CN106148336B - Novel L-threonine-inducible promoter and its application - Google Patents
Novel L-threonine-inducible promoter and its application Download PDFInfo
- Publication number
- CN106148336B CN106148336B CN201510160543.4A CN201510160543A CN106148336B CN 106148336 B CN106148336 B CN 106148336B CN 201510160543 A CN201510160543 A CN 201510160543A CN 106148336 B CN106148336 B CN 106148336B
- Authority
- CN
- China
- Prior art keywords
- promoter
- threonine
- gene
- cysjp
- cyshp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention provides a kind of novel L-threonine-inducible promoters and its application, specifically, construction, carrier and host cell the present invention provides novel L-threonine-inducible promoter and comprising the promoter, the promoter can be induced by threonine.The novel L-threonine inducible promoter nucleic acid molecule of the present invention can induce the transcript and expression that may be operably connected to target gene thereon, therefore be conducive to the controllable production of target RNA and albumen.
Description
Technical field
The present invention relates to field of biotechnology, and specifically, the present invention relates to novel L-threonine-inducible promoters
It nucleic acid molecules, the carrier comprising the nucleic acid molecules, the host cell containing the nucleic acid molecules and is induced using the nucleic acid molecules
The method of target gene transcriptional expression.
Background technique
Escherichia coli are widely used in animal feed industries, pharmaceuticals industry, chemical industry as a kind of important industrial microorganism
The production of multi-chemical in industry and similar industry, the chemicals include L-Aspartic acid, L-threonine, the bad ammonia of L-
The amino acid such as acid, l-Isoleucine.In order to obtain efficient industrial use large intestine by means such as genetic engineering or metabolic engineerings
Bacillus can use the expression of the selectable controlling gene of suitable promoter, therefore, it is very heavy obtain suitable promoter
It wants.
L-threonine is a kind of intracorporal important compound of biology, the e.g. downstream in L-Aspartic acid metabolic pathway
Close one of the upstream compound in one of object and l-Isoleucine route of synthesis.It therefore, can be directly or indirectly to L- Soviet Union ammonia
The promoter that the concentration of acid is responded can be used in the acquisition of industrial strain, such as be used to chemicals for the promoter
Synthesis or the expression of metabolism related gene, so that it may realize that the expression intensity of the gene is mutually coupled with threonine concentration, to have
Conducive to the production of the chemicals.
Had the example by metabolism induction type promoter regulation gene expression, including had research by using
The proteomic analytical methods of 2 dimension gel electrophoresises obtain L-lysine-inducible promoter in bar shaped bacteria
(CN101087881B).Although people to the understanding of promoter in Escherichia coli far more than Corynebacterium glutamicum, at present
There are no L-threonine-inducible promoter reports in good identification enterobacteria.
Summary of the invention
The purpose of the present invention is to provide a kind of novel L-threonine-inducible promoters and its application.
The first aspect of the present invention, provides a kind of promoter element, and the promoter element includes cysJP promoter
And/or cysHP promoter.
In another preferred example, the promoter element is the promoter, fusion of cysJP promoter and cysHP promoter.
In another preferred example, the promoter element is the promoter, fusion of cysJP promoter and cysHP promoter
The structure of cysJHP, the promoter, fusion cysJHP are as shown in Formulas I a or Ib:
Formulas I a:J-L-H；Formulas I b:H-L-J
In formula, J is the nucleotide sequence for including cysJP promoter；
H is the nucleotide sequence for including cysHP promoter；
L is optionally catenation sequence.
In another preferred example, the starting intensity of the promoter element is regulated and controled by threonine；Also,
The promoter element is selected from the group:
(A) nucleotide sequence polynucleotides as shown in SEQ ID NO:1,2,3,12 or 13；
(B) sequence shown in nucleotide sequence and SEQ ID NO:1,2,3,12 or 13 homology >=95% (preferably >=
98%), and start the polynucleotides that intensity is regulated and controled by threonine；
(C) end 5' and/or the end 3' of the polynucleotides as shown in SEQ ID NO:3,12 or 13 truncate 1-60 (preferably
1-30, more preferably 1-6) nucleotide；
(E) polynucleotides complementary with (A)-(D) any polynucleotides.
In another preferred example, the starting intensity refers to, encoding gene transcriptional expression is horizontal downstream for promoter regulation
Ability, starting enhanced strength then downstream coding gene transcriptional expression level improve, starting remitted its fury then downstream encode base
The transcriptional expression level of cause reduces.
The second aspect of the present invention, provides a kind of nucleic acid molecules, and the nucleic acid molecules contain first aspect present invention institute
The promoter element stated, and contain target gene in the promoter element downstream.
In another preferred example, the target gene includes one or more albumen or the encoding gene of RNA.
In a preferred embodiment, the promoter element and downstream the combination of target gene in natural shape
Under state and it is not present.
In another preferred example, the representative example of the target gene includes but is not limited to: metabolism, adjusting function phase
Correlation gene, resistant gene, tolerance related gene, fluorescence protein gene and rna gene.
In another preferred embodiment, the metabolism, adjusting function related gene are selected from the group: Embden-Meyerhof-Parnaspathway
Diameter, tricarboxylic acid cycle, the amino acid synthesis pathways such as aspartic acid, threonine, isoleucine, lysine, methionine, Yi Jiduo
Kind may be to threonine synthesis or degrade directly or indirectly relevant pathway protein and its regulatory protein gene.
In another preferred embodiment, the resistant gene is selected from the group: chloramphenicol, ampicillin, Fourth Ring
The antibiotics resistance genes such as element, hygromycin, neomycin, antiviral gene etc..
In another preferred embodiment, the tolerance related gene is selected from the group: high-temperature-resistant high-salt etc. and ring
Relevant gene of border tolerance etc..
In another preferred embodiment, the fluorescence protein gene is selected from the group: red fluorescent protein, green are glimmering
The fluorescence protein genes such as photoprotein, yellow fluorescence protein.
In another preferred embodiment, the rna gene is selected from the group: RNAi gene, microRNA etc..
The third aspect of the present invention provides a kind of expression cassette, and the expression cassette successively has following elements from 5' to 3':
Promoter element described in first aspect present invention, gene ORF sequence and terminator.
In a preferred embodiment, the expression cassette further includes one or more elements selected from the group below: poly (A)
Element, enhancer, transhipment element or gene target element.
The fourth aspect of the present invention, provides a kind of carrier, and the carrier contains starting described in first aspect present invention
Expression cassette described in nucleic acid molecules described in subcomponent or second aspect of the present invention or third aspect present invention.
In a preferred embodiment, the carrier is selected from: bacterial plasmid, bacteriophage, yeast plasmid or plant cell disease
Poisonous carrier, shuttle vector.
The fifth aspect of the present invention, provides a kind of host cell, and the host cell contains invention the 4th
In addition to promoter element described in the first aspect present invention that contains under native state on carrier described in aspect or its chromosome
It is also integrated with promoter element described in additional first aspect present invention outside or is integrated with core described in second aspect of the present invention
Acid molecule is integrated with expression cassette described in third aspect present invention.
In a preferred embodiment, (preferable 1-50 is a, more preferably 2-6 with one or more for the host cell
It is a) copy promoter element described in claim 1.
In another preferred embodiment, the host cell is selected from the group: prokaryotic cell (such as Escherichia coli, paddy
Propylhomoserin bar bacterium, brevibacterium flavum, streptomyces or Agrobacterium), low eukaryocyte (such as yeast cells) or Higher eukaryotic
Cell (such as plant cell).
In another preferred example, the host cell is Escherichia coli or Corynebacterium glutamicum.
The sixth aspect of the present invention provides promoter element described in first aspect present invention, second aspect of the present invention
The purposes of carrier described in expression cassette described in the nucleic acid molecules, third aspect present invention or fourth aspect present invention, institute
It is selected from the group below one or more for stating purposes:
(a) for expressing target gene in host cell, wherein the target gene and promoter operability
Connection, and the starting intensity of the promoter is by the regulation of threonine；
(b) the transcriptional expression system that building starting intensity is regulated and controled by threonine.
The seventh aspect of the present invention provides a kind of method of regulation target gene transcriptional expression level, the method packet
Include following steps:
(a) construction, the power that the construction contains target gene and is operatively connected with the target gene are provided
Benefit require 1 described in promoter element；
(b) construction for obtaining step (a) imports host cell, obtains the host cell of conversion；
(c) described in addition threonine or the threonine by host cell itself synthesis enhance in host cell cultures
The starting intensity of promoter.
In another preferred example, in the host cell cultures threonine concentration >=3g/L, preferably >=5g/L, more
Preferably >=10g/L, in the host cell cultures concentration of threonine can for 15g/L, 20g/L, 30g/L, 50g/L,
70g/L。
In another preferred example, the host cell is Escherichia coli, it is therefore preferable to Escherichia coli MG1655 and its mutation
Bacterial strain.
In another preferred example, include the following steps: in the step (a)
(a1) using genome of E.coli as template, PCR amplification cysJP promoter, cysHP promoter or comprising
The promoter, fusion of cysJP and cysHP；
(a2) foreign gene polynucleotide passage described in PCR amplification；
(a3) it is operatively connected the promoter and the foreign gene polynucleotide passage obtains the construction.
In another preferred example, in the step (a1) PCR amplification cysJP promoter primer sequence are as follows:
CGCCCTAGGATCCGTTGCGCAAAATCGCTGATTTATC, and
CAAGCGACGCCAGGATTTCCGGTAAGCAAAGCTGTTTCTG。
In another preferred example, in the step (a1) PCR amplification cysHP promoter primer sequence are as follows:
CAGAAACAGCTTTGCTTACCGGAAATCCTGGCGTCGCTTG, and
TTACCGCGCGGTGCCTTGCCTGATGCGAC。
In another preferred example, in the step (a1) promoter, fusion of PCR amplification cysJP and cysHP primer sequence
It is classified as:
CGCCCTAGGATCCGTTGCGCAAAATCGCTGATTTATC, and
TTACCGCGCGGTGCCTTGCCTGATGCGAC。
The eighth aspect of the present invention provides a kind of purposes of threonine, is used to prepare the starting intensity of regulation promoter
Adjusting control agent or starting intensity for regulating and controlling promoter, wherein the promoter is selected from the group: cysJP promoter, cysHP
Promoter and/or promoter, fusion comprising cysJP and cysHP.
In another preferred example, the polynucleotides of the cysJP promoter are selected from the group:
(a) sequence polynucleotides as shown in SEQ ID NO.:1；
(b) multicore of nucleotide sequence and homology >=95% (preferably >=98%) of sequence shown in SEQ ID NO.:1
Thuja acid；
(c) end 5' and/or the end 3' of the polynucleotides as shown in SEQ ID NO.:1 truncate or add 1-60 (preferably 1-
30, more preferably 1-10) nucleotide polynucleotides；
(d) polynucleotides complementary with any polynucleotides of (a)-(c).
In another preferred example, the polynucleotides of the cysHP promoter are selected from the group:
(a) sequence polynucleotides as shown in SEQ ID NO.:2；
(b) multicore of nucleotide sequence and homology >=95% (preferably >=98%) of sequence shown in SEQ ID NO.:2
Thuja acid；
(c) end 5' and/or the end 3' of the polynucleotides as shown in SEQ ID NO.:2 truncate or add 1-60 (preferably 1-
30, more preferably 1-10) nucleotide polynucleotides；
(d) polynucleotides complementary with any polynucleotides of (a)-(c).
In another preferred example, the polynucleotides of the promoter, fusion comprising cysJP and cysHP are selected from the group:
(a) sequence polynucleotides as shown in SEQ ID NO.:3；
(b) multicore of nucleotide sequence and homology >=95% (preferably >=98%) of sequence shown in SEQ ID NO.:3
Thuja acid；
(c) end 5' and/or the end 3' of the polynucleotides as shown in SEQ ID NO.:3 truncate or add 1-60 (preferably 1-
30, more preferably 1-10) nucleotide polynucleotides；
(d) polynucleotides complementary with any polynucleotides of (a)-(c).
In another preferred example, the threonine is L-type threonine.
The ninth aspect of the present invention provides a kind of cell culture, contains the present invention the 5th in the cell culture
Host cell described in aspect and the threonine of external source addition；Preferably, in the host cell cultures threonine it is dense
Degree >=3g/L, preferably >=5g/L, more preferably >=10g/L, the concentration of threonine can be in the host cell cultures
15g/L、20g/L、30g/L、50g/L、70g/L。
It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention
It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, In
This no longer tires out one by one states.
Detailed description of the invention
Fig. 1 shows the building process of plasmid pJC.
Specific embodiment
The present inventor is by extensive and in-depth research, and obtain a kind of novel threonine inducible promoter: cysJP is opened
Mover, cysHP promoter and its promoter, fusion, the experimental results showed that, after inducing the promoter using threonine, it is located at institute
The gene expression dose for stating promoter downstream significantly improves.The novel L-threonine inducible promoter nucleic acid molecule energy of the present invention
Induction may be operably connected to target gene (target gene) high-caliber transcriptional expression thereon, therefore be conducive to target RNA
Or the controllable production of albumen.
In the present invention, term " threonine inducible promoter " refers to by the gene of the protein of threonine inducing expression
Promoter and its control region.
Term " by the protein of threonine inducing expression " refers to the increasing with threonine content in culture solution in the present invention
Add, the increased protein of expression quantity.
In the present invention, one is preferably carried out in mode, and the polynucleotide sequence of the cysJP promoter includes:
TTTGTTTTTCATTAGGTTGGTTAATCTATTTTGTTGTTAAAGACTATTGCTAAAACAGGTTAGTCGAT
TTGGTTATTAGTTATCGCTATCCCGTCTTTAATCCACACCGTTTGCCCCGTTAACCTTACCT(SEQ ID NO.:1)。
In the present invention, one is preferably carried out in mode, the polynucleotide sequence of the cysJP promoter are as follows:
GTTGCGCAAAATCGCTGATTTATCTTAATGATTGGCTAAATTCATTTGTTTTTCATTAGGTTGGTTAA
TCTATTTTGTTGTTAAAGACTATTGCTAAAACAGGTTAGTCGATTTGGTTATTAGTTATCGCTATCCCGTCTTTAA
TCCACACCGTTTGCCCCGTTAACCTTACCTTCTCTTCTGTTTTATGGGCGCTGACAGGGCGCAGAAACAGCTTTGC
TTA(SEQ ID NO.:12)
In the present invention, one is preferably carried out in mode, and the polynucleotide sequence of the cysHP promoter includes:
CATCATTCGCCCGGTGCTCGATCCGGCGCGTGATTTGTGGGATTAACCATCAGCCCGGTCTTGTAGGC
CTGATAAGAACGCGTGAGCGTCGCATCAGGCAAGGCA(SEQ ID NO.:2)。
In the present invention, one is preferably carried out in mode, the polynucleotide sequence of the cysHP promoter are as follows:
CCGGAAATCCTGGCGTCGCTTGATGAACTGATAGGGCGCTGGGCGAAAGAGCGCGAAGCGGGTGAAGG
CTTCGGCGACTTTACGGTGCGTGCGGGCATCATTCGCCCGGTGCTCGATCCGGCGCGTGATTTGTGGGATTAACCA
TCAGCCCGGTCTTGTAGGCCTGATAAGAACGCGTGAGCGTCGCATCAGGCAAGGCA(SEQ ID NO.:13)。
In the present invention, one is preferably carried out in mode, and the fusion of the cysJP promoter and cysHP promoter is opened
The structure of mover cysJHP is as shown in Formulas I a or Ib:
Formulas I a:J-L-H；Formulas I b:H-L-J
In formula, J is the nucleotide sequence for including cysJP promoter；
H is the nucleotide sequence for including cysHP promoter；
L is optionally to connect nucleotide sequence.
In another preferred example, the L is as follows:
TCTCTTCTGTTTTATGGGCGCTGACAGGGCGCAGAAACAGCTTTGCTTACCGGAAATCCTGGCGTCGC
TTGATGAACTGATAGGGCGCTGGGCGAAAGAGCGCGAAGCGGGTGAAGGCTTCGGCGACTTTACGGTGCGTGCGGG
(SEQ ID NO.:14)。
In the present invention, one is preferably carried out in mode, the promoter, fusion of the cysJP promoter and cysHP promoter
The polynucleotide sequence of cysJHP are as follows:
GTTGCGCAAAATCGCTGATTTATCTTAATGATTGGCTAAATTCATTTGTTTTTCATTAGGTTGGTTAA
TCTATTTTGTTGTTAAAGACTATTGCTAAAACAGGTTAGTCGATTTGGTTATTAGTTATCGCTATCCCGTCTTTAA
TCCACACCGTTTGCCCCGTTAACCTTACCTTCTCTTCTGTTTTATGGGCGCTGACAGGGCGCAGAAACAGCTTTGC
TTACCGGAAATCCTGGCGTCGCTTGATGAACTGATAGGGCGCTGGGCGAAAGAGCGCGAAGCGGGTGAAGGCTTCG
GCGACTTTACGGTGCGTGCGGGCATCATTCGCCCGGTGCTCGATCCGGCGCGTGATTTGTGGGATTAACCATCAGC
CCGGTCTTGTAGGCCTGATAAGAACGCGTGAGCGTCGCATCAGGCAAGGCA(SEQ ID NO.:3)
The term as used herein " promoter " or " promoter region (domain) " refer to a kind of effective initial gene functional transcription
Nucleic acid sequence and the nucleic acid sequence that can influence the gene transcription level, guiding gene nucleic acid sequence are transcribed into RNA, usually deposit
It is the upstream (end 5') of target gene coded sequence, generally, promoter or promoter region provide RNA polymerase and correct
The recognition site of necessary other factors and the correlation factor for capableing of controlling gene transcriptional level is transcribed in starting.The present invention
The promoter, fusion further includes the active fragment of cysJP promoter or the active fragment of clipped form and cysHP promoter
Or the polynucleotide sequence with promoter function made of clipped form fusion.
Herein, the promoter or promoter region (domain) include the variant of promoter, and promoter variants can pass through
Nucleic acid sequence is deleted in insertion, carries out random or rite-directed mutagenesis etc. to obtain.
In view of the teachings of the present invention and the prior art, it will be recognized by one of ordinary skill in the art that although implementation of the invention
The promoter sequence provided in example is as shown in SEQ ID NO.:1-3, but the present invention should also include and promoter sequence of the invention
(SEQ ID NO:1-3) have 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferable 90% or more,
More preferable 95% or more, most preferably 98% or more, such as nucleic acid of 99%) homology, as long as the nucleic acid also has in cell
The function of initial gene transcription." homology " refers to according to the identical percentage in position, similar between two or more pieces nucleic acid
Horizontal (i.e. sequence similarity or identity).
" target gene " used herein refer to it is any be directly or indirectly connected with the threonine inducible promoter, from
And the gene of transcription can be originated by the threonine inducible promoter.
Promoter of the invention can operationally be connect with target gene, which can be relative to promoter
From the same species, it can be from different species.Target gene as described herein is not particularly limited, and can be
The gene or coding of RNA have the gene of specific function albumen.
The representative example of the target gene includes but is not limited to: metabolism, adjusting function related gene, resistance base
Cause, tolerance related gene, fluorescence protein gene and rna gene.
The metabolism, adjusting function related gene be for example: glycolytic pathway, tricarboxylic acid cycle, aspartic acid, Soviet Union's ammonia
The amino acid synthesis pathways such as acid, isoleucine, lysine, methionine and it is a variety of may synthesize or degrade with threonine it is straight
Connect the pathway protein and its regulatory protein gene with indirect correlation.
The resistant gene is selected from the group: the antibiotic such as chloramphenicol, ampicillin, tetracycline, hygromycin, neomycin
Resistant gene, antiviral gene etc..
Tolerance related gene is such as: gene relevant to environmental resistance resistant to high temperatures, with high salt etc..
Fluorescence protein gene is such as: red fluorescent protein, green fluorescent protein, yellow fluorescence protein fluorescence protein gene.
Rna gene is for example: RNAi gene, microRNA etc..
The present invention also provides a kind of expression casette, the expression cassette is from 5'-3' including but not limited to following elements: this
The promoter and objective gene sequence of invention.Preferably, the promoter sequence is as shown in SEQ ID NO.:1-3 or and SEQ
Homology >=95% of sequence shown in ID NO.:1-3, preferably >=98%, more preferably >=99%.
The present invention also provides a kind of recombinant vectors, and it includes promoter of the invention and/or expression casettes.Preferred
Embodiment in, the promoter downstream of the recombinant vector includes multiple cloning sites or at least one restriction enzyme site.Need table
When up to target gene, target gene is connected into suitable multiple cloning sites or restriction enzyme site, thus the purpose that is operably connected
Gene and promoter.
In another preferred embodiment, the recombinant vector includes: promoter, target gene on the direction 5' to 3'
And terminator.If desired, the recombinant vector can also include following elements: protein purification label；The acidification of 3' polymerized nucleoside
Signal；Untranslated nucleic acid sequence；Transhipment and targeting nucleic acid sequence；Selected marker (antibiotics resistance gene, fluorescin etc.)；Increase
Hadron；Or operator.
The method for being used to prepare recombinant vector is well known to those of ordinary skill in the art.Expression vector can be bacterium
Plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus or other carriers.In short, as long as it can
It replicates and stablizes in host, any plasmid and carrier can be used.
Those of ordinary skill in the art can contain promoter of the present invention and/or target gene using the building of well known method
The carrier of sequence.These methods include recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..
Promoter, expression cassette or carrier of the invention, can be used for converting host cell appropriate, so that host transcription mesh
RNA or express express target protein matter.Host cell can be prokaryotic cell, such as Escherichia coli, Corynebacterium glutamicum, yellow quarter butt
Bacterium, streptomyces, Agrobacterium: or low eukaryocyte, such as yeast cells；Or higher eucaryotic cells, such as plant cell.This
Skilled person is aware that how to select carrier and host cell appropriate.It is available with recombinant DNA conversion host cell
Routine techniques well known to those skilled in the art carries out.When host is prokaryotes (such as Escherichia coli), CaCl can be used2Method
Processing, it is also possible to which electroporation carries out.When host is eucaryote, following DNA transfection method: coprecipitation of calcium phosphate can be selected
Method, conventional mechanical methods (such as microinjection, electroporation, liposome packaging).Conversion plant can also be used Agrobacterium-mediated Transformation or
The methods of via Particle Bombardment Transformation, such as leaf disk method, rataria conversion method, bud infusion method etc..For conversion plant cell, tissue or
Organ can regenerate plant with conventional method, to obtain the plant of transgenosis.
Term " being operatively connected " refers to that the target gene that will prepare transcriptional expression is connected with a kind of usual manner of this field
Its control sequence is connected to be expressed.
In the present invention, the present inventor, which passes through, utilizes liquid chromatography-mass spectrography developed in recent years/mass spectrum (LC-MS/
MS) joint technology to there are be induced in E. coli MG1655 when threonine expression protein identified,
The promoter of GAP-associated protein GAP upstream is tentatively regarded as threonine inducible promoter.Protein gene is accredited using PCR amplification
Promoter region, which is introduced into the upstream of beta galactosidase (lacZ) gene, pass through detection lysine
In the presence of lacZ enzyme activity change, further the promoter is characterized by the induction situation of L-threonine.
By research, the inventors discovered that, sulfite reductase α subunit (CysJ), sulfite reductase β subunit
(CysI) and the promoter cysJP in the gene cluster where the gene of 3'- phosphoadenylylsulfate reductase (CysH) and
CysHP be L-threonine-inducible promoter, therefore, the present invention be capable of providing in the case that L-threonine there are enhance gene
The Novel promoter nucleic acid molecules of expression.
Main advantages of the present invention are:
(1) disclose a kind of novel threonine inducible promoter for the first time: cysJP promoter, cysHP promoter and its
Promoter, fusion；
(2) the novel L-threonine inducible promoter nucleic acid molecule of the present invention, which can induce, may be operably connected to thereon
Target gene transcriptional expression, therefore be conducive to the induction production of target RNA or albumen.
(3) expression cassette using threonine induction comprising promoter of the present invention and its downstream targets gene is located at institute
The target gene transcriptional expression level for stating promoter downstream significantly improves, and target protein expression amount can be improved about 4 times.
Combined with specific embodiments below, further statement is of the invention.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.The experimental method of detailed conditions is not specified in the following example, usually according to conventional strip
Part such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory
Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and
Number is calculated by weight.
The screening and identification for the protein that its expression is induced by threonine in 1 Escherichia coli of embodiment
By Escherichia coli MG1655, [MG1655 (is obtained from ATCC 700926, can refer to Blattner FR etc., The
complete genome sequence of Escherichia coli K-12.Science 277:1453-62(1997)]
It is inoculated in LB culture medium and is incubated overnight, be then transferred to 4 bottles of M9 inorganic salts containing 2g/L yeast powder according to 1% inoculum concentration
In culture medium, in thalli growth to logarithmic growth early period, (growth 4 hours) adds different amounts of Soviet Union into 4 bottles of culture solutions respectively
Propylhomoserin, making the threonine final concentration added in 4 bottles of culture solutions is respectively 0g/L, 12g/L, 30g/L, 60g/L, adds threonine 2
Thallus is collected after hour, PBS is cleaned 3 times, is added after 4mL lysate mixes and is carried out ultrasonication, condition 300W, every 5 seconds
5 seconds broken, being crushed the time is 15 minutes.Then 13000g is centrifuged 20 minutes, is collected supernatant and is filtered, boils and dispense after ten minutes
To 1.5mL centrifuge tube, -20 DEG C are frozen.
The albumen of preparation is quantified respectively, is alkylated, enzymatic hydrolysis, isotope labelling, LC-MS/MS detection is complete after classification
The situation of change of albumen.
Wherein sulfite reductase α subunit (CysJ), sulfite reductase β subunit (CysI), 3'- adenosine phosphate acyl
The protein content of sulfate reduction enzyme (CysH) increases with the increase for adding threonine concentration in culture solution, in addition, a CspA is cold
The protein content of the PROTEIN C spB and Acetohydroxy acid isomeroreductase (IlvC) of shock protein family are also with addition Soviet Union ammonia in culture solution
The increase of acid concentration and increase, as shown in table 1.
The albumen cysJ in different threonine concentrations of table 1, the differential expression of cysI, cysH
The sequence of genome of E.coli gene and its promoter by a large amount of sequencing parsings and well-known,
CysJ, cysI and cysH gene and its starting sub-information can be obtained from NIH genbank database or Biocyc database.
The expression quantity of visible cysJ and cysI increases with the increase of threonine concentration in table 1, it may be speculated that cysJP is that threonine lures
Conductivity type promoter；Due to cysH gene transcription by cysJP and cysHP double control, and as can be seen from Table 1,
The expression quantity of cysH, which increases, is significantly larger than cysJ and cysI by the increased induction degree of threonine amount, therefore is not difficult to speculate, cysHP
It is also threonine inducible promoter.
Embodiment 2 is used to detect the building of the carrier of promoter activity
Embodiment 1 show cysJ, cysI, cysH, cspB, ilvC coding expressing quantity with threonine concentration raising
And increase, wherein the elevation amplitude of cysJ and cysI is almost the same, and the elevation amplitude of cysH is far longer than cysJ and cysI, can
To deduce influence of the transcriptional expression of cysJ and cysI by threonine inducible promoter cysJP, and the transcription table of cysH
Up to the double influence by threonine inducible promoter cysJP and cysHP, the promoter activity of cspB and ilvC may also be by
The induction of threonine.
In order to further show the induction situation of cysJP and cysHP by threonine, first by promoter cysJP and starting
Sub- cysHP series connection, constructs promoter, fusion cysJHP, then in the downstream connection beta galactose glycosides of promoter, fusion cysJHP
Enzyme gene (LacZ) can reflect out cysJHP and induced by threonine by detecting the enzyme activity of LacZ under different threonine concentrations
Situation.
(1) promoter, fusion of promoter cysJP and promoter cysHP are constructed
Firstly, extracting the genome of Escherichia coli MG1655, using Promega genome extraction kit with this genome
For template, it is utilized respectively primer cysJP-1 and cysJP-2 and cysHP-1 and cysHP-2 shown in table 2, amplification is from big
Nucleic acid fragment SEQ IN NO:1 and SEQ IN NO:2 where the promoter cysJP and cysHP of enterobacteria MG1655.Then distinguish
It is that primer is merged using cysJP-1 and cysHP-2 using promoter cysJP and the cysHP nucleic acid fragment of amplification as template
PCR amplifies segment SEQ IN NO:3 where promoter cysJHP, by PCR amplification, respectively where promoter cysJHP
The upstream and downstream of segment SEQ IN NO:3 introduces the restriction enzyme site of restriction enzyme site CCTAGG and the AscI enzyme of AvrII enzyme
GGCGCGCC。
Then, it using MG1655 genome as template, is obtained by primer PCR amplification of LacZP-1 shown in table 2 and LacZP-2
LacZ genetic fragment is obtained, and introduces the restriction enzyme site GGCGCGCC of AscI enzyme respectively in the genetic fragment upstream and downstream expanded
With the restriction enzyme site ACTAGT of SpeI enzyme.
Then, with plasmid pSB4K5-I52002 (ACCESSION:EU496099) for template, with B4K5P-1 shown in table 2
It is that primer PCR amplification obtains plasmid fragments, and introduces AvrII enzyme respectively in the upstream and downstream of plasmid fragments with B4K5P-2
The restriction enzyme site ACTAGT of restriction enzyme site CCTAGG and SpeI enzyme.
Core where nucleic acid fragment, LacZ gene where the cysJHP finally obtained respectively to PCR amplification using corresponding enzyme
Acid fragment and plasmid fragments carry out double digestion, and nucleic acid fragment obtained by digestion is attached, so that cysJHP be connected with LacZ
Onto plasmid pSB4K5-I52002, plasmid pJC is obtained, the building process of pJC is as shown in Figure 1.
2 promoter cysJHP of table constructs the primer
The detection of 3 promoter activity of embodiment
(1) detection of promoter activity in the case of various concentration threonine exists
In order to reduce influence of the host bacteria to lacZ enzyme activity determination, MG1655 is knocked out by the method for genetic recombination first
The method of the lacZ gene of genome, genetic recombination recombinates (Datsenko, K.A.and B.L.Wanner with reference to red
(2000)."One-step inactivation of chromosomal genes in Escherichia coli K-12
Using PCR products. " Proc Natl Acad Sci USA 97 (12): 6640-6645.), any to keep MG1655 former
The recombination form for having lacZ activity to disappear is ok, and this point is easier to accomplish for the people with Biological Knowledge.
The MG1655 Strain Designation that LacZ activity disappears is MG1655Z.By plasmid pJC electrotransformation into MG1655Z, bacterial strain is constructed
MG1655Z(pJC)。
Picking MG1655Z (pJC) bacterial strain single colonie after being incubated overnight using LB culture medium, is turned according to 0.5% inoculum concentration
It is connected to and contains 0g/L respectively, 5g/L, 10g/L, 30g/L in the LB culture medium of 50g/L threonine, collect thallus after cultivating 12h.
Bacterium solution cultivation temperature is 37 degrees Celsius, shaking speed 220rpm.Thallus pH is 7.0, and concentration is the phosphate of 100mmol/L
Ultrasonic disruption is carried out after buffer washing, being crushed total time is 5min, and crumbling method is work 1 second, is stopped 3 seconds.Liquid is crushed in 4
Degree Celsius, 1,2000rpm centrifugation 10min.Supernatant is taken, with the Pierce BCA Protein Assay Kit of Thermo company
(number Prod#23227) measures protein content.Then the LacZ enzyme activity in supernatant is measured, reaction system are as follows: 10ul's
Bacterial cell disruption supernatant, the o- nitrophenols-β-D- galactoside (4mg/ml) of 74.1ul, the MgCl of 1.67ul2Solution (water
610ul, the MgCl of beta -mercaptoethanol 290ul, 1mol/L2For 100ul), and the phosphate buffer of 114.23ul (pH 7.0, it is dense
Degree be 100mmol/L), every 20 seconds detection reaction solution in product o- nitrophenols 420nm absorbance, then in conjunction with detection
The standard curve of o- nitrophenols the enzyme activity of LacZ in crude enzyme liquid is calculated (detection method can refer to Rosenthal, N.,
Methods Enzymol.152:704-720(1987).).The results are shown in Table 3, with the increase of threonine additive amount, LacZ
Enzyme activity gradually rise, show that threonine is capable of the transcriptional expression of evoked promoter cysJH downstream gene.
3 cysJH promoter downstream gene LacZ of table expression enzyme activity compares
| Threonine additive amount (g/L) | Enzyme activity (mmol/ming) |
| 0 | 5.81±0.26 |
| 5 | 11.62±0.52 |
| 10 | 13.14±0.58 |
| 30 | 17.82±0.75 |
| 50 | 24.64±1.10 |
(2) detection of promoter activity in the case of various concentration NaCl exists
In order to exclude a possibility that factor other than threonine causes cysJH promoter activity to change, it is utilized respectively 0g/L
Threonine is replaced with the NaCl of 30g/L, fully according to embodiment 3 (1) the method culture MG1655Z (pJC) and detects LacZ
Enzyme activity, the results are shown in Table 4.In the culture medium of no threonine, it is separately added into enzyme of the NaCl to LacZ of 0g/L and 30g/L
Influence living is very small.These results have further demonstrated that threonine is specific to the inducing expression of cysJH promoter.
CysJH promoter downstream gene LacZ expresses enzyme activity in the presence of 4 NaCl of table
| NaCl additive amount (g/L) | Enzyme activity (mmol/ming) |
| 0 | 5.42±0.15 |
| 30 | 4.76±0.2 |
Due to the experiment discovery in embodiment 1, the expression quantity of cspB and ilvC gene is also influenced by threonine additive amount,
The present inventor carries according to the expression constructed with method essentially identical in embodiment 2 comprising cspB and ilvC gene promoter
Body, and promoter activity is detected according to the method for embodiment 3, the experimental results showed that cspB gene promoter is not lured by threonine
It leads；And the activity of the promoter of ilvC gene is affected by NaCl, it can not be in specific manner by the induction of L-threonine.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Claims (15)
1. a kind of promoter element, which is characterized in that the promoter element includes cysJP promoter and cysHP promoter, institute
State the promoter, fusion cysJHP, the promoter, fusion cysJHP that promoter element is cysJP promoter and cysHP promoter
Structure as shown in Formulas I a or Ib:
Formulas I a:J-L-H；Formulas I b:H-L-J
In formula, J is the nucleotide sequence for including cysJP promoter；
H is the nucleotide sequence for including cysHP promoter；
L is optionally catenation sequence；
The starting intensity of the promoter element is regulated and controled by threonine；Also,
The promoter element is nucleotide sequence polynucleotides as shown in SEQ ID NO:3.
2. a kind of nucleic acid molecules, which is characterized in that the nucleic acid molecules contain promoter element described in claim 1, and
Contain target gene in the promoter element downstream.
3. nucleic acid molecules as claimed in claim 2, which is characterized in that the target gene is selected from the group: metabolism, adjusting function
Related gene, resistant gene, tolerance related gene, fluorescence protein gene and rna gene.
4. a kind of expression cassette, which is characterized in that the expression cassette successively has following elements from 5' to 3': described in claim 1
Promoter element, ribosome bind site, gene ORF sequence and terminator.
5. a kind of carrier, which is characterized in that the carrier contains promoter element described in claim 1 or claim 3 institute
The nucleic acid molecules or expression cassette as claimed in claim 4 stated.
6. a kind of host cell, which is characterized in that the host cell contain carrier described in the claims in the present invention 5 or its
Additional claim is also integrated on chromosome other than the promoter element described in claim 1 contained under native state
Promoter element described in 1 is integrated with nucleic acid molecules as claimed in claim 3 or is integrated with expression as claimed in claim 4
Box.
7. promoter element described in claim 1, cysJP promoter, cysHP promoter, nucleic acid as claimed in claim 2 point
The purposes of carrier described in expression cassette, as claimed in claim 4 or claim 5, which is characterized in that the purposes be selected from
The following group it is one or more:
(a) for expressing target gene in host cell, wherein the target gene is operatively connected with the promoter,
And the starting intensity of the promoter is by the regulation of threonine；
(b) the transcriptional expression system that building starting intensity is regulated and controled by threonine；
Wherein, the polynucleotide sequence of the cysJP promoter is as shown in SEQ ID NO.:12；And/or
The polynucleotide sequence of the cysHP promoter is as shown in SEQ ID NO.:13.
8. a kind of method of regulation target gene transcriptional expression level, the described method comprises the following steps:
(a) construction is provided, the right that the construction contains target gene and is operatively connected with the target gene is wanted
Promoter element described in asking 1, cysJP promoter or cysHP promoter；
(b) construction for obtaining step (a) imports host cell, obtains the host cell of conversion；
(c) threonine is added in host cell cultures or the starting is enhanced by the threonine that host cell itself synthesizes
The starting intensity of son；
Wherein, the polynucleotide sequence of the cysJP promoter is as shown in SEQ ID NO.:12；And/or
The polynucleotide sequence of the cysHP promoter is as shown in SEQ ID NO.:13.
9. method according to claim 8, which is characterized in that concentration >=3g/ of threonine in the host cell cultures
L。
10. method according to claim 8, which is characterized in that include the following steps: in the step (a)
(a1) using genome of E.coli as template, PCR amplification cysJP promoter, cysHP promoter or comprising cysJP and
The promoter, fusion of cysHP；
(a2) foreign gene polynucleotide passage described in PCR amplification；
(a3) it is operatively connected the promoter and the foreign gene polynucleotide passage obtains the construction.
11. a kind of purposes of threonine, which is characterized in that be used to prepare the adjusting control agent of the starting intensity of regulation promoter or be used for
Regulate and control the starting intensity of promoter, wherein the promoter is selected from the group: cysJP promoter, cysHP promoter and/or packet
Promoter, fusion containing cysJP and cysHP；
The polynucleotide sequence of the cysJP promoter is as shown in SEQ ID NO.:12；And/or
The polynucleotide sequence of the cysHP promoter is as shown in SEQ ID NO.:13；And/or
The polynucleotide sequence of the promoter, fusion comprising cysJP and cysHP is as shown in SEQ ID NO.:3.
12. a kind of cell culture, which is characterized in that contain host cell as claimed in claim 6 in the cell culture,
And threonine.
13. cell culture as claimed in claim 12, which is characterized in that threonine is dense in the host cell cultures
Degree >=3g/L.
14. cell culture as claimed in claim 12, which is characterized in that threonine is dense in the host cell cultures
Degree >=5g/L.
15. cell culture as claimed in claim 12, which is characterized in that threonine is dense in the host cell cultures
Degree >=10g/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510160543.4A CN106148336B (en) | 2015-04-07 | 2015-04-07 | Novel L-threonine-inducible promoter and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510160543.4A CN106148336B (en) | 2015-04-07 | 2015-04-07 | Novel L-threonine-inducible promoter and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106148336A CN106148336A (en) | 2016-11-23 |
| CN106148336B true CN106148336B (en) | 2019-11-05 |
Family
ID=57337898
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510160543.4A Active CN106148336B (en) | 2015-04-07 | 2015-04-07 | Novel L-threonine-inducible promoter and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106148336B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102153534B1 (en) * | 2019-09-02 | 2020-09-09 | 씨제이제일제당 주식회사 | A novel promoter and preparation method of amino acids using thereof |
| CN111440797B (en) * | 2020-04-10 | 2021-10-22 | 江南大学 | Obtaining and application of inducible promoter |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1910286A (en) * | 2004-01-23 | 2007-02-07 | 德古萨股份公司 | Method for producing l-threonine using recombinant enterobacteriaceae with increased enolase activity |
| CN1918283A (en) * | 2004-02-06 | 2007-02-21 | 德古萨股份公司 | Process for the preparation of l-amino acids using strains of the family enterobacteriaceae |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070065901A1 (en) * | 2005-09-19 | 2007-03-22 | Dicosimo Deana J | Process for chromosomal expression of foreign genes in the PAPS reductase (cysH) region of a methylotrophic microbial host cell |
-
2015
- 2015-04-07 CN CN201510160543.4A patent/CN106148336B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1910286A (en) * | 2004-01-23 | 2007-02-07 | 德古萨股份公司 | Method for producing l-threonine using recombinant enterobacteriaceae with increased enolase activity |
| CN1918283A (en) * | 2004-02-06 | 2007-02-21 | 德古萨股份公司 | Process for the preparation of l-amino acids using strains of the family enterobacteriaceae |
Non-Patent Citations (4)
| Title |
|---|
| 《A comprehensive library of fluorescent transcriptional reporters for Escherichia coli》;Zaslaver Alon等;《Nature methods》;20060831;第3卷(第8期);第623-628页 * |
| 《Molecular Characterization of the cysJIH Promoters of Salmonella typhimurium and Escherichia coli: Regulation by cysB Protein and N-Acetyl-L-Serine》;OSTROWSKI J等;《Journal of bacteriology》;19890131;第171卷(第1期);第130-140页 * |
| 《Role for CysJ Flavin Reductase in Molybdenum Cofactor-Dependent Resistance of Escherichia coli to 6-N-Hydroxylaminopurine》;Kozmin Stanislav G.等;《Journal of bacteriology》;20100415;第192卷(第8期);第2026-2033页 * |
| 《Transcriptional response of Escherichia coli to external zinc》;Yamamoto K等;《Journal of bacteriology》;20050930;第187卷(第18期);第6333-6340页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106148336A (en) | 2016-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6518317B2 (en) | Feedback resistant acetohydroxy acid synthase mutant and method for producing L-valine using the same | |
| Kawata et al. | Transformation of Spirulina platensis strain C1 (Arthrospira sp. PCC9438) with Tn5 transposase–transposon DNA–cation liposome complex | |
| Yin et al. | Improvement of oxytetracycline production mediated via cooperation of resistance genes in Streptomyces rimosus | |
| CN113322218A (en) | Recombinant corynebacterium glutamicum and method for producing L-threonine | |
| RU2653453C1 (en) | Microorganism for putrescine production and a method of putrescine production with its use | |
| RU2683551C1 (en) | Microorganism which possess productivity of l-lysine, and method of producing l-lysine using this microorganism | |
| Zheng et al. | Enhancing single-cell hyaluronic acid biosynthesis by microbial morphology engineering | |
| BR112020004575A2 (en) | polynucleotide, vector, microorganism of the genus corynebacterium, methods for producing target substance and for preparing a fermented composition, and fermented composition. | |
| Lee | Development and characterization of expression vectors for Corynebacterium glutamicum | |
| WO2022242637A1 (en) | Genetically engineered bacterium for realizing high yield of l-isoleucine and method for producing l-isoleucine by means of fermentation method | |
| CN108220219B (en) | Lactobacillus plantarum food-grade expression system and application thereof in heterologous protein expression | |
| CN109486734A (en) | A kind of genetic engineering bacterium producing chondroitin and its construction method and application | |
| CN106148336B (en) | Novel L-threonine-inducible promoter and its application | |
| Pátek | Branched-chain amino acids | |
| WO2018077159A1 (en) | Method for modifying amino acid attenuator and use of same in production | |
| JP6249456B2 (en) | How to produce plastic raw materials in cyanobacteria | |
| RU2546239C1 (en) | RECOMBINANT STRAIN Escherichia coli, HAVING CONSTITUTIVE ASPARTASE ACTIVITY AND METHOD OF SYNTHESIS OF L-ASPARTIC ACID USING THIS STRAIN AS BIOCATALYST | |
| RU2672323C2 (en) | Diamine-producing microorganism and method for producing diamine using same | |
| RU2696504C2 (en) | Microorganism for producing diamine and a method of producing diamine using it | |
| WO2011108585A1 (en) | Process for production of useful substance using genetically modified streptomyces ray fungus | |
| CN110062807B (en) | Process for producing polyhydroxyalkanoate and microorganism | |
| JP7350994B2 (en) | Novel promoter and target substance production method using the same | |
| CN107810269B (en) | Novel promoters and uses thereof | |
| CN110004164B (en) | 5-aminolevulinic acid high-yield recombinant strain and application thereof | |
| WO2023198006A1 (en) | Method for preparing s-lactoylglutathione |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |