university of Jiangsu

<120> rape BnMAN7 gene and application thereof

<130> HZ-CJJ-2020-4

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1281

<212> DNA

<213> Brassica napus (Brassica napus)

<400> 1

atgaagcctc tgtgtctggt tacaatccta tcgatcctga tccaacaaag ctatttgaag 60

ctcggagcag atgcgttttc gagagatggg ttcgtgagaa cgaaaggtgt tcagtttagc 120

ctcaatggct atccttatta cgctaatggc ttcaatgcct attggctcat gtacgttgcc 180

tccgatcctt cccaaaggcc taagatctcc gccgccttcc aagaagcgtc tcgccatgga 240

ctgaccgtcg ctcgaacctg ggccttcagt gacggcggtt acaggcctct ccagtattcc 300

cctggctctt acaatgaaga tatgtttcag ggtttggatt ttgcgatagc tgaagcaaga 360

aggcatggga taaagatcat actcagcttt gccaataact acgtgagctt tggagggaag 420

aagcaatatg tggactgggc tagaagtcgt ggccgtcctg tatcttctga agacgacttc 480

ttcacagact ttcttgttaa agatttctac aagaaccata tcaaggctgt gctgaacaga 540

ttcaatactt ttaccaaagt tcattacaga gatgacccga ccattatggc ttgggagctc 600

atgaacgagc ctcgttgccc ctcagatcca accggaagaa ccattcaggc ttggattact 660

gaaatggctg ctcatgtgaa atcactagac agaaaccatc tgcttgaagc tggacttgaa 720

ggtttctacg gtcagtcctc accacaaagc aagactctga acccaccagg ccagtttgga 780

accgatttca tcgccaataa ccggatcccg ggcattgatt tcgtcacggt tcactcttac 840

ccagacgaat ggtttgtaga ctcgaacgag caatcccaaa tggaattctt aaacaaatgg 900

ctggacgcac acatccaaga cgctcagaac gttcttcaca aacccataat cttagcagag 960

ttcggcaaat caacgaagaa agcaggctcc gcgcagagag acgctgtctt caacacagtg 1020

tatggcaaga tttacgagtc tgcgaaacga ggaggatcag cggcaggagg attgttctgg 1080

caacttttgg gaaacggaat ggataatttt caagatgggt atgggatcat acttagccaa 1140

agctcctcaa ctgttaacgt cattgctcag caatcgcgca agttgactct cattcggaga 1200

atcttcgcaa ggatgatcaa tgtggagaaa tggaagagag ccagaggcta tggaccagta 1260

agaaaaggag gtctaaactg a 1281

<210> 2

<211> 426

<212> PRT

<213> Brassica napus (Brassica napus)

<400> 2

Met Lys Pro Leu Cys Leu Val Thr Ile Leu Ser Ile Leu Ile Gln Gln

1 5 10 15

Ser Tyr Leu Lys Leu Gly Ala Asp Ala Phe Ser Arg Asp Gly Phe Val

20 25 30

Arg Thr Lys Gly Val Gln Phe Ser Leu Asn Gly Tyr Pro Tyr Tyr Ala

35 40 45

Asn Gly Phe Asn Ala Tyr Trp Leu Met Tyr Val Ala Ser Asp Pro Ser

50 55 60

Gln Arg Pro Lys Ile Ser Ala Ala Phe Gln Glu Ala Ser Arg His Gly

65 70 75 80

Leu Thr Val Ala Arg Thr Trp Ala Phe Ser Asp Gly Gly Tyr Arg Pro

85 90 95

Leu Gln Tyr Ser Pro Gly Ser Tyr Asn Glu Asp Met Phe Gln Gly Leu

100 105 110

Asp Phe Ala Ile Ala Glu Ala Arg Arg His Gly Ile Lys Ile Ile Leu

115 120 125

Ser Phe Ala Asn Asn Tyr Val Ser Phe Gly Gly Lys Lys Gln Tyr Val

130 135 140

Asp Trp Ala Arg Ser Arg Gly Arg Pro Val Ser Ser Glu Asp Asp Phe

145 150 155 160

Phe Thr Asp Phe Leu Val Lys Asp Phe Tyr Lys Asn His Ile Lys Ala

165 170 175

Val Leu Asn Arg Phe Asn Thr Phe Thr Lys Val His Tyr Arg Asp Asp

180 185 190

Pro Thr Ile Met Ala Trp Glu Leu Met Asn Glu Pro Arg Cys Pro Ser

195 200 205

Asp Pro Thr Gly Arg Thr Ile Gln Ala Trp Ile Thr Glu Met Ala Ala

210 215 220

His Val Lys Ser Leu Asp Arg Asn His Leu Leu Glu Ala Gly Leu Glu

225 230 235 240

Gly Phe Tyr Gly Gln Ser Ser Pro Gln Ser Lys Thr Leu Asn Pro Pro

245 250 255

Gly Gln Phe Gly Thr Asp Phe Ile Ala Asn Asn Arg Ile Pro Gly Ile

260 265 270

Asp Phe Val Thr Val His Ser Tyr Pro Asp Glu Trp Phe Val Asp Ser

275 280 285

Asn Glu Gln Ser Gln Met Glu Phe Leu Asn Lys Trp Leu Asp Ala His

290 295 300

Ile Gln Asp Ala Gln Asn Val Leu His Lys Pro Ile Ile Leu Ala Glu

305 310 315 320

Phe Gly Lys Ser Thr Lys Lys Ala Gly Ser Ala Gln Arg Asp Ala Val

325 330 335

Phe Asn Thr Val Tyr Gly Lys Ile Tyr Glu Ser Ala Lys Arg Gly Gly

340 345 350

Ser Ala Ala Gly Gly Leu Phe Trp Gln Leu Leu Gly Asn Gly Met Asp

355 360 365

Asn Phe Gln Asp Gly Tyr Gly Ile Ile Leu Ser Gln Ser Ser Ser Thr

370 375 380

Val Asn Val Ile Ala Gln Gln Ser Arg Lys Leu Thr Leu Ile Arg Arg

385 390 395 400

Ile Phe Ala Arg Met Ile Asn Val Glu Lys Trp Lys Arg Ala Arg Gly

405 410 415

Tyr Gly Pro Val Arg Lys Gly Gly Leu Asn

420 425

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgttgctatc caggctgttc tttc 24

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gatagcgtga ggaagagcat aacc 24

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaagcctc tgtgtctggt ta 22

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcagtttaga cctccttttc ttac 24

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agactcgaac gagcaatccc 20

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgcagactcg taaatcttgc c 21

<210> 9

<211> 158

<212> DNA

<213> Brassica napus (Brassica napus)

<400> 9

atgaagcctc tgtgtctggt tacaatccta tcgatcctga tccaacaaag ctatttgaag 60

ctcggagcag atgcgttttc gagagatggg ttcgtgagaa cgaaaggtgt tcagtttagc 120

ctcaatggct atccttatta cgctaatggc ttcaatgc 158

<210> 10

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caccatgaag cctctgtgtc tggtta 26

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcattgaagc cattagcgta 20

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctaacagaac tcgccgtgaa gact 24

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ctgctgagcc tcgacatg 18

<210> 14

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

attcggctat gactgggc 18

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

caagaaggcg atagaaggcg 20

<210> 16

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggttccgcgt ggatccatga agcctctgtg tctggt 36

<210> 17

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ctcgagtcga cccgggtcag tttagacctc cttttctt 38

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gggctggcaa gccacgtttg gtg 23

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ccgggagctg catgtgtcag agg 23

<210> 20

<211> 1296

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 20

atgaagcttc tggctctgtt tccatttcta gcgatcgtga tccaactcag ctgttgggag 60

ctaggaacag atgcattacc gagcggtggg ttcgtgagga cgaaaggtgt tcagtttagt 120

ctcaatggct atccatatta cgctaatggc ttcaatgcct actggctcat gtacgtagcc 180

tccgatccat cccaacggtc taagatctcc accgctttcc aagatgcttc tcgccatgga 240

ttgaccgttg ctcgaacctg ggctttcagc gatggcggtt acagggctct tcagtattcc 300

cctggctcct acaacgagga tatgtttcag ggtttggatt ttgcgttagc tgaggcaaga 360

aggcatggta taaagataat actcagcttt gccaataact acgagagctt cggagggagg 420

aagcaatatg tggattgggc tcgaagcaga ggccgtcccg tttcttctga agacgacttc 480

ttcactgact ctcttgttaa agatttctac aagaaccata tcaaggctgt gctgaacaga 540

ttcaatacct ttaccaaagt tcattacaaa gatgacccaa ccattatggc ttgggagctc 600

atgaacgagc cccgttgccc ctctgatcct tccggaagag ccattcaggc ttggattact 660

gaaatggctg ctcatgtgaa atcactagac agaaaccatc tgcttgaagc tggcctcgaa 720

ggtttctatg gtcagtcttc acctcaaagc aagactctta acccacctgg ccagtttgga 780

accgatttca tcgccaataa ccgcattccc ggcattgatt tcgtcacggt tcactcttac 840

cctgatgaat ggtttccaga ctcaagcgag caatcccaaa tggatttctt gaacaaatgg 900

ctagacgcac acatccaaga cgcacagaac gttcttcaca aaccaataat attagcagag 960

tttggtaaat caatgaagaa accaggttat accccagcgc agagagacat cgtcttcaac 1020

accgtgtaca gcaagattta cgggtctgca aaacgaggag gtgcagcagc aggaggattg 1080

ttctggcaac ttctggtaaa cggaattgat aattttcaag atgggtatgg gatcatactt 1140

agccaaagct cgtcgaccgt taacgtcatt tcacagcaat cgcggaagtt gactttgatt 1200

aggaaaatct tcgctaggat gatcaatgtg gagaaatgga agagagcgag aggtcaggga 1260

caagttggga aacgaggtca caaaatcaat aactga 1296

<210> 21

<211> 431

<212> PRT

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 21

Met Lys Leu Leu Ala Leu Phe Pro Phe Leu Ala Ile Val Ile Gln Leu

1 5 10 15

Ser Cys Trp Glu Leu Gly Thr Asp Ala Leu Pro Ser Gly Gly Phe Val

20 25 30

Arg Thr Lys Gly Val Gln Phe Ser Leu Asn Gly Tyr Pro Tyr Tyr Ala

35 40 45

Asn Gly Phe Asn Ala Tyr Trp Leu Met Tyr Val Ala Ser Asp Pro Ser

50 55 60

Gln Arg Ser Lys Ile Ser Thr Ala Phe Gln Asp Ala Ser Arg His Gly

65 70 75 80

Leu Thr Val Ala Arg Thr Trp Ala Phe Ser Asp Gly Gly Tyr Arg Ala

85 90 95

Leu Gln Tyr Ser Pro Gly Ser Tyr Asn Glu Asp Met Phe Gln Gly Leu

100 105 110

Asp Phe Ala Leu Ala Glu Ala Arg Arg His Gly Ile Lys Ile Ile Leu

115 120 125

Ser Phe Ala Asn Asn Tyr Glu Ser Phe Gly Gly Arg Lys Gln Tyr Val

130 135 140

Asp Trp Ala Arg Ser Arg Gly Arg Pro Val Ser Ser Glu Asp Asp Phe

145 150 155 160

Phe Thr Asp Ser Leu Val Lys Asp Phe Tyr Lys Asn His Ile Lys Ala

165 170 175

Val Leu Asn Arg Phe Asn Thr Phe Thr Lys Val His Tyr Lys Asp Asp

180 185 190

Pro Thr Ile Met Ala Trp Glu Leu Met Asn Glu Pro Arg Cys Pro Ser

195 200 205

Asp Pro Ser Gly Arg Ala Ile Gln Ala Trp Ile Thr Glu Met Ala Ala

210 215 220

His Val Lys Ser Leu Asp Arg Asn His Leu Leu Glu Ala Gly Leu Glu

225 230 235 240

Gly Phe Tyr Gly Gln Ser Ser Pro Gln Ser Lys Thr Leu Asn Pro Pro

245 250 255

Gly Gln Phe Gly Thr Asp Phe Ile Ala Asn Asn Arg Ile Pro Gly Ile

260 265 270

Asp Phe Val Thr Val His Ser Tyr Pro Asp Glu Trp Phe Pro Asp Ser

275 280 285

Ser Glu Gln Ser Gln Met Asp Phe Leu Asn Lys Trp Leu Asp Ala His

290 295 300

Ile Gln Asp Ala Gln Asn Val Leu His Lys Pro Ile Ile Leu Ala Glu

305 310 315 320

Phe Gly Lys Ser Met Lys Lys Pro Gly Tyr Thr Pro Ala Gln Arg Asp

325 330 335

Ile Val Phe Asn Thr Val Tyr Ser Lys Ile Tyr Gly Ser Ala Lys Arg

340 345 350

Gly Gly Ala Ala Ala Gly Gly Leu Phe Trp Gln Leu Leu Val Asn Gly

355 360 365

Ile Asp Asn Phe Gln Asp Gly Tyr Gly Ile Ile Leu Ser Gln Ser Ser

370 375 380

Ser Thr Val Asn Val Ile Ser Gln Gln Ser Arg Lys Leu Thr Leu Ile

385 390 395 400

Arg Lys Ile Phe Ala Arg Met Ile Asn Val Glu Lys Trp Lys Arg Ala

405 410 415

Arg Gly Gln Gly Gln Val Gly Lys Arg Gly His Lys Ile Asn Asn

420 425 430

Claims (7)

1. Rape seedBnMAN7Application of gene in enhancing pod dehiscence resistance of rape and rapeBnMAN7The nucleotide sequence of the gene is shown as SEQ ID NO. 1;

the application is to silence/inhibit by utilizing a specific segment shown as SEQ ID NO.9BnMAN7The expression of the gene can enhance the pod shatter resistance of rape pod.

2. A recombinant expression vector comprising the oilseed rape of claim 1BnMAN7The nucleotide sequence of a section of specific sequence of the gene is shown in SEQ ID NO. 9.

3. The recombinant expression vector according to claim 2, wherein the original vector of the recombinant expression vector is pHellsgate12.

4. Use of the recombinant expression vector of claim 2 or 3 for breeding to improve the pod shatter resistance of oilseed rape.

5. A transformant containing the recombinant vector according to claim 2 or 3, wherein the host bacterium is Agrobacterium GV3101.

6. Method for improving crack resistance of rape podThe method is characterized in that the rape shown in SEQ ID NO.9BnMAN7Connecting the specific segment of the gene to an expression vector to construct a recombinant expression vector; and transforming the recombinant vector into microorganisms for culture expression, and then carrying out dip dyeing on the obtained transformant on the rape by adopting an hypocotyl transformation method.

7. The method of claim 6, wherein the microorganism is Agrobacterium GV3101.

Images