CN111454967A - Rape BnMAN7 gene and application thereof - Google Patents

Abstract

The invention provides a rapeBnMAN7Gene and application thereof, belonging to the field of plant genetic engineering and biotechnology; the rapeBnMAN7The gene is related to the dehiscence character of the pod, the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the rape pod dehiscence resistance related gene obtained by cloning in the inventionBnMAN7The inhibition of the expression of the gene can enhance the pod crack resistance and provide a new breeding material for further cultivating a new variety of rape with pod crack resistance; further constructed pHellsgate12-BnMAN7Obtained by transforming rape with recombinant vectorBnMAN7Suppression of expression lines, for the studyBnMAN7The gene provides raw materials for the research on the pod shatter resistance of rape, provides theoretical guidance for the crop pod shatter resistance breeding, and is beneficial to cultivating new species which are easy to be harvested mechanically and have high yield.

Description

Rape seedBnMAN7Gene and application thereof

Technical Field

The invention relates to a rapeBnMAN7Genes and application thereof, belonging to the field of plant genetic engineering and biotechnology.

Background

The yield of the cabbage type rape seeds is high, and the cabbage type rape seeds are mainly planted in the middle and lower reaches of Yangtze river in China, are one of the most widely planted oil crops in China and account for about 20% of the world yield. However, because the mechanization degree of rape production in China is not high and the production cost is high, domestic consumption requirements cannot be met, and a large amount of oil consumption still depends on import. Therefore, the method improves the rape production efficiency and increases the rape yield, and is an important target for rape research in China.

Dehiscence of the siliques can cause a large amount of seeds to fall off before harvesting, so that the yield is greatly reduced, meanwhile, the fallen seeds generate a large amount of self-growing seedlings, when the conditions of water, fertilizer, gas, heat and the like are suitable, the seedlings are sown earlier than the rape in the current year to emerge, the space is strived for and the nutrients in the soil are consumed, and the dehiscent siliques are not beneficial to mechanical harvesting. Compared with other crops, the rape pod is easy to crack, the yield loss caused by cracking reaches about 20 percent, and the yield loss can even reach 50 percent under adverse climatic conditions. Dehiscence of the siliques not only causes loss of yield but also is not conducive to mechanical harvesting of the rape. Pod resistance characteristics of the brassica napus are not greatly changed, no pod resistance variety exists at present, and although pod resistance characteristics exist in other related species, interspecific hybridization hardly removes the influence of poor agronomic characteristics.

Cellulases and hemicellulases are a class of hydrolases involved in processes associated with abscission and dehiscence in plants. Cellulases in plants have many tissue-specific expression patterns associated with developmental processes, such as tissue expansion, fruit ripening, or organ abscission; hemicellulase mainly comprises enzymes such as xylanase, glucanase, mannase and the like, and can decompose hemicellulose into small molecular polysaccharides or monosaccharides.

At present, researches on the aspects of rape pod shattering resistance are few at home and abroad, and a related gene participating in pod shattering in rape needs to be searched urgently, in order to solve the problems, the related gene for regulating and controlling the pod shattering of the rape is searched and the function of the related gene is researched, so that the related gene is the basis for cultivating mechanized harvest varieties and is also the main target of molecular breeding.

Disclosure of Invention

The invention aims to solve one of the technical problems, and therefore, the invention provides a rapeBnMAN7Genes and their use.

The invention firstly provides an application of rape BnMAN7 gene in enhancing pod shatter resistance of rape, wherein the nucleotide sequence of the rape BnMAN7 gene is shown as SEQ ID NO. 1; the protein amino acid sequence coded by the rape BnMAN7 gene is shown in SEQ ID NO. 2.

Specifically, byBnMAN7Silencing or inhibiting expression of genes to improve craze resistance of oilseed rape pods, particularly by targetingBnMAN7Silencing or inhibiting expression of a specific sequence fragment (the nucleotide sequence of the specific sequence fragment is shown as SEQ ID number 9) of the gene improves the crack resistance of the rape pod.

The invention provides a recombinant expression vector, which containsBnMAN7A section of specific sequence in the gene, the nucleotide sequence of which is shown as SEQ ID number 9; the specific preparation method of the recombinant vector comprises the following steps: will be provided withBnMAN7Cloning of the specific sequence into the portal vectorBnMAN7-pENTR, and entry vectorBnMAN7-pENTR is mixed with the target vectors pHellsgate12 and Gateway L R clone enzyme to obtainBnMAN7Suppression of recombinant expression vector pHellsgate12-BnMAN7。

The invention also provides application of the recombinant vector in improving the pod shatter resistance of rape.

The invention also provides a transformant, whichThe transformant is a recombinant vector pHellsgate12-BnMAN7Transforming host bacteria to obtain; the host bacterium is agrobacterium GV 3101.

The invention also provides a method for improving the pod shatter resistance of rape pod, which comprises the following steps:

the rape is treatedBnMAN7Connecting the gene to an expression vector to construct a recombinant expression vector; transforming the recombinant vector into microorganisms for culture expression, and then carrying out dip dyeing on the rape by using an hypocotyl transformation method on the obtained transformant; the microorganism is agrobacterium GV 3101.

The invention has the advantages that:

(1) the gene adopted by the invention is obtained by cloning in a rape cDNA library, and the method has high reliability, high speed and high efficiency on obtaining the target gene.

(2) The invention adopts the agrobacterium-mediated hypocotyl transformation method to transform the rape, the agrobacterium is used as a natural vector system, the success rate is high, and the mechanism of the system is most clearly researched. In the invention, the selected hypocotyl has strong regeneration capability and is easy to be infected by agrobacterium, and the method has high transformation efficiency and high speed.

(3) Rape pod crack resistance related gene cloned in the inventionBnMAN7The inhibition of the expression of the gene can enhance the pod crack resistance, and provides a new breeding material for further breeding new varieties of rape with pod crack resistance.

(4) Genes related to the present inventionBnMAN7The application of the compound in improving the pod crack resistance has important guiding reference significance for the production and breeding of plants which are easy to crack like pods of rape and soybean, and the like. pHellsgate 12-containing protein constructed by the inventionBnMAN7Obtained by transforming rape with recombinant vectorBnMAN7Suppression of expression lines, for the studyBnMAN7The gene provides raw materials for the research on the pod shatter resistance of rape, provides theoretical guidance for the crop pod shatter resistance breeding, and is beneficial to cultivating new species which are easy to be harvested mechanically and have high yield.

Drawings

Fig. 1 shows the conserved domain features of BnMAN7 protein.

FIG. 2 isBnMAN7The same as other speciesThe source protein amino acid sequence comparison result, wherein A is the protein sequence of the cabbage type rape, B is the protein sequence of the cabbage type rape, C is the protein sequence of radish, D is the protein sequence of the allium tuberosum, E is the protein sequence of arabidopsis thaliana, and F is the geneBnMAN7The protein sequence of (a); the black areas in the figure show identical amino acids and the grey areas show similar amino acids.

FIG. 3 is a drawing showingBnMAN7Analyzing the expression pattern of gene tissue.

FIG. 4 shows the plant transformation recombinant expression vector pHellsgate12-BnMAN7Schematic diagram of the structure of the T-DNA insertion region of (1).

FIG. 5 shows a schematic representation of a rape plantBnMAN7The PCR identification result of gene suppression expression strain, M is D L2000 DNA Marker, + is positive control, #1, #2, #3, #4 are independent transformation strain, H₂O is blank control, WT is negative control.

FIG. 6 shows the qPCR detection of gene suppression expression strains and wild-type strainsBnMAN7Comparison of expression levels; WT is wild type control; #1, #2, #3, #4 are independent transformation lines.

FIG. 7 is a drawing showingBnMAN7Prokaryotic expression vector pGEX-4T-1-BnMAN7Schematic representation.

FIG. 8 is a drawing showingBnMAN7And (5) detecting the activity of the hemicellulase.

FIG. 9 shows wild type andBnMAN7the test results of the tensile strength of the silique of the positive transformation plants are shown as #2 and #3BnMAN7And (5) positively transforming plants.

Detailed Description

The technical solution of the present invention is further described with reference to the following examples and drawings, but the examples are for better explaining the present invention and are not to be construed as limiting the present invention.

The reagents or materials referred to in the present invention are, unless otherwise specified, commercially available.

Example 1.BnMAN7Obtaining of genes

According to the hemicellulase gene of Arabidopsis thalianaMANNANASE7The information (nucleotide sequence is shown as SEQ ID NO.20, GENEBANK database accession number is BT008749.1, amino acid sequenceSEQ ID NO.21, GENEBANK database accession numbers are: AAP 49511.1), screening rape gene in database, finally confirming that BnaA07g12590D (nucleotide sequence is shown as SEQ ID NO. 1) is used as research object, further cloning the gene from No.11 (seeds are purchased from oil research science and technology Limited company in Wuhan) in cabbage type rape and researching the function of the gene, and naming the cloned gene asBnMAN7The method comprises the following specific steps:

(1) plant material cultivation:

the double No.11 plants in the cabbage type rape (seeds are purchased from oil planting science and technology limited in Wuhan, and planted in the laboratory) are used as experimental materials, and the growth conditions are as follows: temperature of 20 deg.C+2 ℃; humidity is 60-90%; the light cycle is 8h of illumination and 16h of darkness every day; the illumination intensity is 44 mu mol m^-2s^-1。

(2) Extraction of rape total RNA and cDNA Synthesis:

the Trizol reagent fast extraction method is to freeze a small amount of sample in a mortar by liquid nitrogen, then fast grind the sample into powder, add the powder into an EP tube of 1.5m L precooled on ice containing 1m L Trizol, evenly mix the powder by full shaking, centrifuge the powder at 4 ℃,12,000 rpm for 10min, take supernatant of about 800 mu L into a new EP tube of precooled 1.5m L, add 300 mu L chloroform, place the mixture at room temperature for 3min after the strong shaking, centrifuge the mixture at 4 ℃,12,000 rpm for 10min, take supernatant of about 300 mu L into a new EP tube of 1.5m L, add equal volume isopropanol to shake the mixture to fully precipitate the RNA, centrifuge the mixture for 10min at 4 ℃, 12000rpm, discard the supernatant, add 800 mu L75% ethanol to wash the mixture fully, centrifuge the mixture at 4 ℃, 5min at 12,000rpm, discard the supernatant, wait for precipitation and drying, add 50 mu L DEPC precipitate, finally, dissolve the water for the agarose gel electrophoresis detection of the integrity of the backup and store the RNA content on a spectrophotometer at 70 ℃ and determine the RNA content.

The cDNA synthesis is performed by taking total RNA as a template according to Hiscript^®The QRT Supermix reverse transcription kit (purchased from Nanjing Novozam Biotechnology Co., Ltd.) was used for reverse transcription experiments, in which genomic DNA was first removed, and a mixture of about 500ng of template RNA, 4 × g of DNA wiper Mix 2. mu. L, and RNase free d was added to a centrifuge tube from which RNase was removeddH₂O to the total volume of 8 mu L, gently sucking and beating the mixture by a pipette, mixing the mixture evenly at 42 ℃ for 2min, namely finishing the first step of reaction, then preparing a reverse transcription system, adding 2 mu L5 × qRT Supermix II into the reaction tube of the first step of reaction, gently sucking and beating the mixture evenly by a pipette, then carrying out reverse transcription reaction, reacting the mixture for 10min at 25 ℃, reacting the mixture for 30min at 50 ℃, reacting the mixture for 5min at 85 ℃, and selecting the cabbage type rape internal reference gene as the reaction productActin(GenBank: AF 111812.1) was identified as an internal reference, reference geneActinThe primer sequence is as follows:

Actin-F(SEQ ID NO.3)：5’- TGTTGCTATCCAGGCTGTTCTTTC-3’

Actin-R(SEQ ID NO.4)：5’- GATAGCGTGAGGAAGAGCATAACC-3’，

the cDNA sample of the reference gene (from gene to gene as small as 127 bp) can be amplified by PCR identification and stored at-20 ℃ for later use.

(3)BnMAN7Cloning of the gene cDNA sequence:

according toBnaA07g12590DDesigning a primer for cloning, wherein the amplification sequences are respectively as follows:

Man7-F(SEQ ID NO.5) ：5’- ATGAAGCCTCTGTGTCTGGTTA-3’

Man7-R(SEQ ID NO.6) ：5’- TCAGTTTAGACCTCCTTTTCTTAC-3’

using cDNA of No.11 in Brassica napus as a template, amplifying a target fragment by using high fidelity polymerase KOD-Plus-Neo (Toyobo Co., Ltd.) according to the following reaction conditions: amplification was carried out at 94 ℃ for 2min, 35 cycles (98 ℃,10 s; 59 ℃, 30 s; 68 ℃, 35s) and 68 ℃ for 10minBnMAN7Gene coding sequence, electrophoresis gel running of 1% agarose gel, identification of target fragment amplification result, target product size of 1281bp, and recovery kit E, Z, N, A with gel.^®The Gel Extraction Kit (available from Omega Bio-Tek) was used to recover the PCR product, and the recovered product was ligated to pMD19-T vector (available from Baori physician's technology, Beijing, Ltd.) using a linker system comprising 4.5. mu. L-19 of the desired fragment, 0.5. mu. L, and Solution I5. mu. L (Baori bioengineering, Ltd.) at 16 ℃ overnight to construct a constructIs built intoBnMAN7After that, the Escherichia coli DH5 α competent cells (purchased from Nanjing Nuojingzan biotechnology limited) are transformed into a pMD19-T vector, the cells are selected, bacteria liquid PCR identification is carried out, the positive clones are sent to a biological engineering (Shanghai) corporation for sequencing, and a target gene is obtained through sequencing, named or marked asBnMAN7The nucleotide sequence of the protein is shown as SEQ ID NO.1, the encoded protein is shown as SEQ ID NO. 2.

(4)BnMAN7Gene sequence domain and homology analysis thereof:

the sequence has an open reading frame length of 1281bp through sequencing, 426 amino acids are coded, the CDD database of NCBI is used for predicting the conserved structural domain characteristics of the protein, and the result shows that the protein belongs to glycosyl hydrolase superfamily (figure 1).

The prediction of software Wo L FPSORT shows that BnMAN7 is located outside the cell and is closely related to the function of secreting the BnMAN7 outside the cell to trigger the degradation of the cell wall.

Analysis of PROTSCA L E software showed that BnMAN7 was-0.392 hydrophilic and the instability index was 38.59, indicating that BnMAN7 is a relatively stable hydrophilic protein.

The TMPRED analysis predicted BnMAN7 to have 3 transmembrane domains and the SIGNA L P analysis showed it to have a signal peptide, which was predicted to be a secreted protein.

Alignment of various amino acid sequences using Mega5.1 software revealed that this sequence has some homology at the amino acid level with 5 other hemicellulases, as shown in FIG. 2, A, B, C, D, E in FIG. 2 at Gene Bank accession numbers and names: a represents a protein sequence of Brassica napus (XP _ 013653747.1), B represents a protein sequence of Brassica napus (XP _ 009103527.1), C represents a protein sequence of radish (XP _ 018441000.1), D represents a protein sequence of Garlic mustard (ARH02326.1), E represents a protein sequence of Arabidopsis thaliana (NP _201447.1), and F represents a protein sequence of BnMAN 7. The black regions show the same amino acids and the grey regions show similar amino acids, where a has 97.65% homology to F, B98.36% homology to F, C95.58% homology to F and D93.46% homology to F. The same as FThe source was 88.97%. Show that the invention relates toBnMAN7The gene may have a function or characteristic of a hemicellulase.

Example 2.BnMAN7Analysis of tissue-specific expression patterns of genes

To explore the geneBnMAN7Differential expression in various tissues of the brassica napus is detected by adopting a q-PCR technologyBnMAN7Expression patterns in cabbage type rape roots, stems, stem tips, leaves, flowers, flower buds, young siliques (15 days after flowering), mature siliques (50 days after flowering). The plant material used in this example was canola 11, each tissue material was collected and immediately frozen with liquid nitrogen and stored in an ultra-low temperature freezer at-70 ℃ for future use. RNA from various tissues of Brassica napus was obtained and cDNA was synthesized according to the method described in example 1.

In thatBnMAN7Designing a real-time fluorescent quantitative PCR primer in a non-conserved region of a gene sequence, wherein the primer sequence is as follows:

qman7-F（SEQ ID NO.7）：5’- AGACTCGAACGAGCAATCCC -3’

qman7-R（SEQ ID NO.8）：5’- CGCAGACTCGTAAATCTTGCC -3’

cabbage type rape Actin gene is used as an internal Reference gene, reverse transcription is carried out by taking cDNA of a first strand as a template, a specific operation method is carried out according to AceQ QpcrSYBR Green Master Mix kit specification, a fluorescent quantitative reaction system is 20 mu L, reaction liquid is prepared in a 1.5M L EP tube and then is subpackaged in a PCR reaction tube Strip Tubes, finally, a template (namely cDNA of each tissue) is added, the qPCR reaction system is 2 × SYBR Premix Ex Taq II 10 mu L, 2 mu M qman 7-F2 mu L, 2 mu M qman 7-R2 mu L Reference Dye I0.4 mu L, double distilled water is 3.6 mu L, the template 2 mu L, the reaction conditions are 95 ℃, 5min, then 95 ℃,10 s, 56 ℃, 30s and 40 cycles, 95 ℃ 15s, 60 ℃, 1min, 10s, 3. mu. 3. 10. and 3 times of repeated experimental data of each sample by using cDNA of each group as repeated experimental template and each group^－△△CTThe method is used for analysis, the relative expression quantity of the gene is calculated, and graph pad Prism software is used for mapping.

FIG. 3 is a drawing showingBnMAN7Results of analysis of gene tissue expression patterns, whichIn exploringBnMAN7Differential expression in various tissues and organs of rape, and the expression level in rape roots is used as a control group. FIG. 3 was analyzed by T-test, where p is denoted<0.05, represents p<0.01, represents p<0.001 denotes p<0.0001. As can be seen from the figures, it is,BnMAN7the expression is carried out in different tissues and organs of rape, the expression in the young siliques is higher than that in the mature siliques,BnMAN7the expression level in the flower is highest, which is about 7 times of the expression level in the root, and the result is that the flower is subsequently expressedBnMAN7Provides a theoretical basis for the research.

Example 3 inhibitionBnMAN7Acquisition of Gene-expressed transgenic oilseed rape plants

(1) Suppression ofBnMAN7Construction of expressed RNAi vectors:

constructed as in step (3) of example 1BnMAN7Amplifying the recombinant plasmid-pMD 19-T as a templateBnMAN7158bp specific fragment on the gene is a non-conservative fragment of the gene, the gene can be silenced and loses the function thereof by interfering the sequence of the fragment, and the specific nucleotide sequence of the fragment is shown as SEQ ID NO.9 and specifically comprises the following steps:

ATGAAGCCTCTGTGTCTGGTTACAATCCTATCGATCCTGATCCAACAAAGCTATTTGAAGCTCGGAGCAGATGCGTTTTCGAGAGATGGGTTCGTGAGAACGAAAGGTGTTCAGTTTAGCCTCAATGGCTATCCTTATTACGCTAATGGCTTCAATGC

the primer sequences used for amplification are respectively:

Iman7-F（SEQ ID NO.10）：5’- CACCATGAAGCCTCTGTGTCTGGTTA-3’

Iman7-R（SEQ ID NO.11）：5’- GCATTGAAGCCATTAGCGTA-3’

the primers were synthesized by Shanghai Biotech.

Amplification was performed using the high fidelity enzyme KOD-Plus-Neo (available from Toyobo Biotech Co., Ltd.) in the reaction system 10 × PCR Buffer for KOD-Plus-Neo 5. mu. L, 2mM dNTP 5. mu. L, 25mM MgSO 5₄3 µL，10 µM IMan7-F 1.5 µL，10µM IMan7-R 1.5µL，BnMAN7-pMD19-T recombinant plasmid 0.5 μ L-Plus-Neo (1.0U/μ L) 1 μ L, double distilled water 32.5 μ L.

The reaction procedure is as follows:

at 94 ℃ for 2min, 35 cycles (98 ℃,10 s; 57 ℃, 30 s; 68 ℃,10 s) at 68 ℃ for 10 min.

The PCR product is subjected to agarose gel electrophoresis, and the target band is recovered from the gel and the concentration of the target band is determined.

Then according to pENTR^TM/D-TOPO^TMInstructions for the Cloning Kit, pENTR vector is pENTR vector at a molar ratio of 2:1 (PCR product: pENTR vector)^TM/D-TOPO^TMThe amount of the target fragment and pENTR vector added into the system is accurately calculated by the vector carried in the Cloning Kit so as to ensure the highest connection efficiency.

The linking system is as follows: fragments of interest, i.e. amplifiedBnMAN7A158 bp specific fragment (150 ng/. mu. L) on a gene is 1.5 mu. L, a Salt solution is 0.5 mu. L vector (15-20 ng/. mu. L) is 1 mu. L, the system is connected at the temperature of 22 ℃ for 2h, then the reaction system is transformed into an escherichia coli DH5 α competence and cultured at the temperature of 37 ℃ overnight, a single clone is picked for amplification culture, then bacteria liquid PCR identification is carried out on the picked single clone by primers Iman7-F and Iman7-R, and a positive clone is sent for sequencing.

Amplifying and culturing the positive clone with correct sequencing result to extract plasmid to obtain entry vectorBnMAN7-pENTR, entry vector according to the instructions of Gateway L R clone TM II Enzyme Mix kitBnMAN7-pENTR is used in an amount equal to that of expression vector pHellsgate12 (from Australian CSIRO: http:// www.pi.csiro.au/rnai/vectors. htm), and will beBnMAN7From carrier of entering doorBnMAN7-substitution in pENTR to the final expression vector pHellsgate 12.

The reaction system is 10 mu L:BnMAN7pENTR vector plasmid (130 ng/. mu. L) 0.5. mu. L, pHellsgate12 vector (150 ng/. mu. L) 0.5. mu. L R Mix enzyme 2. mu. L buffer (pH 8.0) 7. mu. L, ligating the system at 25 ℃ for 3h, adding 1. mu. L protein kinase K at 37 ℃ for reaction for 10min, then transforming E.coli DH5 α competence, picking single clone for amplification culture and PCR identification.

In order to ensure the accuracy of the identification result, 2 identification methods are adopted in the identification process, and 2 pairs of identification primers respectively comprise:

Iman7-R（SEQ ID NO.11）：5’- GCATTGAAGCCATTAGCGTA-3’

pH12-12517F（SEQ ID NO.12）：5’-CTAACAGAACTCGCCGTGAAGACT-3’

and Iman7-R (SEQ ID NO. 11): 5'-GCATTGAAGCCATTAGCGTA-3'

pH12-17618R（SEQ ID NO.13）：5’-CTGCTGAGCCTCGACATG-3’

The PCR system is identified as follows:

the reaction system of the pH12-12517F and Iman7-R is 2 × Premix Taq 10 mu L, 10 mu M pH12-12517F 0.5 mu L, Iman 7-R0.5 mu L, monoclonal bacteria liquid 2 mu L and double distilled water 7 mu L.

The Iman7-R and pH12-17618R reaction system comprises 2 × Premix Taq 10 mu L, 10 mu M PH12-17618R0.5 mu L, 10 mu M Iman 7-R0.5 mu L, 2 mu L of monoclonal bacteria liquid and 7 mu L of double distilled water.

The reaction procedure was as follows:

at 94 ℃ for 3min, 28 cycles (94 ℃, 30 s; 55 ℃, 30 s; 72 ℃,1 min), at 72 ℃ for 10 min.

The PCR amplification result shows that the target band size obtained by the amplification of the primers of pH12-12517F and Iman7-R is 712bp, and the target band size obtained by the amplification of the primers of Iman7-R and pH12-17618R is 918 bp. The 2 bands are all fragments containing 158bp, and the 2 fragments contained in the obtained product simultaneously indicate that the replacement is successful.

Carrying out amplification culture on the positive clone identified correctly and improving the plasmid, then transforming the plasmid into agrobacterium GV3101 competent cells (purchased from Shanghai Weidi organism Co., Ltd.), carrying out PCR identification on the selected single colony by using primers of pH12-12517F, pH12-17618R and Iman7-R, carrying out amplification culture on the positive clone identified correctly, storing the positive clone identified correctly in an ultra-low temperature refrigerator at-70 ℃, and finally obtaining the bacillus subtilisBnMAN7Suppression of expression vector pHellsgate12-BnMAN7The T-DNA region of the vector is shown in FIG. 4.

(2) Recombinant plasmid pHellsgate12-BnMAN7The genetic transformation of the rape is as follows:

seed disinfection and sowing: selecting seeds of No.11 varieties in the cabbage type rape, and removing mildewed, broken grains, bacteria-carrying seeds and impurities; soaking seeds in 75% alcohol for 10s, pouring off alcohol, washing with sterile water for 4-5 times, adding bleaching agent with effective chlorine content of 15%, and sterilizing for 7 min; and (4) washing the seeds with sterile water until the seeds are washed clean by disinfectant, otherwise, the germination activity of the seeds is influenced. The sterilized seeds were sown on a sowing medium M0 (containing MS and sucrose) 15-20 grains per bottle, and then placed in a sterile cultivation room for dark cultivation at 25 ℃ for 5-6 days.

Wherein the M0 seeding medium is prepared from 1L seeding medium M0 including 2.21 g MS powder (containing organic substances, available from Duchefa Biochemie company), 8g agar powder, 20g sucrose, pH 5.8, sterilizing at 121 deg.C for 15min, and packaging into sterilized bottles.

Activating and preparing agrobacterium, namely selecting and storing agrobacterium GV3101 containing recombinant plasmids, streaking and activating the agrobacterium GV3101 on a plate, culturing for 2 days at 28 ℃, then selecting a positive single colony to be inoculated into L B liquid culture medium (prepared according to a conventional formula) containing 3-5m L and corresponding antibiotics (50 mg/L rifampicin, 50 mg/L gentamycin and 100 mg/L spectinomycin), shaking and culturing for 36h-48h at 28 ℃ and 220r/min, then inoculating into L B liquid culture medium containing corresponding antibiotics according to 1 percent of inoculum size to 100m L until the final concentration OD600 value of the bacterial liquid is about 0.8, sucking the cultured bacterial liquid into a centrifuge tube at 2m L, centrifuging for 5,000r/min to 10min, pouring out supernatant, using agrobacterium suspension culture medium DM (containing MS and cane sugar) and centrifuging, abandoning supernatant, then using DM with the same volume, taking 2m L and using 18m L as heavy suspension culture medium for later use, and diluting DM with the same volume.

Wherein the strain suspension culture medium DM is prepared by preparing 1L DM from 4.42g MS powder, 30g sucrose, adjusting pH to 5.8.121 deg.C, sterilizing for 15min, cooling to room temperature, and adding 1ml 100 mmol/L AS (acetosyringone).

The preparation and the dip dyeing of the explants are that 5 to 6 sections of seedling hypocotyls are cut by using tweezers and a scalpel, the length is about 0.8 to 1cm, the explants are obliquely cut at an angle of 45 degrees as much as possible (the wound area of the hypocotyls is increased, the contact area of the bacterial liquid and the hypocotyls is increased, and the infection is facilitated), the explants are placed in a liquid basic culture medium M1 (the cutting effect is better, the explants can keep activity and the infection is facilitated), the cut explants are placed in the prepared dip dyeing liquid, the infection is carried out for 20min (the time cannot be long, otherwise the explants are easy to die), the period is shaken for 4 to 6 times, and the dip dyeing is suitable for each dish of 80 to 100 explants/20M L bacterial liquid.

After the dip dyeing is finished, using sterile filter paper to suck bacteria liquid as much as possible, transferring hypocotyls to a solid basic culture medium (containing MS, sucrose, mannitol, agar powder, hormone 2,4-D and kinetin) 20 in each dish, carrying out dark culture at 25 ℃ for 2 days, transferring to a screening culture medium M2 (containing components of the basic culture medium and Kan antibiotic with the final concentration of 50 mg/L) after 2 days, carrying out light culture at 25 ℃ (16 h/8 h at night), transferring to a budding culture medium M3 (containing main components of MS, glucose, xylose and ethanesulfonic acid) after 3 weeks, carrying out subculture once every 2-3 weeks until budding, transferring to a rooting culture medium M4 (mainly containing B5 culture medium and sucrose) for rooting, and then putting into a low-temperature vernalization culture box for 2-4 weeks (the temperature is less than or equal to 4 ℃, the light period is 60-90%, the light period is 16h every day, and the light intensity is 150 μ M^-2s^-1. ) (ii) a After vernalization is finished, transplanting the seedlings to a nutrition pot, and putting the seedlings into a phytotron for culture until the seedlings are harvested; wherein the temperature of the artificial climate chamber is 20 +/-2 ℃, the humidity is 60-90%, the light cycle is 16h and 8h of darkness under illumination every day, and the illumination intensity is 150 mu mol m^-2s^-1。

Wherein, a 1L liquid culture medium M1 is prepared by adjusting pH to 5.8 with 4.42g MS powder, 30g sucrose and 18g mannitol, sterilizing at 121 ℃ for 15min, and adding 1ml 2,4-D with the concentration of 1mg/ml, 1ml KT (kinetin) with the concentration of 0.3mg/ml and 1ml AS (acetosyringone) with the concentration of 100 mmol/L.

1L solid basic culture medium is prepared from MS powder 4.42g, sucrose 30g, mannitol 18g, agar powder 8g, pH 5.8 adjusted, sterilization at 121 deg.C for 15min, and biological 2, 4-D1 ml and KT (kinetin) 1ml with concentration of 1 mg/ml.

1L screening culture medium M2 is prepared by adjusting pH to 5.8,121 deg.C under the conditions of 4.42g MS powder, 30g sucrose, 18g mannitol, 8g agarose, sterilizing for 15min, adding 1.5M L STS, 1M L Timentin (concentration is 300mg/ml Timentin), 1M L Kan (concentration is 50mg/ml kanamycin), wherein silver thiosulfate(STS) 0.1M AgNO at a volume ratio of 1:4₃Dissolved in 0.1M sodium thiosulfate. The reagent should be prepared immediately before use, and precipitate will be generated after a long time.

1L preparation of budding medium M3, 4.42g MS powder, 10g glucose, 8g agarose, 0.25g xylose, 0.6g MES (ethanesulfonic acid), pH 5.8 adjustment, 121 ℃, 15min sterilization, adding 1M L ZT (0.5 mg/ml trans-zeatin), 1M L IAA (0.5 mg/ml indoleacetic acid), 1M L Timentin (300 mg/ml Timentin), 1M L kan (50 mg/ml kanamycin).

1L rooting culture medium M4 is prepared from 3.86g B5 culture medium (purchased conventionally), 20g sucrose, 6g agar powder, adjusting pH to 6, sterilizing at 121 deg.C for 15min, and adding timentin with concentration of 300mg/ml 166 μ L.

(3) Suppression ofBnMAN7PCR identification of gene-expressed transformed rape plants:

the numbers of 4 transformed rapes obtained are respectively numbered from #1 to #4, wild type and #1 to #4 genomes are extracted, and whether the transformation is successful is identified by adopting a PCR technology. The primer sequence used for identification is designed according to a section of the kanamycin inherent in the recombinant expression vector pHellsgate12 (known published sequence), and specifically comprises the following steps:

Kan-F（SEQ ID NO.14）：5’-ATTCGGCTATGACTGGGC-3’

Kan-R（SEQ ID NO.15）：5’- CAAGAAGGCGATAGAAGGCG-3’

the positive control is the carrier plasmid pHellsgate12 containing the 158bp specific target fragmentBnMAN7The negative control was WT and the blank control was H₂O。

The system and reaction procedure for PCR amplification are as follows:

the amplification system comprises 2 × Premix Taq 10 mu L, 10 mu M Kan-F1 mu L, Kan-R1 mu L, genome 1 mu L and double distilled water 7 mu L.

Reaction procedure: at 94 ℃ for 3min, 34 cycles (94 ℃, 30 s; 60 ℃, 30 s; 72 ℃, 45 s) at 72 ℃ for 10 min.

FIG. 5 shows a schematic representation of a rape plantBnMAN7The PCR identification result of gene suppression expression strain, in the figure, M is D L2000 DNA Marker, + is positive control; #1, #2#3, #4 are independent transformation lines, H₂O is blank control, WT is negative control. The detection result shows that the #1, #2, #3, #4 and the positive control in the embodiment can amplify the target band; and the negative control and the blank control have no electrophoresis band, the amplified band is recovered and sent to be sequenced, and the sequencing result is consistent with the sequence of the target fragment, which indicates that the transgenic rape genome already contains the target gene fragment.

(4) In transgenic plantsBnMAN7Detection of relative expression amount

Leaves of wild plants and transgenic plants #1, #2, #3 and #4 were respectively temporarily stored in liquid nitrogen and stored at-70 ℃ for later use. RNA from different plant leaves was extracted and cDNA was synthesized according to the procedure of example 1.

Wild type and transgenic plants were subjected to the qPCR test procedure of example 2BnMAN7Detection of expression level and analysis of the results, mapping using GraphPad Prism software and differential significance test (t tests), FIG. 6 shows qPCR detection of gene suppression expression strains and wild-type strainsBnMAN7Comparison of expression levels; WT in the figure is wild type control; #1, #2, #3, #4 are independent transformation lines. Analysis of FIG. 6 by T-test denotes p<0.05, represents p<0.01, represents p<0.001 denotes p<0.0001, it can be seen from FIG. 6 that the expression levels of #1 and #4 were not decreased and may be false positive in lines #2 and #3BnMAN7The expression amount is obviously reduced compared with the wild type, and the degradation of cell walls is correspondingly reduced, so that the expression amount has a certain inhibiting effect on the dehiscence of the silique.

Example 5.BnMAN7Detection of enzymatic Activity

(1) Construction of prokaryotic expression vector and protein induction expression

Constructed according to the specifications of Clon express II One Step Cloning Kit (purchased from Nanjing Novoverx Biotech Co., Ltd.). The method comprises the following steps: the empty vector PGEX-4T-1 (purchased from Shanghai Starfish Biotech, Inc.) was digested with the restriction endonucleases BamHI and XmaI (purchased from Bao bioengineering, Inc.) to obtain a linearized vector. According to Clonexpress II One Step CloThe ning Kit instruction designs primers, which are introduced into the 5' end of the linearized vector with homologous sequences at both ends and restriction sites, respectively, to amplify the geneBnMAN7The full-length sequence of (a),

upstream primer Yuman7F2(seq. id No. 16):

5’-GGTTCCGCGTGGATCCATGAAGCCTCTGTGTCTGGT-3' (underlined: BamHI cleavage site; underlined: homologous sequence at the end of the linearized vector adjacent to the BamHI cleavage site; underlined: gene-specific upstream primer);

downstream primer Yuman7R2(seq. id No. 17):

5’- CTCGAGTCGACCCGGGTCAGTTTAGACCTCCTTTTCTT-3' (underlined: XmaI cleavage site; pre-underlined: terminal homologous sequence of linearized vector adjacent to XmaI cleavage site; post-underlined: gene-specific downstream primer).

Then, the BnMAN7-pMD19-T recombinant plasmid constructed in the step (3) of the example 1 was used as a template to amplify the gene of the insertBnMAN7The full-length sequence of (1).

Preparing a reaction system on ice, namely a linearized vector pGEX-4T-13 mu L (257.16ng), an insert fragment 1 mu L (39.36ng), a5 × CEII Buffer 4 mu L, an Exnase II 2 mu L and double distilled water 10 mu L, gently sucking and uniformly mixing by using a pipette, collecting reaction liquid to the bottom of a reaction tube by short-time centrifugation, reacting at 37 ℃ for 30min, reducing the temperature to 4 ℃ or immediately placing on ice for cooling, then transforming a product of the recombination reaction into an escherichia coli competent cell DH5 α, picking up a single clone for amplification culture, and identifying a bacterial liquid by PCR, wherein the used universal primers are as follows:

pGEX5'(SEQ.ID.NO.18)：5’-GGGCTGGCAAGCCACGTTTGGTG-3’

pGEX3'(SEQ.ID.NO.19): 5’- CCGGGAGCTGCATGTGTCAGAGG-3’

sequencing the identified positive bacterial colony for verification (biological engineering, Shanghai, Inc.), and extracting plasmid from bacterial liquid with correct sequencingBnMAN7Prokaryotic expression vector pGEX-4T-1-BnMAN7(FIG. 7). The constructed prokaryotic expression vector pGEX-4T-1-BnMAN7Transformed into competent cells of the expression strain B L21, and stored at-70 ℃ for later use.

Protein induction expression is carried out by expanding expression bacterium B L21 containing recombinant plasmid pGEX-4T-1-BnMAN7 and empty vector pGEX-4T-1 respectively in 3m L liquid culture medium (containing 50 mug/m L final concentration of ampicillin) at 37 deg.C and 200rpm for 12-16h, then culturing at 37 deg.C and 200rpm in 100m L liquid culture medium (containing 50 mug/m L final concentration of ampicillin) according to 1% inoculum size until OD600 is 0.6, adding IPTG (isopropyl- β -D-thiogalactoside, a bacterial endoprotein inducer) to make final concentration be 0.4 mmol/L, 18 deg.C and 200rpm, and inducing for 20 h.

The liquid culture medium is prepared from 1L liquid culture medium including yeast extract 5g, peptone 10g, and sodium chloride 10g, and final concentration of ampicillin is 50 μ g/m L.

(2) DNS (3, 5-dinitrosalicylic acid) color development method detectionBnMAN7Hemicellulase Activity

The bacteria are broken by ultrasonic to release protein, and the temperature is kept low during breaking to prevent protein degradation. The specific steps are carried out according to a DNS color developing method: the equivalent amount of protein obtained by inducing the recombinant plasmid pGEX-4T-1-BnMAN7 and the empty vector pGEX-4T-1 is reacted with the substrate xylan, the temperature is 50 ℃, and the temperature is kept for different times: 0.5h, 1.5h, 2.5h, 3.5h and 4.5h, then adding an equal volume DNS color developing agent, boiling water bath for 10min, then using sterile water to fix the volume to the equal volume so as to kill protein bacteria liquid as blank control, using a spectrophotometer to detect OD490 absorption value, and then obtaining hemicellulase activity according to a standard curve or a calculation formula. As shown in FIG. 8, the recombinant plasmid pGEX-4T-1 was contained relative to the protein obtained in the empty vector-BnMAN7The gene BnMAN7 is proved to have hemicellulase activity and has degradation capacity on cell walls, and the presumption that the inhibition of the expression of the gene can enhance the pod shattering resistance, so that the gene has certain degradation capacity on the hemicellulose which is the main component of the cell walls, and the inhibition of the expression of the gene in rape can enhance the pod shattering resistance.

Example 6.

In this example, the tensile strength method was selected to detect the pod shatter resistance of positive plants. The tension cracking method is to determine the tension required for cracking the horn to identify the cracking resistance of the horn. In the embodiment, a physical property instrument is selected to record a stress curve in the process of cracking the siliques so as to judge the cracking resistance of the siliques, and a specific method is shown in quantitative determination of the cracking resistance of the siliques of rape siliques (Tan Xiaoli and the like, journal of agricultural engineering, 2006).

Statistical analysis is carried out on the experimental data of wild-type siliques and positive plant silique cracking force detection, as shown in fig. 9, the force required by positive plants #2 and #3 siliques to crack is found to be larger than that of the wild type, particularly, the #3 has larger difference significance compared with the wild type, the siliques of the plants are shown to have stronger crack resistance, and further, the situation that the siliques of the plants have stronger crack resistance is further explainedBnMAN7The gene has a regulating effect on pod shatter resistance.

The present invention is not limited to the above-described embodiments, and any obvious improvements, substitutions or modifications can be made by those skilled in the art without departing from the spirit of the present invention.

Sequence listing

<110> university of Jiangsu

<120> rape BnMAN7 gene and application thereof

<130>HZ-CJJ-2020-4

<160>21

<170>SIPOSequenceListing 1.0

<210>1

<211>1281

<212>DNA

<213> Brassica napus (Brassica napus)

<400>1

atgaagcctc tgtgtctggt tacaatccta tcgatcctga tccaacaaag ctatttgaag 60

ctcggagcag atgcgttttc gagagatggg ttcgtgagaa cgaaaggtgt tcagtttagc 120

ctcaatggct atccttatta cgctaatggc ttcaatgcct attggctcat gtacgttgcc 180

tccgatcctt cccaaaggcc taagatctcc gccgccttcc aagaagcgtc tcgccatgga 240

ctgaccgtcg ctcgaacctg ggccttcagt gacggcggtt acaggcctct ccagtattcc 300

cctggctctt acaatgaaga tatgtttcag ggtttggatt ttgcgatagc tgaagcaaga 360

aggcatggga taaagatcat actcagcttt gccaataact acgtgagctt tggagggaag 420

aagcaatatg tggactgggc tagaagtcgt ggccgtcctg tatcttctga agacgacttc 480

ttcacagact ttcttgttaa agatttctac aagaaccata tcaaggctgt gctgaacaga 540

ttcaatactt ttaccaaagt tcattacaga gatgacccga ccattatggc ttgggagctc 600

atgaacgagc ctcgttgccc ctcagatcca accggaagaa ccattcaggc ttggattact 660

gaaatggctg ctcatgtgaa atcactagac agaaaccatc tgcttgaagc tggacttgaa 720

ggtttctacg gtcagtcctc accacaaagc aagactctga acccaccagg ccagtttgga 780

accgatttca tcgccaataa ccggatcccg ggcattgatt tcgtcacggt tcactcttac 840

ccagacgaat ggtttgtaga ctcgaacgag caatcccaaa tggaattctt aaacaaatgg 900

ctggacgcac acatccaaga cgctcagaac gttcttcaca aacccataat cttagcagag 960

ttcggcaaat caacgaagaa agcaggctcc gcgcagagag acgctgtctt caacacagtg 1020

tatggcaaga tttacgagtc tgcgaaacga ggaggatcag cggcaggagg attgttctgg 1080

caacttttgg gaaacggaat ggataatttt caagatgggt atgggatcat acttagccaa 1140

agctcctcaa ctgttaacgt cattgctcag caatcgcgca agttgactct cattcggaga 1200

atcttcgcaa ggatgatcaa tgtggagaaa tggaagagag ccagaggcta tggaccagta 1260

agaaaaggag gtctaaactg a 1281

<210>2

<211>426

<212>PRT

<213> Brassica napus (Brassica napus)

<400>2

Met Lys Pro Leu Cys Leu Val Thr Ile Leu Ser Ile Leu Ile Gln Gln

1 5 10 15

Ser Tyr Leu Lys Leu Gly Ala Asp Ala Phe Ser Arg Asp Gly Phe Val

20 25 30

Arg Thr Lys Gly Val Gln Phe Ser Leu Asn Gly Tyr Pro Tyr Tyr Ala

35 40 45

Asn Gly Phe Asn Ala Tyr Trp Leu Met Tyr Val Ala Ser Asp Pro Ser

50 55 60

Gln Arg Pro Lys Ile Ser Ala Ala Phe Gln Glu Ala Ser Arg His Gly

65 70 75 80

Leu Thr Val Ala Arg Thr Trp Ala Phe Ser Asp Gly Gly Tyr Arg Pro

85 90 95

Leu Gln Tyr Ser Pro Gly Ser Tyr Asn Glu Asp Met Phe Gln Gly Leu

100 105 110

Asp Phe Ala Ile Ala Glu Ala Arg Arg His Gly Ile Lys Ile Ile Leu

115 120 125

Ser Phe Ala Asn Asn Tyr Val Ser Phe Gly Gly Lys Lys Gln Tyr Val

130 135 140

Asp Trp Ala Arg Ser Arg Gly Arg Pro Val Ser Ser Glu Asp Asp Phe

145 150 155 160

Phe Thr Asp Phe Leu Val Lys Asp Phe Tyr Lys Asn His Ile Lys Ala

165 170 175

Val Leu Asn Arg Phe Asn Thr Phe Thr Lys Val His Tyr Arg Asp Asp

180 185 190

Pro Thr Ile Met Ala Trp Glu Leu Met Asn Glu Pro Arg Cys Pro Ser

195 200 205

Asp Pro Thr Gly Arg Thr Ile Gln Ala Trp Ile Thr Glu Met Ala Ala

210 215 220

His Val Lys Ser Leu Asp Arg Asn His Leu Leu Glu Ala Gly Leu Glu

225 230 235 240

Gly Phe Tyr Gly Gln Ser Ser Pro Gln Ser Lys Thr Leu Asn Pro Pro

245 250 255

Gly Gln Phe Gly Thr Asp Phe Ile Ala Asn Asn Arg Ile Pro Gly Ile

260 265 270

Asp Phe Val Thr Val His Ser Tyr Pro Asp Glu Trp Phe Val Asp Ser

275 280 285

Asn Glu Gln Ser Gln Met Glu Phe Leu Asn Lys Trp Leu Asp Ala His

290 295 300

Ile Gln Asp Ala Gln Asn Val Leu His Lys Pro Ile Ile Leu Ala Glu

305 310 315 320

Phe Gly Lys Ser Thr Lys Lys Ala Gly Ser Ala Gln Arg Asp Ala Val

325 330 335

Phe Asn Thr Val Tyr Gly Lys Ile Tyr Glu Ser Ala Lys Arg Gly Gly

340 345 350

Ser Ala Ala Gly Gly Leu Phe Trp Gln Leu Leu Gly Asn Gly Met Asp

355 360 365

Asn Phe Gln Asp Gly Tyr Gly Ile Ile Leu Ser Gln Ser Ser Ser Thr

370 375 380

Val Asn Val Ile Ala Gln Gln Ser Arg Lys Leu Thr Leu Ile Arg Arg

385 390 395 400

Ile Phe Ala Arg Met Ile Asn Val Glu Lys Trp Lys Arg Ala Arg Gly

405 410 415

Tyr Gly Pro Val Arg Lys Gly Gly Leu Asn

420 425

<210>3

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tgttgctatc caggctgttc tttc 24

<210>4

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gatagcgtga ggaagagcat aacc 24

<210>5

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

atgaagcctc tgtgtctggt ta 22

<210>6

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tcagtttaga cctccttttc ttac 24

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

agactcgaac gagcaatccc 20

<210>8

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

cgcagactcg taaatcttgc c 21

<210>9

<211>158

<212>DNA

<213> Brassica napus (Brassica napus)

<400>9

atgaagcctc tgtgtctggt tacaatccta tcgatcctga tccaacaaag ctatttgaag 60

ctcggagcag atgcgttttc gagagatggg ttcgtgagaa cgaaaggtgt tcagtttagc 120

ctcaatggct atccttatta cgctaatggc ttcaatgc 158

<210>10

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

caccatgaag cctctgtgtc tggtta 26

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gcattgaagc cattagcgta 20

<210>12

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ctaacagaac tcgccgtgaa gact 24

<210>13

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ctgctgagcc tcgacatg 18

<210>14

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

attcggctat gactgggc 18

<210>15

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

caagaaggcg atagaaggcg 20

<210>16

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ggttccgcgt ggatccatga agcctctgtg tctggt 36

<210>17

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

ctcgagtcga cccgggtcag tttagacctc cttttctt 38

<210>18

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gggctggcaa gccacgtttg gtg 23

<210>19

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

ccgggagctg catgtgtcag agg 23

<210>20

<211>1296

<212>DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400>20

atgaagcttc tggctctgtt tccatttcta gcgatcgtga tccaactcag ctgttgggag 60

ctaggaacag atgcattacc gagcggtggg ttcgtgagga cgaaaggtgt tcagtttagt 120

ctcaatggct atccatatta cgctaatggc ttcaatgcct actggctcat gtacgtagcc 180

tccgatccat cccaacggtc taagatctcc accgctttcc aagatgcttc tcgccatgga 240

ttgaccgttg ctcgaacctg ggctttcagc gatggcggtt acagggctct tcagtattcc 300

cctggctcct acaacgagga tatgtttcag ggtttggatt ttgcgttagc tgaggcaaga 360

aggcatggta taaagataat actcagcttt gccaataact acgagagctt cggagggagg 420

aagcaatatg tggattgggc tcgaagcaga ggccgtcccg tttcttctga agacgacttc 480

ttcactgact ctcttgttaa agatttctac aagaaccata tcaaggctgt gctgaacaga 540

ttcaatacct ttaccaaagt tcattacaaa gatgacccaa ccattatggc ttgggagctc 600

atgaacgagc cccgttgccc ctctgatcct tccggaagag ccattcaggc ttggattact 660

gaaatggctg ctcatgtgaa atcactagac agaaaccatc tgcttgaagc tggcctcgaa 720

ggtttctatg gtcagtcttc acctcaaagc aagactctta acccacctgg ccagtttgga 780

accgatttca tcgccaataa ccgcattccc ggcattgatt tcgtcacggt tcactcttac 840

cctgatgaat ggtttccaga ctcaagcgag caatcccaaa tggatttctt gaacaaatgg 900

ctagacgcac acatccaaga cgcacagaac gttcttcaca aaccaataat attagcagag 960

tttggtaaat caatgaagaa accaggttat accccagcgc agagagacat cgtcttcaac 1020

accgtgtaca gcaagattta cgggtctgca aaacgaggag gtgcagcagc aggaggattg 1080

ttctggcaac ttctggtaaa cggaattgat aattttcaag atgggtatgg gatcatactt 1140

agccaaagct cgtcgaccgt taacgtcatt tcacagcaat cgcggaagtt gactttgatt 1200

aggaaaatct tcgctaggat gatcaatgtg gagaaatgga agagagcgag aggtcaggga 1260

caagttggga aacgaggtca caaaatcaat aactga 1296

<210>21

<211>431

<212>PRT

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400>21

Met Lys Leu Leu Ala Leu Phe Pro Phe Leu Ala Ile Val Ile Gln Leu

1 5 10 15

Ser Cys Trp Glu Leu Gly Thr Asp Ala Leu Pro Ser Gly Gly Phe Val

20 25 30

Arg Thr Lys Gly Val Gln Phe Ser Leu Asn Gly Tyr Pro Tyr Tyr Ala

35 40 45

Asn Gly Phe Asn Ala Tyr Trp Leu Met Tyr Val Ala Ser Asp Pro Ser

50 55 60

Gln Arg Ser Lys Ile Ser Thr Ala Phe Gln Asp Ala Ser Arg His Gly

65 70 75 80

Leu Thr Val Ala Arg Thr Trp Ala Phe Ser Asp Gly Gly Tyr Arg Ala

85 90 95

Leu Gln Tyr Ser Pro Gly Ser Tyr Asn Glu Asp Met Phe Gln Gly Leu

100 105 110

Asp Phe Ala Leu Ala Glu Ala Arg Arg His Gly Ile Lys Ile Ile Leu

115 120 125

Ser Phe Ala Asn Asn Tyr Glu Ser Phe Gly Gly Arg Lys Gln Tyr Val

130 135 140

Asp Trp Ala Arg Ser Arg Gly Arg Pro Val Ser Ser Glu Asp Asp Phe

145 150 155 160

Phe Thr Asp Ser Leu Val Lys Asp Phe Tyr Lys Asn His Ile Lys Ala

165 170 175

Val Leu Asn Arg Phe Asn Thr Phe Thr Lys Val His Tyr Lys Asp Asp

180 185 190

Pro Thr Ile Met Ala Trp Glu Leu Met Asn Glu Pro Arg Cys Pro Ser

195 200 205

Asp Pro Ser Gly Arg Ala Ile Gln Ala Trp Ile Thr Glu Met Ala Ala

210 215 220

His Val Lys Ser Leu Asp Arg Asn His Leu Leu Glu Ala Gly Leu Glu

225 230 235 240

Gly Phe Tyr Gly Gln Ser Ser Pro Gln Ser Lys Thr Leu Asn Pro Pro

245 250 255

Gly Gln Phe Gly Thr Asp Phe Ile Ala Asn Asn Arg Ile Pro Gly Ile

260 265 270

Asp Phe Val Thr Val His Ser Tyr Pro Asp Glu Trp Phe Pro Asp Ser

275 280 285

Ser Glu Gln Ser Gln Met Asp Phe Leu Asn Lys Trp Leu Asp Ala His

290 295 300

Ile Gln Asp Ala Gln Asn Val Leu His Lys Pro Ile Ile Leu Ala Glu

305 310 315 320

Phe Gly Lys Ser Met Lys Lys Pro Gly Tyr Thr Pro Ala Gln Arg Asp

325 330 335

Ile Val Phe Asn Thr Val Tyr Ser Lys Ile Tyr Gly Ser Ala Lys Arg

340 345 350

Gly Gly Ala Ala Ala Gly Gly Leu Phe Trp Gln Leu Leu Val Asn Gly

355 360 365

Ile Asp Asn Phe Gln Asp Gly Tyr Gly Ile Ile Leu Ser Gln Ser Ser

370 375 380

Ser Thr Val Asn Val Ile Ser Gln Gln Ser Arg Lys Leu Thr Leu Ile

385 390 395 400

Arg Lys Ile Phe Ala Arg Met Ile Asn Val Glu Lys Trp Lys Arg Ala

405 410 415

Arg Gly Gln Gly Gln Val Gly Lys Arg Gly His Lys Ile Asn Asn

420 425 430

Claims (10)

1. Rape seedBnMAN7Application of gene in enhancing pod shatter resistance of rape and rapeBnMAN7The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. The use according to claim 1, wherein said oil seed rapeBnMAN7The application of a section of specific sequence of the gene in enhancing the pod shatter resistance of rape, wherein the specific sequence is shown as SEQ ID number 9.

3. Use according to any of claims 1-2, characterized in that the silencing/suppression is as shown in SEQ ID number 9BnMAN7The expression of the gene specific fragment can enhance the pod shatter resistance of rape pod.

4. A recombinant expression vector comprising the oilseed rape of claim 1BnMAN7A section of specific sequence of the gene, the nucleotide sequence of which is shown as SEQ ID number 9.

5. The recombinant expression vector according to claim 4, wherein the original vector of the recombinant expression vector is pHellsgate 12.

6. Use of the recombinant expression vector of claim 4 or 5 for breeding to improve the crazing resistance of oilseed rape pod.

7. A transformant containing the recombinant vector according to claim 4 or 5.

8. The transformant according to claim 7, wherein the host bacterium is Agrobacterium GV 3101.

9. A method for improving the pod shatter resistance of rape, which is characterized in that rape shown by SEQ ID number 9BnMAN7Connecting the specific segment of the gene to an expression vector to construct a recombinant expression vector; and transforming the recombinant vector into microorganisms for culture expression, and then carrying out dip dyeing on the obtained transformant on the rape by adopting an hypocotyl transformation method.

10. The method of claim 9, wherein the microorganism is Agrobacterium GV 3101.

Images