CN110004164A - A kind of 5-ALA high yield recombinant bacterial strain and application thereof - Google Patents

A kind of 5-ALA high yield recombinant bacterial strain and application thereof Download PDF

Info

Publication number
CN110004164A
CN110004164A CN201910246577.3A CN201910246577A CN110004164A CN 110004164 A CN110004164 A CN 110004164A CN 201910246577 A CN201910246577 A CN 201910246577A CN 110004164 A CN110004164 A CN 110004164A
Authority
CN
China
Prior art keywords
ala
sequence
unit
recombinant
hema
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910246577.3A
Other languages
Chinese (zh)
Other versions
CN110004164B (en
Inventor
李维
葛方兰
陈贵英
左勇
文冬梅
葛清蓉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Normal University
Original Assignee
Sichuan Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Normal University filed Critical Sichuan Normal University
Priority to CN201910246577.3A priority Critical patent/CN110004164B/en
Publication of CN110004164A publication Critical patent/CN110004164A/en
Application granted granted Critical
Publication of CN110004164B publication Critical patent/CN110004164B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01037—5-Aminolevulinate synthase (2.3.1.37)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a kind of recombinant plasmids, it can express the hemA gene of Rhodobacter capsulatus, moreover it is possible to inhibit the expression of the hemB gene of Escherichia coli itself.The present invention also provides a kind of recombinant bacteriums, it is the Escherichia coli with aforementioned recombinant plasmid.Recombinant plasmid or recombinant bacterium of the invention are used for 5-ALA fermentation, the yield of 5-ALA, and the metabolism without adding exogenous 5-ALA dehydratase inhibitor to hinder 5-ALA in bacterium can be significantly improved.

Description

A kind of 5-ALA high yield recombinant bacterial strain and application thereof
Technical field
The present invention relates to field of microorganism engineering more particularly to a kind of 5-ALA superior strain and its preparation sides Method.
Background technique
5-ALA (5-Aminolevulinic acid, ALA) also known as 5-ALA, are a kind of non-eggs Casamino acid, molecular weight 131.2.5-ALA is widely present in animals and plants and microbial cell, is organism Interior synthesis chlorophyll, ferroheme, porphyrin and vitamin B12The precursor substance of equal tetrapyrroles.ALA is facing as photosensitizer Have in bed medicine and agriculture field and has been widely used.Medically, ALA can be used for photodynamic therapy and the diagnosis of cancer. In agriculture field, due to 5-ALA have the advantages that degradable, noresidue and to people and animals it is avirulent, can be used as novel Green pesticide, herbicide and growth regulator and the great attention by industry.
In early stage, the production of ALA can only be by being chemically synthesized, but there are complex process, low yield, poison for chemical synthesis More than byproduct and the problems such as polluting environment.So the ALA of bioanalysis synthesis in recent years is concerned.In nature, organism is closed Mainly there are two kinds of approach of C4 and C5 at the metabolic pathway of ALA.C4 approach synthesis ALA is primarily present in animal, fungi and non-sulphur light Close in bacterium, be by succinyl-CoA and glycine 5-aminolevulinate synthetase (ALAS is encoded by hemA) effect Lower condensation generates ALA.In C5 approach, glutamic acid urging Glutamyl-tRNA synthetase (GluRS is encoded by gltX) first Change lower generation glutamy-tRNA, then glutamy-tRNA urging glutamyl-tRNA reductase (GluTR is encoded by hemA) Change lower generation paddy ammonium aldehyde, last paddy ammonium aldehyde generates under paddy ammonium aldehyde aminopherase (GSA-AT is encoded by hemL) catalytic action ALA。
With the continuous development of biotechnology, bioanalysis synthesizes ALA because production process is simple, at low cost, yield is high and ring Concern of the advantages that border is friendly by people.In nature, many biological energy sources synthesize ALA, if photosynthetic bacteria is exactly a kind of energy Synthesis ALA is simultaneously secreted into extracellular microorganism.The wild-type strain screened in nature, ALA product accumulation Amount is too low, and industrial demand is not achieved.Currently, there are two main classes for the method for raising microorganism production ALA: one kind is to utilize to lure The method for becoming breeding selects the bacterial strain of energy high yield ALA, the fermentation accumulation ALA in specific culture medium.Another kind of is to pass through generation C4 the or C5 metabolic pathway for thanking to engineering reconstruction Microbe synthesis ALA, strengthens the expression of key gene, and inhibits ALA generation Thank to the expression of approach middle and lower reaches enzyme (5-ALA dehydratase), to improve the yield of ALA.
5-ALA dehydratase (5-aminolevulinate dehydratase, ALAD) also known as porphobilinogen Synzyme (porphobilinogen synthase, PBGS), is encoded by hemB gene, can be catalyzed the contracting of two molecule ALA asymmetry A molecule porphobilinogen (porphobilinogen, PBG) is synthesized, porphobilinogen is various tetrapyrroles in organism Precursor substance.ALAD can make ALA's during engineering bacterium fermentation produces ALA as the downstream enzyme in ALA metabolic pathway Accumulation reduces (Fig. 1), but lacks the normal activities that this enzyme will affect cell.
During engineering bacteria produces ALA, for the downstream metabolic for reducing ALA, often through the addition levulic acid and Portugal D- The inhibitor such as grape sugar reduce ALAD activity (Nishikawa etc., Journal of Bioscience & Bioengineering, 1999,87 (6): 798.Liu etc., Applied Biochemistry & Biotechnology, 2010,160 (3): 822- 830.) in Lai Tigao fermentation liquid ALA accumulation.The activity of ALAD is reduced by addition inhibitor, so that the fermentation of production ALA Technique becomes complicated, and is unfavorable for the later period to the separating-purifying of ALA, and increase production cost.
Recent study persons reduce the activity of ALAD by the transformation to ALA dehydrase gene.Xie etc. (Biotechnology Letters, 2003,25 (20): 1751-1755.), hemB gene in mutant Escherichia coli, as a result show The yield of ALA is not improved in thallus after showing hemB mutation.Still (modern food science and technology, 2011,27 (7): 742- such as Ke 746) the hemB gene in E.coli MG1655 bacterial strain, is knocked out, although as a result, it has been found that the activity of ALAD is greatly lowered, shadow The growth of thallus is rung, the accumulation of ALA is not also improved.
Summary of the invention
To solve the above-mentioned problems, the present invention provides:
A kind of DNA fragmentation, it includes the unit B for expressing the unit A and silencing hemB gene of hemA gene；
The unit A includes sequence shown in SEQ ID NO.1；
The unit B includes the antisense sequences of hemB gene；The antisense sequences can be with the initiation codon of hemB gene Upstream -57nt arrives the section reverse complemental of initiation codon downstream 139nt；
Contain sequence C and sequence D in the antisense sequences both ends of the unit B；The sequence C and sequence D can reverse complemental match It is right；
The unit A and unit B all have promoter and terminator sequence.Foregoing plasmid, the unit B it is anti- The reverse complemental section of adopted sequence and hemB gene is only limitted to hemB gene start codon upstream -57nt to downstream 139nt.
Foregoing DNA fragmentation, the pairing end sequence length are 25~45bp, preferably 38bp.
Foregoing DNA fragmentation, the promoter are trc promoters；And/or the terminator is rrnB terminator.
Foregoing DNA fragmentation, the unit B have the sequence as shown in SEQ ID NO.4.
The present invention also provides a kind of recombinant plasmids, it is the plasmid containing DNA fragmentation as previously described.
The present invention also provides a kind of recombinant bacteriums, it is the Escherichia coli containing aforementioned recombinant plasmid.
Further, the Escherichia coli are rare codon Optimization-type Escherichia coli Rosetta (DE3).
The present invention also provides aforementioned recombinant plasmids or recombinant bacterium to prepare the purposes in 5-ALA.
The present invention also provides a kind of methods for preparing 5-ALA, include the following steps:
(1) aforementioned recombinant bacterium is accessed in the fermentation broth of the 25 μ g/mL containing kanamycins, 37 DEG C of shake cultures；
(2) to OD600nm be 0.5~0.7 when, toward culture medium be added isopropylthiogalactoside, keep the end of the latter dense Degree is 0.1mM, in 28 DEG C of shake cultures；
(3) recombinant bacterium thallus is collected and ruptured, 5-ALA is purified.
Further, step (2) OD600nmWhen being 0.6, it is initially added into isopropylthiogalactoside.
The present invention can reach it is following the utility model has the advantages that
RNA jamming effectiveness to hemB of the invention is up to 75% or more.
For being only transferred to the Escherichia coli of hemA gene, the Escherichia coli for being transferred to recombinant plasmid of the present invention are significantly improved The yield of 5-ALA；In an embodiment of the present invention, 5-ALA yield point after fermentation 16h and 20h 16.3% and 17.6% are not improved.
Moreover, recombinant bacterial strain of the invention inhibits without adding exogenous 5-ALA dehydratase in fermentation Agent can generate 5-ALA at a high level.
Obviously, above content according to the present invention is not being departed from according to the ordinary technical knowledge and customary means of this field Under the premise of the above-mentioned basic fundamental thought of the present invention, the modification, replacement or change of other diversified forms can also be made.
Above content of the invention is described in further detail again below by way of specific embodiment.But it should not be by this The range for being interpreted as the above-mentioned theme of the present invention is only limitted to example below.All technologies realized based on above content of the present invention are equal Belong to the scope of the present invention.
Detailed description of the invention
Fig. 1: Escherichia coli ferroheme route of synthesis figure.
Fig. 2: a PTasRNA wherein single-stranded secondary structure figure.
Fig. 3: expression plasmid pET28a-hemA building process.
Fig. 4: the building process of antisense expression plasmid pET28a-hemA-asRNA.
The identification of Fig. 5: pET28a-hemA-asRNA plasmid enzyme restriction；M:DNA standard control object；1:pET28a/BamHI；2: pET28a-hemA/BamHI；3:pET28a-hemA/NdeI, BamHI；4:pET28a-hemA-asRNA/BamHI；5: pET28a-hemA-asRNA/NdeI、XhoI。
Fig. 6: the relative expression quantity of hemB gene mRNA in recombinant bacterium.
The content of PBG in Fig. 7: Rosetta/pET28a-hemA and Rosetta/pET28a-hemA-asRNA fermentation liquid.
The content of ALA in Fig. 8: Rosetta/pET28a-hemA and Rosetta/pET28a-hemA-asRNA fermentation liquid.
Specific embodiment
This part with the mode of embodiment and experimental example will further disclose the present invention, embodiment and experiment The part Experiment method used in example is as follows:
The analysis of 1.ALA measures
1.1 reagents prepare
Acetate buffer (pH 4.6): 8.2g anhydrous sodium acetate (NaAc) is weighed in 70mL deionized water, is added 5.7mL glacial acetic acid with deionized water constant volume to 100mL, mixes, 4 DEG C of refrigerators save backup until completely dissolved.
Paradime thylaminobenzaldehyde (DMAB) color developing agent: weighing 1.0g paradime thylaminobenzaldehyde in 30mL glacial acetic acid, Then the HClO of 5mL 70% is sequentially added4, 5mL deionized water.Until completely dissolved with glacial acetic acid constant volume to 50mL, mix It is even, it is kept in dark place in 4 DEG C, brown reagent bottle.
The colour developing of 1.2 photochemistry
Bacterium solution 8000rpm after fermentation is centrifuged 5min, supernatant is taken to dilute multiple (B) appropriate, after taking 120 μ L to dilute Sample in 1.5mL EP pipe, sequentially add 160 μ L acetate buffers, 14 μ L acetylacetone,2,4-pentanediones, boiling water bath heats 15min Afterwards, cooled to room temperature is added 294 μ L DMAB color developing agents and does blank control at room temperature after chromogenic reaction 30min with water, Measure the light absorption value (A at 554nm554)。
The analysis of 2.PBG measures
Bacterium solution 8000rpm after fermentation is centrifuged 5min, takes 500 μ L of supernatant in 1.5mL EP pipe,
Isometric DMAB color developing agent (paradime thylaminobenzaldehyde color developing agent) is added, after mixing, colour developing is anti-at room temperature After answering 30min, 200 μ L reaction solutions are taken, blank control is done with water, the light absorption value (A at its 554am is measured with microplate reader554)。
3. fermented and cultured
3.1 culture medium
LB culture medium (g/L): yeast extract (Yeast extract) 5.0g, peptone (Tryptone) 10.0g, 2% agar strip need to be added if LB solid medium in NaCl 10.0g.
Fermentation medium (g/L): yeast extract (Yeast extract) 5.0g, peptone (Tryptone) 10.0g, Glycine (Glycine) 2.0g, succinic acid (Succcinic acid) 8.0g adjust pH to 6.2 or so with NaOH, and 121 DEG C go out Bacterium 20min, glucose 2.0g, 115 DEG C of sterilizing 30min are mixed after being sterilized separately.
3.2 condition of culture
Spawn incubation: glycerol tube scribing line, then the scribing line of picking single colonie is in the LB plate for containing kanamycins (25 μ g/mL) On, it 37 DEG C, is incubated overnight, as seed source；
Seed culture: the fresh single bacterium of plate picking falls within 5mL and contains in kanamycins (25 μ g/mL) LB liquid medium, and 37 DEG C, 200rpm, shake culture 12-16h.
Fermented and cultured: being contained in the fermentation broth of kanamycins (25 μ g/mL) by 2% inoculum concentration access 100mL, 37 DEG C, 200rpm, shake culture to bacterium solution OD600When being 0.6 or so, final concentration 0.1mM isopropylthiogalactoside is added (IPTG), in 28 DEG C, 200rpm, fermented and cultured is carried out.After cultivating about 20h, bacterium solution is collected.
The building of 1 expression plasmid pET28a-hemA of embodiment
Using Rhodobacter capsulatus total DNA as template, polymerase chain reaction (PCR) amplifying target genes (hemA) are carried out.With 5-aminolevulinate synthetase gene order (the RCAP_rcc01447 5- for the Rhodobacter capsulatus reported on GenBank Aminolevulinate synthase, SEQ ID NO.1, is shown in annex) based on, the primer of design is as follows:
F1: CTGCATATGGACTACAATCTCGCGCTCGACAAAG (SEQ ID NO.2)
R1: ATAGGATCCAGAATGGCTCAGGCAGAGGCC (SEQ ID NO.3)
By above-mentioned target gene hemA, it is firstly connected to pMDTMIn 19-T carrier (Takara).pMDTM19-T carrier connects Junctor system (20 μ L) are as follows: pMDTM1 μ L of 19-T carrier, 2 μ L of target gene fragment, 5 μ L of solution I, add water to mend to 20 μ L.16 DEG C connection overnight.Connection product is transformed into competent escherichia coli cell DH5 α, is allowed to containing amicillin resistance Culture medium on grow, filter out recon.And plasmid is extracted from the Escherichia coli of recombination, digestion identification and sequencing identification nothing Restriction enzyme Nde I and BamH I digestion are used after accidentally, equally use Nde I and BamH I digestion carrier pET-28a.Use DNA Target DNA fragment is connect by connection kit (Takara) with linear pET28a plasmid, linked system (10 μ L) are as follows: pET28a 1 μL、hemA 3μL、Sln I 5μL、ddH2O 1μL。
It is as shown in Figure 3 to construct process.
Connection product is transferred in e.colidh5αcell, picking transformant, extracts plasmid verifying, then further survey Sequence verifying, to obtain recombinant plasmid: pET28a-hemA.
The building of 2 antisense expression plasmid pET28a-hemA-asRNA of embodiment
1. designing and synthesizing the double chain DNA sequence of interference hemB gene, it is named as PTasRNA；The PTasRNA is wherein One single-stranded secondary structure and partial sequence as shown in Fig. 2, including promoter (in the present embodiment be trc promoter), HemB gene antisense sequence (antisense RNA), the PT being connected directly with antisense sequences (pairing end) sequence, terminator (this implementation It is rrnB terminator in example) and partially digested site；The PTasRNA complete sequence (SEQ ID NO.4), hemB gene itself Complete sequence (SEQ ID NO.5) see annex.
2. rmB terminator sequence is cloned on plasmid pET28a-hemA (BamH I/Hind III), with the terminator The transcription of hemA gene on plasmid is terminated, obtains recombinant plasmid pET28a-hemA-T.
3. the double-stranded DNA form of PTasRNA is cloned into pET28a-hemA-T, antisense expression plasmid pET28a- is obtained hemA-asRNA。
The above building process is as shown in Figure 4.
PET28a-hemA-asRNA is transferred in bacillus coli DH 5 alpha competent cell, plasmid is extracted and carries out digestion identification (Fig. 5), the prosperous biological Co., Ltd's sequencing in recombinant plasmid Song Qing section Chinese catalpa after identifying successfully, to obtain correct antisense expression plasmid pET28a-hemA-asRNA。
The building of embodiment 3ALA fermentation recombinant bacterium
The recombinant plasmid pET28a-hemA built is transferred to rare codon Optimization-type Escherichia coli Rosetta (DE3) In bacterial strain, recombinant bacterium Rosetta/pET28a-hemA is obtained.The antisense expression plasmid pET28a-hemA-asRNA that will be built It is transferred in Escherichia coli Rosetta (DE3) bacterial strain, obtains recombinant bacterium Rosetta/pET28a-hemA-asRNA.
The verifying of 1 real-time fluorescence quantitative PCR of experimental example
By recombinant bacterium Rosetta/pET28a-hemA and Rosetta/pET28a-hemA-asRNA distinguish fermented and cultured 4h, It is extracted the total serum IgE of recombinant bacterium after 8h, 12h, 16h, 20h, after reverse transcription is cDNA, carries out fluorescent quantitation by template of cDNA PCR。
Primer used in quantitative fluorescent PCR is as follows:
HemB:F4: CAGGTACAGGCGATTCGTCA (SEQ ID NO.6)
R4-TCACGACGGTTCATTGGGTT(SEQ ID NO.7)
16SRNA:F5-GAGCGCAACCCTTATCCTTTG(SEQ ID NO.8)
R5-TACTAGCGATTCCGACTTCATGG(SEQ ID NO.9)
Real-time fluorescence quantitative PCR reaction system (25 μ L): 12.5 μ L of SYBR Premix Ex Taq II, PCR Forward Primer (10 μM) 1 μ L, PCR Reverse Primer (10 μM) 1 μ L, 1 μ L of cDNA template, sterilizing ddH2O 9.5μL。
Real-time fluorescence quantitative PCR program setting (two-step method): 95 DEG C 30 seconds；95 DEG C 5 seconds, 60 DEG C 30 seconds, follow for 40 times Ring；
It carries out quantitative fluorescent PCR and Ct value is determined according to amplification curve later, calculate 2 according to Ct value-ΔΔCtValue determines each gene Relative expression quantity.If be 1 with the expression quantity of hemB in recombinant bacterial strain Rosetta/pET28a-hemA-asRNA, it is not inserted into The expression quantity of hemB gene has reached 11 in the control group Rosetta/pET28a-hemA of antisense sequences, it can be seen that insertion Antisense RNA plays certain inhibiting effect to the expression of hemB gene, and after fermented and cultured 4h, jamming effectiveness reaches 75% or more, as shown in Figure 6.
The fermentation verifying of 2 recombinant bacterium of experimental example
Recombinant bacterium Rosetta/pET28a-hemA-asRNA and control bacterium Rosetta/pET28a-hemA are connect by 2% Kind amount is inoculated in respectively in the fermentation medium that 100mL, pH are 6.4, to bacterium solution OD600When being 0.6, the IPTG of 0.1mM is added, 28 DEG C, after 200rpm fermented and cultured 4h, 8h, 12h, 16h, 20h, detect the content of ALA and PBG in fermentation liquid.
PBG production quantity in recombinant bacterium Rosetta/pET28a-hemA-asRNA fermentation liquid reduces (such as Fig. 7), illustrates Antisense RNA inhibition conversion of the ALA to PBG, slows down the wear rate of ALA, increases the accumulation of ALA in fermentation liquid. Rosetta/pET28a-hemA-asRNA is higher than bacterial strain Rosetta/pET28a-hemA in the ALA yield of each period, And 16.3% and 17.6% is respectively increased in 16h and 20h ALA yield.In 20h, bacterial strain Rosetta/pET28a-hemA- ALA content in asRNA shake flask fermentation liquid is up to 1231mg/L (such as Fig. 8).The result shows that being inserted into the bacterial strain of Antisense RNA sequence After the expression for inhibiting hemB, conversion of the ALA to PBG in fermentation liquid is reduced, ALA in fermentation liquid is made to have obtained effective accumulation.
The present invention weakens hemB table using antisense RNA perturbation technique by strengthening the expression of hemA in Escherichia coli It reaches, under the conditions of shaking flask, so that the accumulation of ALA in escherichia coli fermented broth has been increased to 1231mg/L by 76.5mg/L, have Good application prospect.
Subparts nucleotide sequence
1.hemA nucleotide sequence (SEQ ID NO.1)
The nucleotide sequence (SEQ ID NO.4) of 2.PTasRNA
3.hemB nucleotide sequence (SEQ ID NO.5)
SEQUENCE LISTING
<110>Sichuan Teachers University
<120>a kind of 5-ALA high yield recombinant bacterial strain and application thereof
<130> GYKH1165-2019P015311CC
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 1238
<212> DNA
<213> Rhodobacter capsulatus
<400> 1
atggactaca atctcgcgct cgacaaagcg atccagaagc tccacgacga gggacgttac 60
cgcacgttca tcgacatcga acgcgagaag ggcgccttcc ccaaggcgca gtggaaccgc 120
cccgatggcg gcaagcagga catcaccgtc tggtgcggca acgactatct gggcatgggc 180
cagcacccgg tcgttctggc cgcgatgcat gaggcgctgg aagcggtcgg ggccgggtcg 240
ggtggcaccc gcaacatctc gggcaccacg gcctatcacc gccgccttga ggccgagatc 300
gccgatctgc accagaaaga agccgcgctg gtcttttcct cggcctacaa cgccaatgac 360
gccacgcttt cgaccctgcg cgtgctcttc cccggcctga tcatctattc cgacagcctg 420
aaccacgcct cgatgatcga ggggatcaag cgcaatgccg ggccgaagcg gatcttccgt 480
cacaatgacg tcgcgcatct gcgcgagctg atcgccgccg atgatccggc cgcgccgaag 540
ctgatcgcct tcgaatcggt ctattcgatg gatggcgact tcggcccgat caaggaaatc 600
tgcgacatcg ccgaggaatt cggcgcgctg acctatatcg acgaagtcca tgccgtcggc 660
atgtatggcc cccgcggcgc gggcgtggcg gaacgcgacg gtctgatgca tcgcatcgac 720
atcttcaacg gcacgctggc gaaagcctac ggcgtcttcg gcggctatat cgccgcttcg 780
gcgcggatgg tcgatgccgt gcgctcctat gcgccgggct tcatcttctc gacctcgctg 840
ccgccggcga tcgccgcggg cgcgcaggcc tcgatcgcct tcctgaaaac cgccgaaggg 900
cagaagctgc gcgacgcgca acagatgcac gccaaggttc tcaagatgcg gctcaaggcg 960
ctcggcatgc cgatcatcga ccacggcagc cacatcgttc cggtggtcat cggcgacccc 1020
gtgcacacca aggcggtgtc ggacatgctc ttgtcggatt acggcgttta cgtgcagccg 1080
atcaacttcc cgacggtgcc gcgcggcacc gaacggctgc gcttcacccc ctcgccggtg 1140
catgatctca agcagatcga cgggctcgtt catgccatgg atctgctctg ggcgcgctgt 1200
gcgctgaatc gcgccgaggc ctctgcctga gccattct 1238
<210> 2
<211> 34
<212> DNA
<213>artificial sequence
<400> 2
ctgcatatgg actacaatct cgcgctcgac aaag 34
<210> 3
<211> 30
<212> DNA
<213>artificial sequence
<400> 3
ataggatcca gaatggctca ggcagaggcc 30
<210> 4
<211> 714
<212> DNA
<213>artificial sequence
<400> 4
gagctctgca ggtcgtaaat cactgcataa ttcgtgtcgc tcaaggcgca ctcccgttct 60
ggataatgtt ttttgcgccg acatcataac ggttctggca aatattctga aatgagctgt 120
tgacaattaa tcatccggct cgtataatgt gtggaattgt gagcggataa caatttcagg 180
aggaattaac catgcagtgg tggtggtggt ggtgccatgg cggctttgta gtcgtcaatt 240
tcttcttcaa caaagatcgg caacaccagg tcgttaaggc taagtgttgt ctcttcaaac 300
atagcgcgca gcgcaggaga tttgcgcagg cgacgagggc gttggattaa gtctgtcatg 360
gtctgcctga tgtttgtgga attaaggtgc acagtatacc tgaagcgggg caggagggat 420
ccaccaccac caccaccact gcatggttaa ttcctcctag ttttggcgga tgagagaaga 480
ttttcagcct gatacagatt aaatcagaac gcagaagcgg tctgataaaa cagaatttgc 540
ctggcggcag tagcgcggtg gtcccacctg accccatgcc gaactcagaa gtgaaacgcc 600
gtagcgccga tggtagtgtg gggtctcccc atgcgagagt agggaactgc caggcatcaa 660
ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt ttatctgcgg ccgc 714
<210> 5
<211> 975
<212> DNA
<213> Rhodobacter capsulatus
<400> 5
atgacagact taatccaacg ccctcgtcgc ctgcgcaaat ctcctgcgct gcgcgctatg 60
tttgaagaga caacacttag ccttaacgac ctggtgttgc cgatctttgt tgaagaagaa 120
attgacgact acaaagccgt tgaagccatg ccaggcgtga tgcgcattcc agagaaacat 180
ctggcacgcg aaattgaacg catcgccaac gccggtattc gttccgtgat gacttttggc 240
atctctcacc ataccgatga aaccggcagc gatgcctggc gggaagatgg actggtggcg 300
cgtatgtcgc gcatctgcaa gcagaccgtg ccagaaatga tcgttatgtc agacacctgc 360
ttctgtgaat acacttctca cggtcactgc ggtgtgctgt gcgagcatgg cgtcgacaac 420
gacgcgactc tggaaaattt aggcaagcaa gccgtggttg cagctgctgc aggtgcagac 480
ttcatcgccc cttccgccgc gatggacggc caggtacagg cgattcgtca ggcgctggac 540
gctgcgggat ttaaagatac ggcgattatg tcgtattcga ccaagttcgc ctcctccttt 600
tatggcccgt tccgtgaagc tgccggaagc gcattaaaag gcgaccgcaa aagctatcag 660
atgaacccaa tgaaccgtcg tgaggcgatt cgtgaatcac tgctggatga agcccagggc 720
gcagactgcc tgatggttaa acctgctgga gcgtacctcg acatcgtgcg tgagctgcgt 780
gaacgtactg aattgccgat tggcgcgtat caggtgagcg gtgagtatgc gatgattaag 840
ttcgccgcgc tggcgggtgc tatagatgaa gagaaagtcg tgctcgaaag cttaggttcg 900
attaagcgtg cgggtgcgga tctgattttc agctactttg cgctggattt ggctgagaag 960
aagattctgc gttaa 975
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
caggtacagg cgattcgtca 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
tcacgacggt tcattgggtt 20
<210> 8
<211> 21
<212> DNA
<213>artificial sequence
<400> 8
gagcgcaacc cttatccttt g 21
<210> 9
<211> 23
<212> DNA
<213>artificial sequence
<400> 9
tactagcgat tccgacttca tgg 23

Claims (10)

1. a kind of DNA fragmentation, it is characterised in that: it includes the unit B for expressing the unit A and silencing hemB gene of hemA gene；
The unit A includes sequence shown in SEQ ID NO.1；
The unit B includes the antisense sequences of hemB gene；The antisense sequences can be with the upstream from start codon-of hemB gene Section reverse complemental of the 57nt to initiation codon downstream 139nt；
Contain sequence C and sequence D in the antisense sequences both ends of the unit B；The sequence C and sequence D can reverse complemental pairings；
The unit A and unit B all have promoter and terminator sequence.
2. DNA fragmentation as described in claim 1, it is characterised in that: the pairing end sequence length is 25~45bp, preferably 38bp。
3. DNA fragmentation as described in claim 1, it is characterised in that: the promoter is trc promoter；And/or the termination Son is rrnB terminator.
4. DNA fragmentation as described in claim 1, it is characterised in that: the unit B has the sequence as shown in SEQ ID NO.4 Column.
5. a kind of recombinant plasmid, it is characterised in that: it includes any DNA fragmentation of Claims 1 to 4.
6. a kind of recombinant bacterium, it is characterised in that: it is the Escherichia coli containing recombinant plasmid as claimed in claim 5.
7. recombinant bacterium as claimed in claim 6, it is characterised in that: the Escherichia coli are rare codon Optimization-type large intestine bars Bacterium Rosetta (DE3).
8. claim 1~7 plasmid or recombinant bacterium are preparing the purposes in 5-ALA.
9. a kind of method for preparing 5-ALA, which comprises the steps of:
(1) recombinant bacterium as claimed in claims 6 or 7 is accessed in the fermentation broth of the 25 μ g/mL containing kanamycins, 37 DEG C Shake culture；
(2) OD is arrived600nmWhen being 0.5~0.7, isopropylthiogalactoside is added toward culture medium, makes that the latter's is final concentration of 0.1mM, in 28 DEG C of shake cultures；
(3) recombinant bacterium thallus is collected and ruptured, 5-ALA is purified.
10. a kind of method for preparing 5-ALA, it is characterised in that: step (2) described OD600nmWhen being 0.6, start to add Enter isopropylthiogalactoside.
CN201910246577.3A 2019-03-28 2019-03-28 5-aminolevulinic acid high-yield recombinant strain and application thereof Active CN110004164B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910246577.3A CN110004164B (en) 2019-03-28 2019-03-28 5-aminolevulinic acid high-yield recombinant strain and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910246577.3A CN110004164B (en) 2019-03-28 2019-03-28 5-aminolevulinic acid high-yield recombinant strain and application thereof

Publications (2)

Publication Number Publication Date
CN110004164A true CN110004164A (en) 2019-07-12
CN110004164B CN110004164B (en) 2023-01-13

Family

ID=67168736

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910246577.3A Active CN110004164B (en) 2019-03-28 2019-03-28 5-aminolevulinic acid high-yield recombinant strain and application thereof

Country Status (1)

Country Link
CN (1) CN110004164B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114134184A (en) * 2021-11-25 2022-03-04 南宁汉和生物科技股份有限公司 Method for improving synthesis of 5-aminolevulinic acid by escherichia coli engineering bacteria by adding vitamin B6

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103695364A (en) * 2014-01-14 2014-04-02 中国科学院天津工业生物技术研究所 5-aminolevulinic acid high-producing strain obtained by weakening activity of 5-aminolevulinic acid dehydratase and application of strain
WO2015047202A2 (en) * 2013-09-24 2015-04-02 Kars Gokhan Rhodobacter sphaeroides o.u.oo1 producing 5-aminolevulinic acid with a new metabolic pathway and 5-aminolevulinic acid production method
CN104830748A (en) * 2015-06-02 2015-08-12 江南大学 Method for weakening hemB gene expression to increase yield of 5-aminolevulinic acid synthesized by escherichia coli
US20150376661A1 (en) * 2013-02-07 2015-12-31 Tianjin Institute Of Industrial Biotechnology, Chinese Academy Of Sciences 5-aminolevulinic acid high-yield bacterial strain, preparation method and use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150376661A1 (en) * 2013-02-07 2015-12-31 Tianjin Institute Of Industrial Biotechnology, Chinese Academy Of Sciences 5-aminolevulinic acid high-yield bacterial strain, preparation method and use thereof
WO2015047202A2 (en) * 2013-09-24 2015-04-02 Kars Gokhan Rhodobacter sphaeroides o.u.oo1 producing 5-aminolevulinic acid with a new metabolic pathway and 5-aminolevulinic acid production method
CN103695364A (en) * 2014-01-14 2014-04-02 中国科学院天津工业生物技术研究所 5-aminolevulinic acid high-producing strain obtained by weakening activity of 5-aminolevulinic acid dehydratase and application of strain
CN104830748A (en) * 2015-06-02 2015-08-12 江南大学 Method for weakening hemB gene expression to increase yield of 5-aminolevulinic acid synthesized by escherichia coli

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
刘艳等: "表达浑球红细菌hemA基因生产5-氨基乙酰丙酸的研究", 《激光生物学报》 *
郭小飞等: "利用5-氨基乙酰丙酸脱水酶缺失的重组大肠杆菌合成5-氨基乙酰丙酸", 《天津科技大学学报》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114134184A (en) * 2021-11-25 2022-03-04 南宁汉和生物科技股份有限公司 Method for improving synthesis of 5-aminolevulinic acid by escherichia coli engineering bacteria by adding vitamin B6
CN114134184B (en) * 2021-11-25 2023-11-28 南宁汉和生物科技股份有限公司 Method for improving synthesis of 5-aminolevulinic acid by escherichia coli engineering bacteria by adding vitamin B6

Also Published As

Publication number Publication date
CN110004164B (en) 2023-01-13

Similar Documents

Publication Publication Date Title
KR101814888B1 (en) 5-aminolevulinic acid high-yield bacterial strain, preparation method and uses thereof
KR102223521B1 (en) Recombinant Microorganisms Producing Methyl-anthranilate and Method for Producing Methyl-anthranilate Using the Same
CN104004701B (en) Method for building high-yield 5-aminolevulinic acid escherichia coli engineering strains
Patel et al. Bioreactor studies of production of mycophenolic acid by Penicillium brevicompactum
CN106754607A (en) A kind of recombinant bacterial strain and its construction method for producing tyrosol
CN108531437A (en) A kind of 5-ALA biosynthesis pathway that Glyoxylate transaminase mediates
CN103328498B (en) New O-acetylhomoserine sulfhydrylase or its mutant protein, and use it to change into the method for methionine(Met)
CN110004164A (en) A kind of 5-ALA high yield recombinant bacterial strain and application thereof
Cai et al. Complete genome sequence of Bacillus amyloliquefaciens LFB112 isolated from Chinese herbs, a strain of a broad inhibitory spectrum against domestic animal pathogens
TW201016849A (en) Method for producing lactate using plant-derived materail and lactate-producing bacteria
CN110283800B (en) Glucose oxidation enzyme mutant, double enzyme coexpression vectors and its application
CN102234624B (en) Genetic engineering strain for expression and generation of bacillus subtilis arginase, and constructing method thereof
CN110452861A (en) A kind of genetic recombination engineering bacteria and its catalyzing and synthesizing the application in D- pantoyl internal ester
KR101326255B1 (en) Recombinant Microorganism Having Enhanced Productivity of 5-Aminolevulinic Acid and Method of Producing 5-aminolevulinic Acid Using the Same
CN110218691A (en) One plant of genetic engineering bacterium for synthesizing altheine and its construction method and application
CN106085931A (en) Produce engineering bacteria and the application thereof of trans 4 hydroxyprolines
US10351885B2 (en) Variant microorganism producing 5-aminolevulinic acid and method for preparing 5-aminolevulinic acid using therof
CN108977455A (en) For producing the recombinant plasmid, escherichia expression system and methods and applications of oxalate decarboxylase
US20230126375A1 (en) Engineered bacteria and methods of producing sustainable biomolecules
JP2007244222A (en) Method for producing carotenoids by fermenting method
CN106148336B (en) Novel L-threonine-inducible promoter and its application
WO2023039646A1 (en) Agricultural composition composed by consortium between azospirillum sp. and pseudomonas sp., production process and increased stability thereof, and use as promotor of plant growth for agricultural application
CN109097315A (en) The genetic engineering bacterium and its construction method of a kind of high yield lipopeptid and application
CN107460175A (en) Optimize method, recombinant bacterium and its application for carrying out Glucose oxidase secretion expression based on metabolic engineering
KR101023788B1 (en) Recombinant plasmid, biotin producing microorganism transformed by the recombinant plasmid and method for manufacturing biotin using the transformed biotin producing microorganism

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant