CN110004164B - 5-aminolevulinic acid high-yield recombinant strain and application thereof - Google Patents

Abstract

The invention provides a recombinant plasmid, which can express hemA gene of rhodobacter capsulatus and can inhibit the expression of hemB gene of escherichia coli. The invention also provides a recombinant bacterium which is Escherichia coli with the recombinant plasmid. The recombinant plasmid or recombinant bacterium provided by the invention is used for fermentation of 5-aminolevulinic acid, the yield of the 5-aminolevulinic acid can be obviously improved, and exogenous 5-aminolevulinic acid dehydratase inhibitor is not required to be added to hinder metabolism of the 5-aminolevulinic acid in the bacterium.

Description

5-aminolevulinic acid high-yield recombinant strain and application thereof

Technical Field

The invention relates to the field of microbial engineering, in particular to a 5-aminolevulinic acid high-producing strain and a preparation method thereof.

Background

5-Aminolevulinic acid (ALA), also known as 5-Aminolevulinic acid, is a non-proteinogenic amino acid with a molecular weight of 131.2. 5-aminolevulinic acid widely exists in animal, plant and microbial cells, and is used for synthesizing chlorophyll, heme, porphyrin and vitamin B in vivo ₁₂ Precursors of isopyrrole compoundsA substance. ALA is used as a photosensitizer and has wide application in the fields of clinical medicine and agriculture. In medicine, ALA is useful in the photodynamic treatment and diagnosis of cancer. In the agricultural field, 5-aminolevulinic acid has the advantages of easy degradation, no residue and no toxicity to people and livestock, and can be used as a novel green pesticide, a herbicide and a growth regulating factor to be highly regarded by the industry.

In the early days, ALA can only be synthesized by a chemical method, but the chemical synthesis has the problems of complex process, low yield, more toxic and side products, environmental pollution and the like. Therefore, in recent years, the biosynthesis of ALA by biological methods has been attracting attention. In nature, there are two major metabolic pathways for ALA synthesis by organisms, namely, the C4 pathway and the C5 pathway. ALA synthesis by the C4 pathway occurs mainly in animals, fungi and non-sulfur photosynthetic bacteria and is produced by condensation of succinyl-CoA and glycine under the action of 5-aminolevulinic acid synthase (ALAS, encoded by hemA). In the C5 pathway, glutamate first catalyzes the production of glutamyl-tRNA from glutamyl-tRNA synthetase (GluRS, encoded by gltX), glutamyl-tRNA then catalyzes the production of glutamaldehyde from glutamyl-tRNA reductase (GluTR, encoded by hemA), and glutamaldehyde finally catalyzes the production of ALA from glutamyl aminotransferase (GSA-AT, encoded by hemL).

With the continuous development of biotechnology, ALA synthesized by a biological method is receiving attention of people due to the advantages of simple production process, low cost, high yield, environmental friendliness and the like. In nature, ALA is synthesized by many organisms, such as photosynthetic bacteria, which are a class of microorganisms that synthesize ALA and secrete it to the outside of cells. The wild strain screened in nature has too low ALA product accumulation amount to meet the requirement of industrial production. Currently, there are two main types of methods for increasing ALA production by microorganisms: one is to select strains which can produce ALA with high yield by a mutation breeding method, and ferment and accumulate ALA in a specific culture medium. The other is that C4 or C5 metabolic pathway for synthesizing ALA by microorganisms is modified by metabolic engineering technology, the expression of key enzyme genes is enhanced, and the expression of downstream enzyme (5-aminolevulinic acid dehydratase) in the ALA metabolic pathway is inhibited, so that the ALA yield is improved.

5-aminolevulinic acid dehydratase (ALAD), also known as porphobilinogen synthase (PBGS), is encoded by the hemB gene and catalyzes the asymmetric condensation of two molecules of ALA to synthesize one molecule of Porphobilinogen (PBG), which is a precursor substance of various tetrapyrrole compounds in vivo. ALAD as a downstream enzyme in ALA metabolic pathway can reduce ALA accumulation in the process of ALA production by fermentation of engineering bacteria (figure 1), but the lack of ALAD can affect normal life activities of cells.

In the process of ALA production by engineering bacteria, in order to reduce the downstream metabolism of ALA, the activity of ALAD is often reduced by adding inhibitors such as levulinic acid and D-glucose (Nishikawa et al, journal of Bioscience & Bioengineering,1999, 87 (6): 798.Liu et al, applied Biochemistry & Biotechnology,2010, 160 (3): 822-830) to increase the accumulation of ALA in the fermentation broth. The addition of the inhibitor reduces the activity of ALAD, so that the fermentation process for producing ALA becomes complicated, the later separation and purification of ALA are not facilitated, and the production cost is increased.

In recent years, researchers have reduced the activity of ALAD by modifying ALA dehydratase gene. Xie et al (Biotechnology Letters,2003, 25 (20): 1751-1755.) mutated the hemB gene in E.coli and showed that there was no increase in ALA production in the cells after hemB mutation. In addition, the hemB gene in E.coli MG1655 strain was knocked out by Korotko et al (modern food technology, 2011, 27 (7): 742-746), and it was found that although ALAD activity was greatly reduced, the growth of the cells was affected and ALA accumulation was not improved.

Disclosure of Invention

In order to solve the above problems, the present invention provides:

a DNA fragment comprising unit a expressing the hemA gene and unit B silencing the hemB gene;

the unit A comprises a sequence shown in SEQ ID NO. 1;

the unit B comprises an antisense sequence of the hemB gene; the antisense sequence can be reversely complemented with the interval from-57 nt upstream of the initiation codon to 139nt downstream of the initiation codon of the hemB gene;

the two ends of the antisense sequence of the unit B contain a sequence C and a sequence D; the sequence C and the sequence D can be reversely and complementarily paired;

both units A and B carry promoter and terminator sequences. As with the previously described plasmids, the antisense sequence of unit B is restricted to the reverse complement of the hemB gene from-57 nt upstream to 139nt downstream of the initiation codon of the hemB gene.

As described above, in the DNA fragment, the length of the paired end sequences is 25 to 45bp, preferably 38bp.

A DNA fragment as described above, wherein said promoter is trc promoter; and/or the terminator is a rrnB terminator.

The DNA fragment, the unit B has a sequence shown in SEQ ID NO. 4.

The invention also provides a recombinant plasmid, which is a plasmid containing the DNA fragment.

The invention also provides a recombinant bacterium, which is escherichia coli containing the recombinant plasmid.

Further, the Escherichia coli is a rare codon-optimized Escherichia coli Rosetta (DE 3).

The invention also provides application of the recombinant plasmid or the recombinant bacterium in preparation of 5-aminolevulinic acid.

The invention also provides a method for preparing 5-aminolevulinic acid, which comprises the following steps:

(1) Inoculating the recombinant bacteria into a fermentation liquid culture medium containing 25 mu g/mL kanamycin, and performing shake culture at 37 ℃;

(2) When OD600nm is 0.5-0.7, adding isopropyl thiogalactoside into the culture medium to make the final concentration of the isopropyl thiogalactoside be 0.1mM, and performing shake culture at 28 ℃;

(3) Collecting and breaking recombinant bacteria, and purifying the 5-aminolevulinic acid.

Further, the OD of step (2) _600nm At 0.6, the addition of isopropylthiogalactoside was started.

The invention can achieve the following beneficial effects:

the RNA interference efficiency of the invention to hemB can reach more than 75%.

Compared with the Escherichia coli only transferred with the hemA gene, the Escherichia coli transferred with the recombinant plasmid of the invention obviously improves the yield of the 5-aminolevulinic acid; in the examples of the invention, the yield of 5-aminolevulinic acid after 16h and 20h of fermentation was increased by 16.3% and 17.6%, respectively.

Furthermore, the recombinant strain of the present invention can produce 5-aminolevulinic acid at a high level without adding an exogenous 5-aminolevulinic acid dehydratase inhibitor at the time of fermentation.

It will be apparent that various other modifications, substitutions and alterations can be made in the present invention without departing from the basic technical concept of the invention as described above, according to the common technical knowledge and common practice in the field.

The above-mentioned aspects of the present invention will be further described in detail with reference to the following embodiments. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1: e.coli heme synthesis pathway.

FIG. 2 is a schematic diagram: secondary structure diagram of one of the single strands of the PTAsRNA.

FIG. 3: the expression plasmid pET28a-hemA is constructed.

FIG. 4 is a schematic view of: the construction process of antisense expression plasmid pET28a-hemA-asRNA.

FIG. 5: carrying out enzyme digestion identification on pET28a-hemA-asRNA plasmid; m: a DNA standard control; 1: pET28a/BamHI;2: pET28a-hemA/BamHI;3: pET28a-hemA/NdeI, bamHI;4: pET28a-hemA-asRNA/BamHI;5: pET28a-hemA-asRNA/NdeI, xhoI.

FIG. 6: relative expression amount of hemB gene mRNA in recombinant bacteria.

FIG. 7: the content of PBG in the Rosetta/pET28a-hemA and Rosetta/pET28a-hemA-asRNA fermentation broths.

FIG. 8: the ALA content in the Rosetta/pET28a-hemA and Rosetta/pET28a-hemA-asRNA fermentation broths.

Detailed Description

The present invention will be further disclosed by the examples and experimental examples, wherein the following experimental methods are used in the examples and experimental examples:

analytical determination of ALA

1.1 reagent preparation

Acetate buffer (pH 4.6): weighing 8.2g of anhydrous sodium acetate (NaAc) into 70mL of deionized water, adding 5.7mL of glacial acetic acid, after completely dissolving, using the deionized water to fix the volume to 100mL, uniformly mixing, and storing in a refrigerator at 4 ℃ for later use.

p-Dimethylaminobenzaldehyde (DMAB) developer: weighing 1.0g of p-dimethylaminobenzaldehyde in 30mL of glacial acetic acid, and then adding 5mL of 70% HClO in sequence ₄ 5mL of deionized water. After the solution is completely dissolved, the volume is determined to be 50mL by glacial acetic acid, the solution is mixed evenly and stored in a brown reagent bottle at 4 ℃ in the dark.

1.2 photochemical development

Centrifuging fermented bacteria solution at 8000rpm for 5min, diluting the supernatant by a proper amount (B), placing 120 μ L diluted sample in 1.5mL EP tube, sequentially adding 160 μ L acetate buffer solution and 14 μ L acetylacetone, heating in boiling water bath for 15min, naturally cooling to room temperature, adding 294 μ L DMAB developer, performing color reaction at room temperature for 30min, and measuring the light absorption value at 554nm (A) with water as blank control ₅₅₄ )。

Analytical determination of PBG

Centrifuging the fermented bacterial liquid at 8000rpm for 5min, taking 500 microlitre of supernatant into a 1.5mL EP tube,

adding equal volume of DMAB color-developing agent (p-dimethylaminobenzaldehyde color-developing agent), mixing, performing color reaction at room temperature for 30min, collecting 200 μ L reaction solution, using water as blank control, and measuring the light absorption value (A) at 554am with enzyme-labeling instrument ₅₅₄ )。

3. Fermentation culture

3.1 culture Medium

LB medium (g/L): 5.0g of Yeast extract (Yeast extract), 10.0g of peptone (Tryptone), 10.0g of NaCl, and 2% agar strips if LB solid medium is used.

Fermentation medium (g/L): 5.0g of Yeast extract (Yeast extract), 10.0g of peptone (Tryptone), 2.0g of Glycine (Glycine) and 8.0g of succinic acid (succinic acid), adjusting the pH to about 6.2 with NaOH, sterilizing at 121 ℃ for 20min, sterilizing at 115 ℃ for 30min with 2.0g of glucose, sterilizing respectively, and mixing.

3.2 culture conditions

And (3) strain culture: the glycerol tube is streaked, then a single colony is selected and streaked on an LB plate containing kanamycin (25 mu g/mL), and the single colony is cultured at 37 ℃ overnight to be used as a seed source;

seed culture: fresh single colonies were picked from the plates and cultured in 5mL LB liquid medium containing kanamycin (25. Mu.g/mL) at 37 ℃ for 12-16h with shaking at 200 rpm.

Fermentation culture: inoculating into 100mL fermentation liquid medium containing kanamycin (25 μ g/mL) at a inoculum size of 2%, culturing at 37 deg.C and 200rpm with shaking to obtain bacterial liquid OD ₆₀₀ When the concentration is about 0.6, isopropyl thiogalactoside (IPTG) is added to the mixture at a final concentration of 0.1mM, and fermentation culture is carried out at 28 ℃ and 200 rpm. After culturing for about 20h, the bacterial liquid was collected.

EXAMPLE 1 construction of expression plasmid pET28a-hemA

And (3) performing Polymerase Chain Reaction (PCR) amplification on a target gene (hemA) by taking the total DNA of the rhodobacter capsulatus as a template. Based on the sequence of the 5-aminolevulinic acid synthase gene of rhodobacter capsulatus reported in GenBank (RCAP _ rcc01447 5-aminolevulinate synthase, SEQ ID NO.1, see appendix), primers were designed as follows:

F ₁ ：CTGCATATGGACTACAATCTCGCGCTCGACAAAG(SEQ ID NO.2)

R ₁ ：ATAGGATCCAGAATGGCTCAGGCAGAGGCC(SEQ ID NO.3)

the target gene hemA was first ligated to pMD ^TM 19-T vector (Takara). pMD ^TM The 19-T vector ligation system (20. Mu.L) was: pMD ^TM 1 mu L of 19-T vector, 2 mu L of target gene fragment and 5 mu L of solution I, and adding water to supplement to 20 mu L. Ligation was carried out overnight at 16 ℃. The ligation product was transformed into E.coli competent cell DH 5. Alpha. And grown on a medium containing ampicillin resistance, and the recombinant was selected. Extracting plasmid from recombinant colibacillus, enzyme digestion identification and sequencing identificationAfter the determination, the vector pET-28a was digested with restriction enzymes Nde I and BamH I, and the vector was digested with Nde I and BamH I. The DNA fragment of interest was ligated with the linear pET28a plasmid using a DNA ligation kit (Takara) in a ligation system (10. Mu.L): pET28a 1. Mu.L, hemA 3. Mu.L, sln I5. Mu.L, ddH2O 1. Mu.L.

The construction flow is shown in FIG. 3.

Transferring the ligation product into Escherichia coli DH5 alpha cells, selecting a transformant, extracting a plasmid for verification, and further performing sequencing verification to obtain a recombinant plasmid: pET28a-hemA.

EXAMPLE 2 construction of antisense expression plasmid pET28a-hemA-asRNA

1. Designing and synthesizing a double-stranded DNA sequence interfering the hemB gene, and naming the double-stranded DNA sequence as PTAsRNA; one single-stranded secondary structure and a partial sequence of the ptassrna are shown in fig. 2, which includes a promoter (trc promoter in this embodiment), a hemB gene antisense sequence (antisense RNA), a PT (paired end) sequence directly connected to the antisense sequence, a terminator (rrnB terminator in this embodiment), and a partial cleavage site; the complete sequence of the PTAsRNA (SEQ ID NO. 4) and the complete sequence of the hemB gene itself (SEQ ID NO. 5) are shown in the appendix.

2. The rmB terminator sequence was cloned into the plasmid pET28a-hemA (BamH I/Hind III) and the terminator was used to terminate the transcription of the hemA gene on the plasmid, resulting in the recombinant plasmid pET28a-hemA-T.

3. The double-stranded DNA form of the PTAsRNA was cloned into pET28a-hemA-T to obtain antisense expression plasmid pET28a-hemA-asRNA.

The above construction flow is shown in fig. 4.

The pET28a-hemA-asRNA is transferred into an escherichia coli DH5 alpha competent cell, plasmid is extracted for enzyme digestion identification (figure 5), and the successfully identified recombinant plasmid is sent to the Scophtalae Catapxi organism Limited company for sequencing to obtain the correct antisense expression plasmid pET28a-hemA-asRNA.

Example 3 construction of ALA-fermenting recombinant bacteria

The constructed recombinant plasmid pET28a-hemA is transferred into a rare codon-optimized escherichia coli Rosetta (DE 3) strain to obtain a recombinant bacterium Rosetta/pET28a-hemA. The constructed antisense expression plasmid pET28a-hemA-asRNA is transferred into an escherichia coli Rosetta (DE 3) strain to obtain a recombinant bacterium Rosetta/pET28a-hemA-asRNA.

Experimental example 1 real-time fluorescent quantitative PCR verification

The recombinant bacteria Rosetta/pET28a-hemA and Rosetta/pET28a-hemA-asRNA are fermented and cultured for 4h, 8h, 12h, 16h and 20h respectively, then total RNA of the recombinant bacteria is extracted, after reverse transcription, cDNA is used as a template for carrying out fluorescence quantitative PCR.

The primers used for the fluorescent quantitative PCR were as follows:

hemB：F ₄ ：CAGGTACAGGCGATTCGTCA(SEQ ID NO.6)

R ₄ -TCACGACGGTTCATTGGGTT(SEQ ID NO.7)

16SRNA：F ₅ -GAGCGCAACCCTTATCCTTTG(SEQ ID NO.8)

R ₅ -TACTAGCGATTCCGACTTCATGG(SEQ ID NO.9)

real-time fluorescent quantitative PCR reaction (25 μ L): SYBR Premix Ex Taq II 12.5. Mu.L, PCR Forward Primer (10. Mu.M) 1. Mu.L, PCR Reverse Primer (10. Mu.M) 1. Mu.L, cDNA template 1. Mu.L, sterilized ddH ₂ O 9.5μL。

Real-time fluorescent quantitative PCR program set (two-step method): 30 seconds at 95 ℃;5 seconds at 95 ℃ and 30 seconds at 60 ℃ for 40 cycles;

after carrying out fluorescence quantitative PCR, determining Ct value according to amplification curve, and calculating 2 according to Ct value ^-ΔΔCt The values determine the relative expression of each gene. If the expression amount of hemB in the recombinant strain Rosetta/pET28a-hemA-asRNA is 1, the expression amount of hemB gene in the control group Rosetta/pET28a-hemA without inserted antisense sequence reaches 11, so that the inserted antisense RNA plays a certain role in inhibiting the expression of hemB gene, and the interference efficiency reaches more than 75% after fermentation culture for 4h, as shown in figure 6.

Experimental example 2 fermentation verification of recombinant bacteria

Inoculating the recombinant bacterium Rosetta/pET28a-hemA-asRNA and the reference bacterium Rosetta/pET28a-hemA into 100mL fermentation culture medium with pH of 6.4 according to the inoculation amount of 2%, respectively, and obtaining the OD of the bacteria liquid ₆₀₀ When the concentration is 0.6, 0.1mM IPTG is added, and fermentation culture is carried out at 28 ℃ and 200rpm for 4h, 8h and 12hAfter 16h and 20h, detecting the content of ALA and PBG in the fermentation liquor.

The recombinant bacterium Rosetta/pET28a-hemA-asRNA fermentation liquor has reduced PBG production amount (as shown in figure 7), which shows that the antisense RNA inhibits the conversion of ALA to PBG, slows down the consumption rate of ALA and increases the accumulation amount of ALA in the fermentation liquor. The ALA production of the Rosetta/pET28a-hemA-asRNA in each time period is higher than that of the strain Rosetta/pET28a-hemA, and the ALA production is improved by 16.3 percent and 17.6 percent respectively at 16h and 20 h. At 20h, the ALA content in the strain Rosetta/pET28a-hemA-asRNA shake flask fermentation liquor is as high as 1231mg/L (as shown in figure 8). The result shows that after the bacterial strain inserted with the antisense RNA sequence inhibits the expression of hemB, the conversion of ALA in the fermentation liquor to PBG is reduced, and the ALA in the fermentation liquor is effectively accumulated.

According to the invention, the expression of hemA in escherichia coli is enhanced, and hemB expression is weakened by adopting an antisense RNA interference technology, so that the accumulation amount of ALA in escherichia coli fermentation liquor is increased from 76.5mg/L to 1231mg/L under the condition of shaking the flask, and the application prospect is good.

Appendix part nucleotide sequence

hemA nucleotide sequence (SEQ ID NO. 1)

Nucleotide sequence of PTAsRNA (SEQ ID NO. 4)

hemB nucleotide sequence (SEQ ID NO. 5)

SEQUENCE LISTING

<110> Sichuan university

<120> a 5-aminolevulinic acid high-yield recombinant strain and application thereof

<130> GYKH1165-2019P015311CC

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 1238

<212> DNA

<213> Rhodobacter capsulatus

<400> 1

atggactaca atctcgcgct cgacaaagcg atccagaagc tccacgacga gggacgttac 60

cgcacgttca tcgacatcga acgcgagaag ggcgccttcc ccaaggcgca gtggaaccgc 120

cccgatggcg gcaagcagga catcaccgtc tggtgcggca acgactatct gggcatgggc 180

cagcacccgg tcgttctggc cgcgatgcat gaggcgctgg aagcggtcgg ggccgggtcg 240

ggtggcaccc gcaacatctc gggcaccacg gcctatcacc gccgccttga ggccgagatc 300

gccgatctgc accagaaaga agccgcgctg gtcttttcct cggcctacaa cgccaatgac 360

gccacgcttt cgaccctgcg cgtgctcttc cccggcctga tcatctattc cgacagcctg 420

aaccacgcct cgatgatcga ggggatcaag cgcaatgccg ggccgaagcg gatcttccgt 480

cacaatgacg tcgcgcatct gcgcgagctg atcgccgccg atgatccggc cgcgccgaag 540

ctgatcgcct tcgaatcggt ctattcgatg gatggcgact tcggcccgat caaggaaatc 600

tgcgacatcg ccgaggaatt cggcgcgctg acctatatcg acgaagtcca tgccgtcggc 660

atgtatggcc cccgcggcgc gggcgtggcg gaacgcgacg gtctgatgca tcgcatcgac 720

atcttcaacg gcacgctggc gaaagcctac ggcgtcttcg gcggctatat cgccgcttcg 780

gcgcggatgg tcgatgccgt gcgctcctat gcgccgggct tcatcttctc gacctcgctg 840

ccgccggcga tcgccgcggg cgcgcaggcc tcgatcgcct tcctgaaaac cgccgaaggg 900

cagaagctgc gcgacgcgca acagatgcac gccaaggttc tcaagatgcg gctcaaggcg 960

ctcggcatgc cgatcatcga ccacggcagc cacatcgttc cggtggtcat cggcgacccc 1020

gtgcacacca aggcggtgtc ggacatgctc ttgtcggatt acggcgttta cgtgcagccg 1080

atcaacttcc cgacggtgcc gcgcggcacc gaacggctgc gcttcacccc ctcgccggtg 1140

catgatctca agcagatcga cgggctcgtt catgccatgg atctgctctg ggcgcgctgt 1200

gcgctgaatc gcgccgaggc ctctgcctga gccattct 1238

<210> 2

<211> 34

<212> DNA

<213> Artificial sequence

<400> 2

ctgcatatgg actacaatct cgcgctcgac aaag 34

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence

<400> 3

ataggatcca gaatggctca ggcagaggcc 30

<210> 4

<211> 714

<212> DNA

<213> Artificial sequence

<400> 4

gagctctgca ggtcgtaaat cactgcataa ttcgtgtcgc tcaaggcgca ctcccgttct 60

ggataatgtt ttttgcgccg acatcataac ggttctggca aatattctga aatgagctgt 120

tgacaattaa tcatccggct cgtataatgt gtggaattgt gagcggataa caatttcagg 180

aggaattaac catgcagtgg tggtggtggt ggtgccatgg cggctttgta gtcgtcaatt 240

tcttcttcaa caaagatcgg caacaccagg tcgttaaggc taagtgttgt ctcttcaaac 300

atagcgcgca gcgcaggaga tttgcgcagg cgacgagggc gttggattaa gtctgtcatg 360

gtctgcctga tgtttgtgga attaaggtgc acagtatacc tgaagcgggg caggagggat 420

ccaccaccac caccaccact gcatggttaa ttcctcctag ttttggcgga tgagagaaga 480

ttttcagcct gatacagatt aaatcagaac gcagaagcgg tctgataaaa cagaatttgc 540

ctggcggcag tagcgcggtg gtcccacctg accccatgcc gaactcagaa gtgaaacgcc 600

gtagcgccga tggtagtgtg gggtctcccc atgcgagagt agggaactgc caggcatcaa 660

ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt ttatctgcgg ccgc 714

<210> 5

<211> 975

<212> DNA

<213> Rhodobacter capsulatus

<400> 5

atgacagact taatccaacg ccctcgtcgc ctgcgcaaat ctcctgcgct gcgcgctatg 60

tttgaagaga caacacttag ccttaacgac ctggtgttgc cgatctttgt tgaagaagaa 120

attgacgact acaaagccgt tgaagccatg ccaggcgtga tgcgcattcc agagaaacat 180

ctggcacgcg aaattgaacg catcgccaac gccggtattc gttccgtgat gacttttggc 240

atctctcacc ataccgatga aaccggcagc gatgcctggc gggaagatgg actggtggcg 300

cgtatgtcgc gcatctgcaa gcagaccgtg ccagaaatga tcgttatgtc agacacctgc 360

ttctgtgaat acacttctca cggtcactgc ggtgtgctgt gcgagcatgg cgtcgacaac 420

gacgcgactc tggaaaattt aggcaagcaa gccgtggttg cagctgctgc aggtgcagac 480

ttcatcgccc cttccgccgc gatggacggc caggtacagg cgattcgtca ggcgctggac 540

gctgcgggat ttaaagatac ggcgattatg tcgtattcga ccaagttcgc ctcctccttt 600

tatggcccgt tccgtgaagc tgccggaagc gcattaaaag gcgaccgcaa aagctatcag 660

atgaacccaa tgaaccgtcg tgaggcgatt cgtgaatcac tgctggatga agcccagggc 720

gcagactgcc tgatggttaa acctgctgga gcgtacctcg acatcgtgcg tgagctgcgt 780

gaacgtactg aattgccgat tggcgcgtat caggtgagcg gtgagtatgc gatgattaag 840

ttcgccgcgc tggcgggtgc tatagatgaa gagaaagtcg tgctcgaaag cttaggttcg 900

attaagcgtg cgggtgcgga tctgattttc agctactttg cgctggattt ggctgagaag 960

aagattctgc gttaa 975

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

caggtacagg cgattcgtca 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

tcacgacggt tcattgggtt 20

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence

<400> 8

gagcgcaacc cttatccttt g 21

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence

<400> 9

tactagcgat tccgacttca tgg 23

Claims (9)

1.A DNA fragment for use in the preparation of 5-aminolevulinic acid, characterized in that: it includes unit A expressing hemA gene and unit B silencing hemB gene;

the unit A is a sequence shown in SEQ ID NO. 1; the unit B is a sequence shown as SEQ ID NO. 4;

the unit B comprises an antisense sequence of the hemB gene; the antisense sequence is reversely complementary with the interval from-57 nt upstream of the initiation codon to 139nt downstream of the initiation codon of the hemB gene;

the two ends of the antisense sequence of the unit B contain a sequence C and a sequence D; the sequence C and the sequence D are in reverse complementary pairing; the length of the pairing terminal sequence is 25 to 45bp;

both units A and B carry promoter and terminator sequences.

2. The DNA segment of claim 1, wherein: the length of the paired end sequences is 38bp.

3. The DNA segment of claim 1, wherein: the promoter is a trc promoter; and/or the terminator is a rrnB terminator.

4. A recombinant plasmid, characterized in that: it comprises the DNA fragment of any one of claims 1 to 3.

5. A recombinant bacterium, which is characterized in that: it is Escherichia coli containing the recombinant plasmid according to claim 4.

6. The recombinant bacterium according to claim 5, wherein: the E.coli is a rare codon-optimized E.coli Rosetta (DE 3).

7. Use of the plasmid or recombinant bacterium of any one of claims 4 to 6 in preparation of 5-aminolevulinic acid.

8. A method for preparing 5-aminolevulinic acid, which is characterized by comprising the following steps:

(1) Inoculating the recombinant strain of claim 5 or 6 into a fermentation liquid culture medium containing 25 mug/mL kanamycin, and performing shake culture at 37 ℃;

(2) To OD _600nm When the concentration is 0.5 to 0.7, adding isopropyl thiogalactoside into the culture medium to make the final concentration of the isopropyl thiogalactoside be 0.1mM, and performing shake culture at 28 ℃;

(3) Collecting and breaking recombinant bacteria, and purifying the 5-aminolevulinic acid.

9. The method of claim 8, wherein: OD of step (2) _600nm At 0.6, the addition of isopropylthiogalactoside was started.

Images