CN111440797B

CN111440797B - Obtaining and application of inducible promoter

Info

Publication number: CN111440797B
Application number: CN202010278066.2A
Authority: CN
Inventors: 史锋; 谭书煜; 李永富
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-04-10
Filing date: 2020-04-10
Publication date: 2021-10-22
Anticipated expiration: 2040-04-10
Also published as: CN111440797A

Abstract

The invention discloses an obtaining method and application of an inducible promoter, belonging to the field of genetic engineering. The promoter induced by branched chain amino acid or L-methionine is obtained by screening through a forward-reverse selection method, the promoter and the upstream genome thereof are synthesized into a sensor, the sensor can obviously improve the synthesis amount of target protein, and the strength of the sensor is wild type P_brnFE2.3-6.5 times of the promoter. The promoter obtained by the screening can regulate the expression of an isoleucine dioxygenase encoding gene ido, and the yield of 4-hydroxyisoleucine is increased from 24.7mM to 28.9-77.8 mM.

Description

Obtaining and application of inducible promoter

Technical Field

The invention relates to the acquisition and application of an inducible promoter, belonging to the field of genetic engineering.

Background

Corynebacterium glutamicum is a non-spore-forming gram-positive bacterium, and has been regarded by researchers as being industrially used for the production of a large number of chemicals such as protein amino acids, non-protein amino acids, organic acids, alcohols, and terpenes. Corynebacterium glutamicum is a well-recognized safe food-grade producer, and its molecular genetic background information has been obtained as the genome of multiple strains of Corynebacterium glutamicum is sequenced. Subsequently, molecular genetic tools were developed and applied to the metabolic engineering of C.glutamicum in order to produce more valuable chemicals more efficiently or more valuable. However, most of the existing genetic tools are applied to static metabolic engineering, and few tools for the dynamic regulation and control of C.glutamicum are available. Inducible promoters have been widely developed and applied by researchers to metabolic engineering of microorganisms as part of a dynamic regulatory tool. Native inducible promoters are difficult to apply for metabolic engineering due to limitations in sensitivity and regulatory range, and need to be engineered to obtain more suitable, applicable inducible promoters. P in C.glutamicum_brnFEThis feature is provided.

Three branched chain amino acids of L-isoleucine, L-leucine and L-valine and L-methionine all belong to the amino groups essential to human bodyAnd (4) acid. These four amino acids are sensed by the transcriptional regulator of C.glutamicum Lrp, which is a transcriptional activator, whose downstream target gene is brnFE. When one of the four amino acids is combined with Lrp, the activity of transcription positive regulatory protein of Lrp is activated, and Lrp is enabled to be combined with P in intergenic region of Lrp and brnFE_brnFEThe-35 region and the upstream region of the promoter, and activates the transcription of the target gene brnFE, thereby synthesizing the outward transporters BrnF and BrnE of branched chain amino acid, and transporting the three branched chain amino acids to the outside of the cell. Due to the transcription regulatory factor Lrp and its target promoter P_brnFESensitive to branched chain amino acids and L-methionine, therefore Lrp-P was studied_brnFEThe system is developed into a specific dynamic sensor of branched chain amino acid and L-methionine, and is used for detecting the four amino acids or screening and constructing yield-increasing bacteria such as L-valine and the like. Wherein P is_brnFEIt can also be regarded as an inducible promoter induced by branched chain amino acids and L-methionine.

However, when the expression of the target gene is dynamically regulated in Corynebacterium glutamicum using this system, the expression of the target gene is regulated due to natural P_brnFEThe weak strength of the promoter makes the expression amount of the target gene not high, which limits its application. Therefore, how to increase Lrp-P_brnFEIn the sensor P_brnFEThe strength of the promoter, thereby improving the dynamic regulation and control capability and P of the system_brnFEThe strength of induction of the promoter remains an important technical problem.

The (2S,3R,4S) -4-hydroxyisoleucine (4-HIL) is a natural non-protein amino acid, has physiological effects of promoting insulin secretion, reducing insulin resistance, regulating dyslipidemia, improving liver function and the like, and has good application prospect in the aspect of treating diabetes and complications thereof. At present, the main preparation method of the 4-HIL is to extract from fenugreek seeds, but the yield is low, and the market demand is difficult to meet. Alpha-ketoglutarate-dependent Isoleucine Dioxygenase (IDO), also known as isoleucine hydroxylase, catalyzes the hydroxylation of L-isoleucine at position C4 to form 4-HIL. Introduction of Bacillus-derived IDO-encoding gene IDO into L-isoleucine-producing Glu by genetic engineeringThe corynebacterium acidocaldarium is expressed efficiently, and the L-isoleucine synthesized by the corynebacterium acidocaldarium is converted into 4-HIL by using IDO expressed by engineering bacteria, so that the production method of the 4-HIL is more economical and effective. However, since this method requires L-isoleucine, α -ketoglutaric acid, O₂And oxaloacetate and the like, and the substrates and precursors are often difficult to be supplied in a coordinated way during static metabolic engineering, so that the synthesis efficiency of the 4-HIL cannot be effectively improved. Dynamic regulation can overcome the defects, but the expression intensity of the existing dynamic regulation tool is too low to meet the requirements. Therefore, how to obtain an effective dynamic regulation tool and realize effective dynamic regulation of 4-HIL synthesis still remains an important technical problem.

Disclosure of Invention

Based on the existing problems, the invention obtains a series of enhanced promoters by screening through a forward-reverse selection method (double selection method), and optimizes an activator, the concentration range thereof, the concentration of a positive selection reagent and the like in the screening process so as to ensure that the promoter with the best performance is obtained by screening.

The invention mainly tests that the screened promoter is combined with the upstream protein Lrp thereof to form a sensor for increasing the synthesis of target protein, the sensor is applied to the synthesis of 4-HIL and alpha-ketoglutarate dependent Isoleucine Dioxygenase (IDO), and the sensor can also be applied to the metabolic engineering of any other related product which can be induced or activated by three branched chain amino acids of L-isoleucine, L-leucine and L-valine and L-methionine, and as long as P is P_brnFEIn the presence of an Lrp binding sequence, the Lrp can bind to P_brnFEIn the upper, regulation and control of P_brnFEDriving transcriptional activity.

The first purpose of the invention is to provide a promoter, and the nucleotide sequence of the promoter is shown in any one of SEQ ID NO. 1-6.

It is a second object of the present invention to provide a sensor induced by branched chain amino acids and L-methionine, which is composed of transcription regulatory factor Lrp and promoter P_brnFEComposition of, the promoter P_brnFENucleotide of (A)The sequence is shown in any one of SEQ ID NO. 1-6; wherein, P _brnFE1 is shown as SEQ ID NO.1, P _brnFE5 has the nucleotide sequence shown as SEQ ID NO.2, P _brnFE7 has the nucleotide sequence shown as SEQ ID NO.3, P_brnFEThe nucleotide sequence of 9 is shown as SEQ ID NO.4, P _brnFE13 is shown as SEQ ID NO.5, P_brnFEThe nucleotide sequence of 5D is shown in SEQ ID NO. 6; the nucleotide sequence of the coding gene Lrp of the transcription regulatory factor Lrp is shown as SEQ ID NO. 7.

In one embodiment, the transcription regulatory factor Lrp is associated with promoter P_brnFEExist in the same system.

In one embodiment, the gene encoding the transcription regulatory factor Lrp is present in the genome of the microorganism, or is linked to the promoter P_brnFEPresent on the same vector.

In one embodiment, the promoter consists of the transcription regulatory factor Lrp and the promoter P_brnFEOf composition lrp-P_brnFEThe sequence is shown as SEQ ID NO. 9-14; wherein lrp-P _brnFE1 nucleotide sequence is shown as SEQ ID NO.9, lrp-P _brnFE5 the nucleotide sequence is shown as SEQ ID NO.10, lrp-P _brnFE7 the nucleotide sequence is shown as SEQ ID NO.11, lrp-P _brnFE9 the nucleotide sequence is shown in SEQ ID NO.12, lrp-P _brnFE13 nucleotide sequence is shown in SEQ ID NO.13, lrp-P_brnFEThe 5D nucleotide sequence is shown in SEQ ID NO. 14.

The third purpose of the invention is to provide a promoter P containing a wild type promoter_brnFEThe starting plasmid of (1), said plasmid comprising an L-isoleucine sensor and a selectable marker; the L-isoleucine sensor is the transcription regulatory element lrp-P under the positive regulation of L-isoleucine_brnFEThe gene Lrp coding for the isoleucine transcription regulatory factor Lrp and the promoter P downstream thereof_brnFEComposition is carried out; the screening marker is tetracycline efflux protein, and the coding gene of the tetracycline efflux protein is tetA.

In one embodiment, the tetracycline efflux protein coding gene is the tetA gene shown in SEQ ID No. 16.

In one embodiment, the L-isoleucine sensor and the selectable marker contain an RBS sequence therebetween.

In one embodiment, the selectable marker includes, but is not limited to, the tetA gene encoding a tetracycline efflux protein.

In one embodiment, the sequence of the tetracycline efflux protein gene tetA is the GenBank accession No. AAB59735.1 sequence, SEQ ID No.16 nucleotide sequence.

The fourth purpose of the invention is to provide a promoter P containing a wild type promoter_brnFEThe method for constructing the starting plasmid comprises the following steps:

1) construction of L-isoleucine sensor: amplification of lrp-P from genomic DNA of C.glutamicum lactofermentum SN01 (accession No.: CCTCC NO: M2014410, published in the paper of Appl Microbiol Biotechnol,2015,99(9): 3851-3863)_brnFE(i.e., I);

2) construction of a selection marker tetA Gene: synthesizing a tetracycline efflux protein tetA gene (namely T) by adopting a chemical total synthesis method;

3) obtaining of starting plasmid of promoter induced by L-isoleucine: fusing the gene fragments constructed in the steps 1) and 2) into a fragment by an overlap extension PCR method, and cloning the fragment into a shuttle vector pJYW-5 to obtain a starting plasmid pIT of the promoter induced by L-isoleucine.

In one embodiment, the lrp-P_brnFEThe nucleotide of (A) is SEQ ID NO. 8.

In one embodiment, the nucleotide sequence of tetA is SEQ ID No. 16.

In one embodiment, the method for constructing the pJYW-5 plasmid is disclosed in the patent application No. CN 103834679B.

The fifth object of the present invention is to establish a mutant library of promoter induced by branched chain amino acid or L-methionine by amplifying the starting plasmid pIT by PCR and simultaneously amplifying P_brnFERandom mutation treatment is carried out on the-10 region and the spacer sequence between the-10 region and the-35 region of the promoter, so as to obtain a mutation library pIT_LibThe plasmid library is extracted from Escherichia coli, and introduced into Corynebacterium glutamicum by electrotransformation.

In one embodiment, the sequence of the mutations in the library is as shown in SEQ ID NO.15 (corresponding to 466-566bp of SEQ ID NO. 8).

In one embodiment, the number of randomly mutated sequences of the mutation library includes, but is not limited to, 17 bases.

In one embodiment, the type of randomly mutated sequence of the mutation library includes, but is not limited to, N bases.

In one embodiment, the Escherichia coli includes, but is not limited to JM 109.

In one embodiment, the C.glutamicum includes, but is not limited to, SN 01.

It is a sixth object of the present invention to screen strong promoters from mutant libraries of promoters induced by branched chain amino acids or L-methionine.

In one embodiment, in the forward screening, L-isoleucine and tetracycline are added to the medium, inducible P in the library_brnFEThe promoter activates tetA transcription, the cell obtains tetracycline resistance, and the cell survives; with increasing tetracycline concentration, P with increased activity is obtained_brnFEA promoter.

In one embodiment, in the reverse screening, the medium is supplemented with L-isoleucine, nickel chloride, inducible P in the library_brnFEThe promoter cannot activate the transcription of tetA, and cells which do not express tetA acquire nickel chloride resistance and survive; with increasing tetracycline concentration, P with increased activity is obtained_brnFEPromoter, if P is non-inducible in the library_brnFEThe promoter can still activate tetA transcription, and cells expressing tetracycline efflux protein are sensitive to nickel chloride and carry the non-inducible P_brnFECell death of the promoter.

In one embodiment, forward screening alternates with reverse screening.

In one embodiment, the forward screening is performed in combination with the reverse screening, including but not limited to five rounds of screening.

The seventh purpose of the invention is to provide a series of expression plasmids which are regulated and controlled by promoter induced by L-isoleucine and ido, wherein the plasmids comprise an L-isoleucine sensor and an isoleucine dioxygenase gene ido; the L-isoleucine sensor is the transcription regulatory element lrp-P under the positive regulation of L-isoleucine_brnFEThe gene Lrp coding for the isoleucine transcription regulatory factor Lrp and the promoter P downstream thereof_brnFE(including wild-type and mutant forms of P_brnFE) Composition is carried out; the sequence of the isoleucine dioxygenase gene ido is shown in SEQ ID NO. 17.

In one embodiment, the L-isoleucine sensor and ido contain an RBS sequence therebetween.

The eighth purpose of the present invention is to provide a method for constructing a series of expression plasmids under the control of ido expression by a promoter induced by L-isoleucine, comprising the following steps:

1) construction of L-isoleucine sensor: amplification of lrp-P from genomic DNA of C.glutamicum lactofermentum SN01 (accession No.: CCTCC NO: M2014410, published in the paper of Appl Microbiol Biotechnol,2015,99(9): 3851-3863)_brnFE(i.e., I); synthesis of mutant-containing P by chemical total synthesis_brnFElrp-P of N_brnFEN (i.e. I)_N)；

2) Construction of expressed genes: synthesizing isoleucine dioxygenase gene ido (namely D) by adopting a chemical total synthesis method, wherein the sequence is shown as SEQ ID NO. 17;

3) obtaining of expression plasmid whose expression is controlled by promoter induced by L-isoleucine ido: fusing the gene segments constructed in the steps 1) and 2) into a segment by an overlap extension PCR method, cloning the segment into a shuttle vector pJYW-5 to obtain a series of expression plasmids pID and pI expressed by ido regulated and controlled by a promoter induced by L-isoleucine_ND。

A ninth object of the present invention is to provide a method for increasing the amount of gene expression or protein synthesis, which comprises expressing the gene in a system containing a branched-chain amino acid and L-methionine using the sensor.

The invention also claims the mutant promoter obtained by screening to be used for regulating and controlling the expression of the gene ido encoding the isoleucine dioxygenase and producing 4-hydroxyisoleucine.

The invention provides a sensor of the promoter or the perception branched chain amino acid and the L-methionine, and the application of the sensor in the environment induced by the branched chain amino acid or the L-methionine.

In one embodiment, the application is induced by a branched chain amino acid or L-methionine to regulate the expression of other genes and the production of related products.

Has the advantages that: the present invention provides an inducible promoter that can be induced by a branched chain amino acid or L-methionine and has a strength of wild type P_brnFE2.3-6.5 times of the promoter. Using the promoters obtained from these screens to regulate the expression of the isoleucine dioxygenase-encoding gene ido, the yield of 4-hydroxyisoleucine could be increased from 24.7mM to 28.9-77.8 mM.

Drawings

FIG. 1 shows pIT plasmid containing a native promoter.

FIG. 2 is pIT containing promoter library_LibPlasmids and mutated regions and adjacent sequences of the library.

FIG. 3 shows the detection plasmid pIG or pI containing a native or mutated promoter_NG。

FIG. 4 shows the fluorescence intensity of GFP expressed from the native and mutant promoters.

FIG. 5 shows the pID or pI of a dynamically regulated plasmid containing a native or mutated promoter_ND。

FIG. 6 shows the 4-HIL production of strains dynamically regulated by native and mutant promoters.

Detailed Description

The pJYW-5 plasmid is described and published in patent application No. CN103834679B, a Corynebacterium expression System independent of antibiotic as selection pressure.

The kit used for PCR is purchased from Jiangsukang, a century Biotechnology Co., Ltd, and the specific operation steps are described in the kit specification.

The fluorescence intensity detection method comprises the following steps: the cell culture was diluted to an appropriate concentration, sampled and injected into a multi-well plate, and the fluorescence intensity was measured using a microplate reader. The specific parameters are that the excitation wavelength is 490nm (the bandwidth is 20nm), and the emission wavelength is 520nm (the bandwidth is 20 nm).

The detection method of 4-hydroxyisoleucine comprises the following steps: using HPLC pre-column derivatization: centrifuging the fermentation liquor at 12000r/min for 5min, treating the supernatant with 5% trichloroacetic acid for 4h, diluting 20 times, centrifuging at 12000r/min for 30min, filtering the supernatant with water system filter membrane, and measuring the sample with HPLC. The determination reagent is mobile phase water phase buffer A (1L): 3.01g of sodium acetate, 200 mu L of triethylamine and 5mL of tetrahydrofuran, and adjusting the pH value to 7.20 by using 10% acetic acid; organic phase buffer B (1L): after 3.01g of sodium acetate was dissolved in 200mL of ultrapure water, the pH was adjusted to 7.20 with 10% acetic acid, and 400mL of acetonitrile and 400mL of methanol were added. The gradient elution conditions were: 0min 8% buffer B, 20min 60% buffer B, 25min 100% buffer B, 28.5min 8% buffer B, 40 ℃ column temperature, 0.8mL/min flow rate.

Fermentation medium: glucose 140g/L, (NH)₄)₂SO₄30g/L, 10g/L corn steep liquor and KH₂PO₄ 1g/L，MgSO₄0.75g/L，FeSO₄ 1.5g/L，CaCO₃ 20g/L，pH 7.20。

Selecting a culture medium: glucose 25g/L, (NH)₄)₂SO₄30g/L, 10g/L corn steep liquor and KH₂PO₄ 1g/L，MgSO₄0.75g/L，FeSO₄1.5g/L，pH 7.20。

LBB medium: 2.5g/L of yeast extract, 5g/L of sodium chloride, 5g/L of peptone and 18.5g/L of brain-heart infusion.

Example 1: promoter P_brnFEConstruction of

(1) Promoter P_brnFEConstruction of the starting plasmid

Using genomic DNA of Corynebacterium glutamicum lactofermentum subspecies SN01 (strain preservation number: CCTCC NO: M2014410, described and published in the paper of Appl Microbiol Biotechnol,2015,99(9): 3851-3863) as a template, primers used were IF and IR, and an L-isoleucine sensor lrp-P was amplified_brnFENucleotide, its preparation and useThe sequence (i.e. I, the sequence is shown in SEQ ID NO. 8). The tetracycline efflux protein gene tetA (namely T, the sequence is shown in SEQ ID NO. 16) is synthesized by adopting a chemical total synthesis method. The IT fragment was obtained by overlap PCR of I and T using primers IF (restriction site NdeI underlined) and TR (restriction site EcoRI underlined).

IF：CGGTATTTCACACCGCATATGTTTGGTACCTCACACCTGGGGGCGAG，SEQ ID NO.19；

IR：TCATCCTATAACTCCTTCTCTCCAGGCTTGAATGAATC，SEQ ID NO.20；

TR：AGCTCGAATTCGTCGACTCCTTCAGGTCGAGGTGGCCCGG，SEQ ID NO.21。

An IT fragment is inserted between NdeI and EcoRI sites of the plasmid pJYW-5 to obtain a promoter P_brnFEThe starting plasmid pIT, as shown in FIG. 1.

(2) Promoter P_brnFEConstruction of a library of mutations of (3)

1) Taking the starting plasmid pIT as a template, using LibF and LibR as primers, amplifying a linear plasmid containing random mutation bases,

LibF：GNTANANTNGTAGTGTGCAAAAAACGCAAG，SEQ ID NO.22；

LibR：NNNNNNNNNNNNNAGTTTTGTTGCCAGTTTGCGC，SEQ ID NO.23；

2) recovering and purifying the linear plasmid, treating the linear plasmid by DpnI, then carrying out phosphorylation treatment, and then carrying out T4 DNA ligase treatment for 16h to obtain a plasmid ligation solution;

3) introducing the connecting solution into competent cells of Escherichia coli JM109 through chemical transformation, and culturing for 14 h;

4) extracting the plasmids in the cell culture solution to obtain a plasmid library pIT_LibAs shown in fig. 2;

5) the obtained plasmid library was electrically transduced into C.glutamicum SN01 competent cells to obtain a mutant library of L-isoleucine-inducible promoter.

(3) Screening of mutant library of promoter induced by L-isoleucine

1) Inoculating the Corynebacterium glutamicum containing the mutation library into a selective medium, adding 10mM L-isoleucine and 10mg/L tetracycline for forward screening, and culturing at 30 ℃ at 200r/min for 24 h;

2) harvesting the above cultured cells, washing the cells twice with sterile physiological saline, inoculating all the cells to a fresh selection medium, adding 30mg/L kanamycin sulfate, and culturing at 30 deg.C for 8h at 200 r/min;

3) the cells were inoculated into fresh medium at 5% inoculum size and 0.3mM NiCl was added₂Performing reverse screening, and culturing at 30 deg.C at 200r/min for 24 hr;

4) harvesting the above cultured cells, washing the cells twice with sterile physiological saline, inoculating all the cells to a fresh selection medium, adding 30mg/L kanamycin sulfate, and culturing at 30 deg.C for 8h at 200 r/min; completing a round of forward and backward screening through the 4 steps;

5) inoculating the cells into a fresh culture medium according to the inoculation amount of 5%, adding 10mM L-isoleucine and 20mg/L tetracycline for forward screening, and culturing at 30 ℃ for 24h at 200 r/min; continuously repeating the steps 2-4) to finish another round of forward and backward screening;

6) and repeating the steps to finish the next round of forward and backward screening. In the forward screening, the concentration of L-isoleucine is 10mM, and the concentration of tetracycline is increased by 10mg/L in each round; in reverse screening, NiCl₂The concentration of the addition was 0.3 mM. Five rounds of screening are carried out in total, so that the concentration of tetracycline is increased to 60mg/L when screening is carried out;

7) coating the bacterial liquid obtained in the last round of reverse screening on an LBB flat plate containing 30mg/L kanamycin sulfate, and randomly selecting 16 single bacteria from the flat plate for sequencing;

8) according to the sequencing result, single colonies with the same sequencing result are classified into the same strain, so that 6 mutant promoters are obtained, the sequences are shown as SEQ ID NO. 1-6, the mutant regions are located in a spacer region between a-35 region and a-10 region and the-10 region, and the binding sites (-35 region and the upstream region thereof) with the upstream Lrp gene are not changed, so that the binding of the Lrp and the promoters is not influenced.

Example 2: functional verification of L-isoleucine-induced promoter

(1) Probe plasmid construction of L-isoleucine-inducible promoter

Amplifying wild type L-isoleucine sensor lrp-P by using genome DNA of SN01 as a template and using primers of IF and IR_brnFEThe nucleotide sequence of (I) is shown in SEQ ID NO. 8.

Synthesis of L-isoleucine sensor lrp-P containing sequence of mutant promoter by chemical total synthesis method_brnFEN (N is #1, #5, #7, #9, #13 and #5D, i.e. I_N)，lrp-P _brnFE1 nucleotide sequence is shown as SEQ ID NO.9, lrp-P _brnFE5 the nucleotide sequence is shown as SEQ ID NO.10, lrp-P _brnFE7 the nucleotide sequence is shown as SEQ ID NO.11, lrp-P _brnFE9 the nucleotide sequence is shown in SEQ ID NO.12, lrp-P _brnFE13 nucleotide sequence is shown in SEQ ID NO.13, lrp-P_brnFEThe 5D nucleotide sequence is shown in SEQ ID NO. 14.

The fluorescent reporter gene gfp (namely G, the sequence is shown in SEQ ID NO. 18) is synthesized by a chemical total synthesis method. I or I_NPerforming overlap PCR with G to obtain IG or I_NG fragment, the primers used were IF (restriction sites NdeI underlined) and GR (restriction site BamHI underlined).

IF：CGGTATTTCACACCGCATATGTTTGGTACCTCACACCTGGGGGCGAG，SEQ ID NO.19；

GR：ATAGGATCCCTATTTGTATAGTTCATCC，SEQ ID NO.24。

The IG or I is inserted between the NdeI and BamHI sites of the plasmid pJYW-5_NG fragment, resulting in the detection plasmid pIg or pI of the promoter induced by L-isoleucine_NG, as shown in FIG. 3.

(2) Activity measurement of promoter induced by L-isoleucine

The detection plasmids pIG and pI_NG is electrically transduced into SN01 strain to obtain SN01/pIG and SN01/pI_NG. SN01/pIG and SN01/pI_NG was activated by LBB medium culture and expressed as final OD₅₆₂Transferring the strain to a fresh LBB culture medium for 0.1, culturing for 6-8 h until logarithmic phase, and harvesting 200 mu L of bacterial liquid. The cells were washed twice with sterile physiological saline and SN01/pIG was added with L-isoleucine at final concentrations of 1mM, 5mM, 10mM and 15 mM; SN01/pI_NG L-isoleucine was added to a final concentration of 1 mM.At intervals, SN01/pIG and SN01/pI were measured_NFluorescence intensity of G.

Wild type P_brnFEThe concentration of the promoter responding to the external L-isoleucine is 1-10mM, and the activation multiple is from 1.40 times to 2.30 times.

As shown in FIG. 4, 6 mutant forms of P_brnFEN promoter after addition of 1mM L-isoleucine, P _brnFE1 promoter was 3.60 times as active as that before addition of L-isoleucine, P _brnFE5 promoter activity was 4.00 times that before addition of L-isoleucine, P _brnFE7 promoter was 5.61 times as active as that before addition of L-isoleucine, P _brnFE9 promoter activity was 2.39 times that before addition of L-isoleucine, P _brnFE13 promoter activity was 2.36 times that before addition of L-isoleucine, P_brnFEThe activity of the 5D promoter was 6.47 times higher than that before addition of L-isoleucine than that of the wild-type P promoter_brnFEActivation fold of promoter (1.40 fold).

Example 3: promoter P _brnFE1 application in dynamic regulation and control of ido expression

(1) Promoter P _brnFE1 construction of expression plasmid for dynamic control of ido

Amplifying wild type L-isoleucine sensor lrp-P by using genome DNA of SN01 as a template and using primers of IF and IR_brnFE(i.e., I), the nucleotide sequence of which is shown in SEQ ID NO. 8.

Synthesis of L-isoleucine sensor lrp-P containing sequence of mutant promoter by chemical total synthesis method _brnFE1, and the nucleotide sequence is shown as SEQ ID NO. 9.

Isoleucine dioxygenase gene ido (namely D, the sequence is shown in SEQ ID NO. 17) is synthesized by a chemical total synthesis method. I or I_NObtaining ID or I by overlapping PCR with D_ND, using primers of IF and DR.

IF：CGGTATTTCACACCGCATATGTTTGGTACCTCACACCTGGGGGCGAG，SEQ ID NO.19；

IR：TCATCCTATAACTCCTTCTCTCCAGGCTTGAATGAATC，SEQ ID NO.20；

DR：CACGGGATCCTTATTTTGTCTCCTTATAAG，SEQ ID NO.25。

The ID or I is inserted between NdeI and BamHI sites of the plasmid pJYW-5_ND fragment, obtaining expression plasmids pID and pI for dynamically regulating and controlling ido expression according to L-isoleucine concentration₁D, as shown in FIG. 5.

(2) Dynamic regulation and control of 4-hydroxyisoleucine fermentation of ido-expressing strain by L-isoleucine sensor

ido encodes isoleucine dioxygenase which hydroxylates the C4 position of L-isoleucine to produce 4-hydroxyisoleucine. The expression plasmids pID and pI_ND was transduced into SN01 strain as final OD₅₆₂Inoculating the strain with the inoculation amount of 1.8 into a fermentation medium, fermenting at 30 ℃ and 200rpm for 144h, and measuring the concentration of 4-hydroxyisoleucine in the fermentation liquid.

As shown in FIG. 6, the yield of 4-hydroxyisoleucine was 24.67mM for strain SN01/pID, and for strain SN01/pI₁The yield of 4-hydroxyisoleucine from D was increased to 46.55 mM.

Example 4: promoter P _brnFE5 application in dynamic regulation and control of ido expression

(1) Promoter P_brnFEConstruction of expression plasmid for 5 dynamic control of ido

See example 3 step (1) except that the L-isoleucine sensor lrp-P containing a sequence of a mutant promoter was synthesized using a chemical total synthesis method _brnFE5，lrp-P _brnFE5 the nucleotide sequence is shown in SEQ ID NO.10, and the expression plasmid pI which can dynamically regulate ido expression according to the concentration of L-isoleucine is obtained₅D。

See example 3 step (2) for specific embodiments, except that the expression plasmid pI is₅D is electrically transduced into SN01 strain to obtain SN01/pI strain₅D, mixing the strain SN01/pI₅And D, inoculating the mixture into a fermentation medium, and fermenting.

Strain SN01/pI₅The yield of 4-hydroxyisoleucine for D was 61.28 mM.

Example 5: promoter P_brnFEApplication of 7 in dynamic regulation and control of ido expression

(1) Promoter P_brnFEConstruction of expression plasmid for 7 dynamic control of ido

Detailed description of the preferred embodimentsa difference in step (1) of example 3 is that the L-isoleucine sensor lrp-P containing a sequence of a mutant promoter was synthesized using a chemical total synthesis method _brnFE7，lrp-P _brnFE7 nucleotide sequence is shown as SEQ ID NO.11, and the expression plasmid pI which can dynamically regulate ido expression according to L-isoleucine concentration is obtained₇D。

See example 3 step (2) for specific embodiments, except that the expression plasmid pI is₇D is electrically transduced into SN01 strain to obtain SN01/pI strain₇D, mixing the strain SN01/pI₇And D, inoculating the mixture into a fermentation medium, and fermenting.

Strain SN01/pI₇The yield of 4-hydroxyisoleucine for D was 74.40 mM.

Example 6: promoter P_brnFEApplication of 9 in dynamically regulating expression of ido

(1) Promoter P _brnFE9 construction of expression plasmid for dynamic control of ido

Detailed description of the preferred embodimentsa difference in step (1) of example 3 is that the L-isoleucine sensor lrp-P containing a sequence of a mutant promoter was synthesized using a chemical total synthesis method _brnFE9，lrp-P_brnFEThe nucleotide sequence of 9 is shown in SEQ ID NO.12, and the expression plasmid pI which can dynamically regulate ido expression according to the concentration of L-isoleucine is obtained₉D。

See example 3 step (2) for specific embodiments, except that the expression plasmid pI is₉D is electrically transduced into SN01 strain to obtain SN01/pI strain₉D, mixing the strain SN01/pI₉And D, inoculating the mixture into a fermentation medium, and fermenting.

Strain SN01/pI₉The yield of 4-hydroxyisoleucine of D was 28.89mM。

Example 7: promoter P _brnFE13 application in dynamically regulating ido expression

(1) Promoter P_brnFEConstruction of expression plasmid for dynamic control of ido

Detailed description of the preferred embodimentsa difference in step (1) of example 3 is that the L-isoleucine sensor lrp-P containing a sequence of a mutant promoter was synthesized using a chemical total synthesis method _brnFE13，lrp-P_brnFEThe nucleotide sequence of 13 is shown in SEQ ID NO.13, and the expression plasmid pI which can dynamically regulate ido expression according to the concentration of L-isoleucine is obtained₁₃D。

See example 3 step (2) for specific embodiments, except that the expression plasmid pI is₁₃D is electrically transduced into SN01 strain to obtain SN01/pI strain₁₃D, mixing the strain SN01/pI₁₃And D, inoculating the mixture into a fermentation medium, and fermenting.

Strain SN01/pI₁₃The yield of 4-hydroxyisoleucine for D was 31.04 mM.

Example 8: promoter P_brnFEApplication of 5D in dynamic regulation and control of ido expression

(1) Promoter P_brnFEConstruction of expression plasmid for 5D dynamic control of ido

Detailed description of the preferred embodimentsa difference in step (1) of example 3 is that the L-isoleucine sensor lrp-P containing a sequence of a mutant promoter was synthesized using a chemical total synthesis method _brnFE5D，lrp-P_brnFEThe 5D nucleotide sequence is shown in SEQ ID NO.14, and the expression plasmid pI which is dynamically regulated and controlled ido expression according to the L-isoleucine concentration is obtained_5DD。

See example 3 step (2) for specific embodiments, except that the expression plasmid pI is_5DD is electrically transduced into SN01 strain to obtain SN01/pI strain_5DD, mixing the strain SN01/pI_5DAnd D, inoculating the mixture into a fermentation medium, and fermenting.

Strain SN01/pI_5DThe yield of 4-hydroxyisoleucine for D was 77.85 mM.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> obtaining of inducible promoter and application thereof

<160> 25

<170> PatentIn version 3.3

<210> 1

<211> 100

<212> DNA

<213> Artificial sequence

<400> 1

aatagcctag ttgaggtgcg caaactggca acaaaactca acaaaggtag ggtagagtgg 60

tagtgtgcaa aaaacgcaag agattcattc aagcctggag 100

<210> 2

<211> 101

<212> DNA

<213> Artificial sequence

<400> 2

aatagcctag ttgaggtgcg caaactggca acaaaactgt gtaaaatgtg tgttatactg 60

gtagtgtgca aaaaacgcaa gagattcatt caagcctgga g 101

<210> 3

<211> 96

<212> DNA

<213> Artificial sequence

<400> 3

aatagcctag ttgaggtgcg caaactggca acaaaactga ctatggggta tattggtagt 60

gtgcaaaaaa cgcaagagat tcattcaagc ctggag 96

<210> 4

<211> 96

<212> DNA

<213> Artificial sequence

<400> 4

aatagcctag ttgaggtgcg caaactggca acaaaactcg taaagagcta gagttgtagt 60

gtgcaaaaaa cgcaagagat tcattcaagc ctggag 96

<210> 5

<211> 96

<212> DNA

<213> Artificial sequence

<400> 5

aatagcctag ttgaggtgcg caaactggca acaaaactta ggagtaacta gactagtagt 60

gtgcaaaaaa cgcaagagat tcattcaagc ctggag 96

<210> 6

<211> 165

<212> DNA

<213> Artificial sequence

<400> 6

aatagcctag ttgaggtgcg caaactggca acaaaactac ccggcaattg tgtgatgatt 60

gtagtgtgca aaaaacgcaa tgcgcaaact ggcaacaaaa ctgtgtaaaa tgtgtgttat 120

actggtagtg tgcaaaaaac gcaagagatt cattcaagcc tggag 165

<210> 7

<211> 465

<212> DNA

<213> C. glutamicum ssp. lactofermentum

<400> 7

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcac 465

<210> 8

<211> 566

<212> DNA

<213> C. glutamicum ssp. lactofermentum

<400> 8

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcacaatag cctagttgag 480

gtgcgcaaac tggcaacaaa actacccggc aattgtgtga tgattgtagt gtgcaaaaaa 540

cgcaagagat tcattcaagc ctggag 566

<210> 9

<211> 565

<212> DNA

<213> Artificial sequence

<400> 9

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcacaatag cctagttgag 480

gtgcgcaaac tggcaacaaa actcaacaaa ggtagggtag agtggtagtg tgcaaaaaac 540

gcaagagatt cattcaagcc tggag 565

<210> 10

<211> 566

<212> DNA

<213> Artificial sequence

<400> 10

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcacaatag cctagttgag 480

gtgcgcaaac tggcaacaaa actgtgtaaa atgtgtgtta tactggtagt gtgcaaaaaa 540

cgcaagagat tcattcaagc ctggag 566

<210> 11

<211> 561

<212> DNA

<213> Artificial sequence

<400> 11

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcacaatag cctagttgag 480

gtgcgcaaac tggcaacaaa actgactatg gggtatattg gtagtgtgca aaaaacgcaa 540

gagattcatt caagcctgga g 561

<210> 12

<211> 561

<212> DNA

<213> Artificial sequence

<400> 12

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcacaatag cctagttgag 480

gtgcgcaaac tggcaacaaa actcgtaaag agctagagtt gtagtgtgca aaaaacgcaa 540

gagattcatt caagcctgga g 561

<210> 13

<211> 561

<212> DNA

<213> Artificial sequence

<400> 13

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcacaatag cctagttgag 480

gtgcgcaaac tggcaacaaa acttaggagt aactagacta gtagtgtgca aaaaacgcaa 540

gagattcatt caagcctgga g 561

<210> 14

<211> 630

<212> DNA

<213> Artificial sequence

<400> 14

tcacacctgg gggcgagctg gtttcaccac tttcatagca aaacgtgatg agatctttgc 60

aattcctggc acggtttgaa tgtgactgga taaaaattgc tcatacgcct ccaaatcagc 120

aacgccgatg cgaacaaaat aatctggcga accaaaaagc ctgtgcaact ccagtacttc 180

atcatgctgc gcaacggagc tttcaaaatt gtctacagtg gagcggtcga agttgctgag 240

agtgacatcc acggtcacct caaatccacg attcatcacc gcagggtgaa tgtccgcgct 300

gtagcccaaa atgattcctt cggcttccaa acgctgcacc ctcctcaagc aaggtcccgg 360

agtgagatgc accttgtcag ccagtgcgag atttgagatg cgcgcattcg cgctaagctc 420

cgcaataatt gcgcaatcaa tggaatctag cttcatatat tgcacaatag cctagttgag 480

gtgcgcaaac tggcaacaaa actacccggc aattgtgtga tgattgtagt gtgcaaaaaa 540

cgcaatgcgc aaactggcaa caaaactgtg taaaatgtgt gttatactgg tagtgtgcaa 600

aaaacgcaag agattcattc aagcctggag 630

<210> 15

<211> 101

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (39)..(51)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (53)..(53)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (56)..(56)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (58)..(58)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (60)..(60)

<223> n is a, c, g, or t

<400> 15

aatagcctag ttgaggtgcg caaactggca acaaaactnn nnnnnnnnnn ngntanantn 60

gtagtgtgca aaaaacgcaa gagattcatt caagcctgga g 101

<210> 16

<211> 1191

<212> DNA

<213> Artificial sequence

<400> 16

atgaaatcta acaatgcgct catcgtcatc ctcggcaccg tcaccctgga tgctgtaggc 60

ataggcttgg ttatgccggt actgccgggc ctcttgcggg atatcgtcca ttccgacagc 120

atcgccagtc actatggcgt gctgctagcg ctatatgcgt tgatgcaatt tctatgcgca 180

cccgttctcg gagcactgtc cgaccgcttt ggccgccgcc cagtcctgct cgcttcgcta 240

cttggagcca ctatcgacta cgcgatcatg gcgaccacac ccgtcctgtg gatcctctac 300

gccggacgca tcgtggccgg catcaccggc gccacaggtg cggttgctgg cgcctatatc 360

gccgacatca ccgatgggga agatcgggct cgccacttcg ggctcatgag cgcttgtttc 420

ggcgtgggta tggtggcagg ccccgtggcc gggggactgt tgggcgccat ctccttgcat 480

gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc tactactggg ctgcttccta 540

atgcaggagt cgcataaggg agagcgtcga ccgatgccct tgagagcctt caacccagtc 600

agctccttcc ggtgggcgcg gggcatgact atcgtcgccg cacttatgac tgtcttcttt 660

atcatgcaac tcgtaggaca ggtgccggca gcgctctggg tcattttcgg cgaggaccgc 720

tttcgctgga gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc 780

ctcgctcaag ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt 840

atcgccggca tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc 900

tggatggcct tccccattat gattcttctc gcttccggcg gcatcgggat gcccgcgttg 960

caggccatgc tgtccaggca ggtagatgac gaccatcagg gacagcttca aggatcgctc 1020

gcggctctta ccagcctaac ttcgatcact ggaccgctga tcgtcacggc gatttatgcc 1080

gcctcggcga gcacatggaa cgggttggca tggattgtag gcgccgccct ataccttgtc 1140

tgcctccccg cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg a 1191

<210> 17

<211> 720

<212> DNA

<213> Artificial sequence

<400> 17

atgaaaatga gtggctttag catagaagaa aaggtacatg aatttgaatc taaaggattc 60

cttgaaattt caaatgaaat ctttttacaa gaggaagaga atcatcgtct attaacacaa 120

gcacagttag attattataa tttggaagat gatgcatacg gtgaatgtcg tgctagatct 180

tattcaaggt atataaagta tgttgattca ccagattata ttttagataa tagtaatgat 240

tacttccaat ctaaagaata taactatgac gatggcggga aagttagaca gttcaatagc 300

ataaatgata gctttttatg taatccttta attcaaaata tcgtgcgctt cgatactgaa 360

tttgcattta aaacaaatat aatagataca agtaaagact taattatagg tttacatcaa 420

gtaagatata aagctactaa agaaagacca tcttttagtt cacctatttg gttacataaa 480

gatgatgaac cagtagtgtt tttacacctt atgaatttaa gtaatacagc tattggtgga 540

gataatttaa tagctaattc tcctcgggaa attaatcagt ttataagttt gaaggagcct 600

ttagaaactt tagtatttgg acaaaaggtc ttccatgccg taacgccact tggaacagaa 660

tgtagtacgg aggcttttcg tgatatttta ttagtaacat tttcttataa ggagacaaaa 720

<210> 18

<211> 717

<212> DNA

<213> Artificial sequence

<400> 18

atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60

gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120

aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180

gtcactactt tctcttatgg tgttcaatgc ttttcaagat acccagatca catgaaacgg 240

catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaaagaac tatatttttc 300

aaagatgacg ggaactacaa gacacgtgct gaagtcaagt ttgaaggtga tacccttgtt 360

aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct tggacacaaa 420

ttggaataca actataactc acacaatgta tacatcatgg cagacaaaca aaagaatgga 480

atcaaagtta acttcaaaat tagacacaac attgaagatg gaagcgttca actagcagac 540

cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600

ctgtccacac aatctgccct ttcgaaagat cccaacgaaa agagagacca catggtcctt 660

cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaatag 717

<210> 19

<211> 47

<212> DNA

<213> Artificial sequence

<400> 19

cggtatttca caccgcatat gtttggtacc tcacacctgg gggcgag 47

<210> 20

<211> 38

<212> DNA

<213> Artificial sequence

<400> 20

tcatcctata actccttctc tccaggcttg aatgaatc 38

<210> 21

<211> 40

<212> DNA

<213> Artificial sequence

<400> 21

agctcgaatt cgtcgactcc ttcaggtcga ggtggcccgg 40

<210> 22

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (2)..(2)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (7)..(7)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (9)..(9)

<223> n is a, c, g, or t

<400> 22

gntanantng tagtgtgcaa aaaacgcaag 30

<210> 23

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (1)..(13)

<223> n is a, c, g, or t

<400> 23

nnnnnnnnnn nnnagttttg ttgccagttt gcgc 34

<210> 24

<211> 28

<212> DNA

<213> Artificial sequence

<400> 24

ataggatccc tatttgtata gttcatcc 28

<210> 25

<211> 30

<212> DNA

<213> Artificial sequence

<400> 25

cacgggatcc ttattttgtc tccttataag 30

Claims

1. The inducible promoter is characterized in that the nucleotide sequence is shown as any one of SEQ ID NO. 1-6.

2. A sensor induced by a branched-chain amino acid or L-methionine, wherein the sensor consists of a transcription regulatory factor Lrp and a promoter of a target gene downstream thereof; the nucleotide sequence for coding the transcription regulatory factor Lrp is shown as SEQ ID NO. 7; the nucleotide sequence of the promoter of the downstream target gene is shown in any one of SEQ ID NO. 1-6.

3. The sensor according to claim 2, wherein the transcription regulatory factor Lrp and the downstream target promoter thereof are present in the same system, and the same system is the same cell.

4. The sensor according to claim 3, wherein the gene of the transcription regulatory factor Lrp is present on the genome of the host cell and the downstream target promoter thereof is present on a vector of the host cell, or the gene of the transcription regulatory factor Lrp and the downstream target promoter thereof are present on the same vector.

5. A vector or host cell comprising the promoter of claim 1.

6. A vector or host cell comprising the sensor of claim 2.

7. A method for increasing the amount of gene expression or protein synthesis, which comprises inducing gene expression using the sensor according to claim 2.

8. The method of claim 7, wherein the cells containing the sensor are cultured in an environment containing branched chain amino acids or L-methionine to promote gene expression.

9. Use of a promoter according to claim 1, or a sensor according to any one of claims 2 to 4, or a vector or host cell according to any one of claims 5 to 6 in an environment induced by branched chain amino acids or L-methionine.

10. The use according to claim 9, wherein the use is induced by a branched chain amino acid or L-methionine to regulate the expression of other genes encoding isoleucine dioxygenase gene ido and the production of related products 4-hydroxyisoleucine.