CN111440733A - Recombinant saccharomyces cerevisiae for producing terpineol, construction method and application - Google Patents

Abstract

The invention discloses a recombinant saccharomyces cerevisiae for producing terpineol, a construction method and application thereof, wherein the construction method of the recombinant saccharomyces cerevisiae for producing the terpineol comprises the following steps: using a method of homologous recombination, the strain of saccharomyces cerevisiae ATCC: 208352, introducing a truncated terpineol synthase coding gene delta Ts to obtain a recombinant bacterium 1; introducing a truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase encoding gene tHMG1 and an isopentenyl pyrophosphate isomerase encoding gene IDI1 into the recombinant bacterium 1 to obtain a recombinant bacterium 2; experiments prove that the recombinant saccharomyces cerevisiae for producing the terpineol is fermented, so that the yield of the terpineol is high. The invention successfully constructs the recombinant saccharomyces cerevisiae for producing the terpineol. Lays a foundation for the synthesis of terpineol by artificial cells.

Description

Recombinant saccharomyces cerevisiae for producing terpineol, construction method and application

Technical Field

The invention relates to the technical field of biology, in particular to a recombinant saccharomyces cerevisiae for producing terpineol, a construction method and application thereof.

Background

Terpineol is a monoterpene alcohol compound with 10 carbon atom skeleton, is the main component of many plant essential oils, and has lilac flavor, and its formate and acetate can be used for preparing essence, and can be used in high-grade solvent and deodorizer, also can be used in medicine, pesticide, plastics, soap and ink industry, and also can be used as color solvent on glassware. At present, the preparation method mainly uses plant extraction or turpentine as a raw material, a small amount of peregal is added into sulfuric acid as an emulsifier, hydration reaction is carried out at normal temperature, so that main component pinene in the turpentine generates hydrated terpene diol, crude terpineol is obtained by dehydration, and fractionation is carried out.

Synthetic biology techniques have attracted considerable attention since their advent, and are a cross-discipline involving biology, genetics, chemistry, computer science, and engineering, with a focus on metabolic flux changes, as opposed to genetic engineering, which involves a large range of genetic engineering. Many terpenoids have high application value, some terpenoids have low content in plants and cannot be well developed and utilized, the preparation by a chemical synthesis method is complicated, the synthesis of plant-derived terpenoids with high added value by a microbial platform becomes a research hotspot of scientists in the field by synthesizing arteannuic acid serving as a precursor of the antimalarial drug artemisinin by saccharomyces cerevisiae; synthesizing anticancer drug taxol precursor taxadiene by using escherichia coli; uses saccharomyces cerevisiae to synthesize the precursor of tanshinone and the like of antibacterial and anti-inflammatory drugs.

However, the synthesis of monoterpene terpineol by using saccharomyces cerevisiae as a chassis is not reported.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a recombinant saccharomyces cerevisiae for producing terpineol.

The second object of the present invention is to provide a second terpineol-producing recombinant s.cerevisiae.

The third object of the present invention is to provide a third recombinant s.cerevisiae producing terpineol.

The fourth object of the present invention is to provide a fourth recombinant s.cerevisiae producing terpineol.

The fifth object of the present invention is to provide a fifth terpineol-producing recombinant s.cerevisiae.

The sixth purpose of the invention is to provide a construction method of the recombinant saccharomyces cerevisiae for producing terpineol.

The seventh purpose of the invention is to provide the application of the recombinant saccharomyces cerevisiae for producing the terpineol in the preparation of the terpineol by fermentation.

The technical scheme of the invention is summarized as follows:

a construction method of recombinant saccharomyces cerevisiae for producing terpineol comprises the following steps:

using a method of homologous recombination, the strain of saccharomyces cerevisiae ATCC: 208352, introducing a truncated terpineol synthase coding gene delta Ts to obtain a recombinant bacterium 1;

the nucleotide sequence of the truncated terpineol synthase coding gene delta Ts is shown in SEQ ID NO. 1.

The second construction method of the recombinant saccharomyces cerevisiae for producing the terpineol comprises the following steps:

introducing a truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase encoding gene tHMG1 and an isopentenyl pyrophosphate isomerase encoding gene IDI1 into the recombinant bacterium 1 by utilizing a homologous recombination method to obtain a recombinant bacterium 2;

the nucleotide sequence of the truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene tHMG1 is shown in SEQ ID NO. 5;

the nucleotide sequence of the isopentenyl pyrophosphate isomerase coding gene IDI1 is shown in SEQ ID NO. 6.

The third construction method of the recombinant saccharomyces cerevisiae for producing the terpineol comprises the following steps:

introducing a mutated farnesyl pyrophosphate synthase encoding gene MERg20 into an ERG20 site in the recombinant bacterium 2 by using a homologous recombination method to obtain a recombinant bacterium 3;

the nucleotide sequence of the mutated farnesyl pyrophosphate synthase encoding gene MErg20 is shown in SEQ ID No. 11.

The fourth construction method of the recombinant saccharomyces cerevisiae for producing the terpineol comprises the following steps:

introducing a fusion protein coding gene ERG20FTs of mutated farnesyl pyrophosphate synthase and truncated terpineol synthase into the recombinant bacterium 3 by using a homologous recombination method to obtain a recombinant bacterium 4;

the nucleotide sequence of the coding gene ERG20FTs is shown in SEQ ID NO. 12.

The fifth construction method of the recombinant saccharomyces cerevisiae for producing terpineol comprises the following steps:

by utilizing a homologous recombination method, introducing a squalene synthase coding gene ERG9 into the recombinant strain 4 to obtain a recombinant strain 5;

the nucleotide sequence of the squalene synthase coding gene ERG9 is shown in SEQ ID NO. 13.

The recombinant saccharomyces cerevisiae for producing terpineol constructed by the methods.

The recombinant saccharomyces cerevisiae for producing terpineol is applied to producing terpineol.

Experiments prove that the recombinant saccharomyces cerevisiae for producing the terpineol disclosed by the invention is fermented, so that the yield of the terpineol is high. The invention successfully constructs the recombinant saccharomyces cerevisiae for producing the terpineol. Lays a foundation for the synthesis of terpineol by artificial cells.

Drawings

FIG. 1 shows the results of GC-MS analysis of terpineol. In FIG. 1, a is a gas chromatogram for detection. A in a is a gas chromatography-mass spectrometry detection spectrogram of W303-1 a; b is a gas chromatography-mass spectrometry detection spectrogram of the recombinant bacterium 1; c is a gas chromatography-mass spectrometry detection spectrogram of the terpineol standard substance; 1 is a chromatographic peak of a terpineol standard substance; and 2 is a chromatographic peak of a product produced by the recombinant bacterium 1. In fig. 1, b is a mass spectrum of a product produced by the recombinant bacterium 1, namely a mass spectrum corresponding to peak 2 in a. In fig. 1, c is a mass spectrum of the terpineol standard, i.e., a mass spectrum corresponding to peak 1 in a.

FIG. 2 is a comparison of terpineol production by recombinant Saccharomyces cerevisiae strains.

Detailed Description

The present invention will be further illustrated by the following specific examples.

The experimental procedures used in the following examples are all conventional ones unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Saccharomyces cerevisiae W303-1a, American ATCC: 208352, time of purchase, 2016.6 website: https:// www.atcc.org

Example 1 preparation of the respective fragment sources

(1) The gene elements △ TS sequence (truncated △ TS, original TS from grape (Vitisinifera)), MERg20 sequence (mutated ERG20, original ERG20 from Saccharomyces cerevisiae), ERG20FTs sequence (mutated ERG20 and △ TS fusion protein coding gene).

The URA3 sequence, ADE2 sequence, TRP1 sequence, L EU2 sequence and HIS3 sequence are all derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae), are synthesized by the company, are connected to an Escherichia coli plasmid pUC57, and are stored in Escherichia coli.

The nucleotide sequence of △ TS is shown as SEQ ID NO.1, the nucleotide sequence of MERg20 is shown as SEQ ID NO.11, the nucleotide sequence of ERG20FTs (artificial sequence of gene for coding fusion protein) is shown as SEQ ID NO.12, the nucleotide sequence of URA3 is shown as SEQ ID NO.16, the nucleotide sequence of ADE2 is shown as SEQ ID NO.4, the nucleotide sequence of TRP1 is shown as SEQ ID NO.17, the nucleotide sequence of L EU2 is shown as SEQ ID NO.15, and the nucleotide sequence of HIS3 is shown as SEQ ID NO. 14.

(2) The saccharomyces cerevisiae endogenous fragment is obtained by extracting a saccharomyces cerevisiae genome, taking the saccharomyces cerevisiae genome as a template and carrying out PCR amplification.

The extraction method of Saccharomyces cerevisiae genome comprises inoculating Saccharomyces cerevisiae (W303-1a) in liquid YPD medium, culturing overnight at 30 deg.C by shaking table, sucking overnight cultured Saccharomyces cerevisiae into 2M L centrifuge tube, centrifuging at 10000rpm for 1min, discarding supernatant, collecting bottom thallus precipitate, adding quartz sand with volume equal to thallus volume into centrifuge tube, adding STES lysate of 400 μ L and phenol/chloroform/isoamylol of 400 μ L, placing the mixture in oscillator, oscillating for 10min, adding TE solution of 400 μ L into the centrifuge tube after oscillation, mixing well, centrifuging to obtain supernatant, transferring supernatant into new 2M L centrifuge tube, adding 3M NaAc of 1/10 volume and anhydrous ethanol of 2 times volume into the collected supernatant, mixing well, placing at-20 deg.C for 1h, centrifuging at 10000rpm for 10min, observing small amount of white precipitate at the bottom of centrifuge tube, namely DNA, removing supernatant, rinsing with 75% ethanol, ventilating once, adding residual ethanol, and volatilizing at L deg.C, measuring residual ethanol concentration in refrigerator, and measuring residual DNA.

The formulation of the solution used was as follows:

Tris-HCl (50 mmol/L) solution 50m L in 0.1 mol/L Tris solution and 29.2m L in 0.1 mol/L HCl solution were mixed uniformly and then made up to 100m L with water.

EDTA (0.5 mol/L) solution 18.16g Na₂EDTA·2H₂O was dissolved in water and made to volume of 100m L, and the pH was adjusted to 8.0 with solid NaOH.

The formulation of TE solution was 200ml of Tris-HCl (50 mmol/L) solution and 2m of EDTA (0.5 mol/L) solution (L m), mixed and added with water to a constant volume of 1L.

The STES lysate formulation was prepared by mixing 20m L Tris-HCl (50 mmol/L) solution, 2m L Triton X-100 solution, 0.584g NaCl, 200. mu. L EDTA (0.5 mol/L) solution, and adding water to 100m L volume.

5. Phenol in phenol/chloroform/isoamyl alcohol mixture: chloroform: isoamyl alcohol 25:24: 1.

(3) The invention adopts high fidelity polymerase of Vazyme company to amplify DNA fragments, and the reaction system comprises the following components:

the PCR reaction procedure was as follows:

the Tm value is determined according to the annealing temperature of the primer.

(4) The plasmid preserved in the escherichia coli is extracted by using a small Tiangen plasmid extraction kit, and the steps are as follows:

1. inoculating Escherichia coli into L B liquid culture medium containing antibiotic, culturing, collecting 1-5m L bacterial liquid in a centrifuge tube, centrifuging at 12000rpm for 1min, discarding supernatant, and collecting thallus at the bottom of the centrifuge tube (the supernatant is removed as much as possible);

2. the adsorption column is balanced by B L equilibrium liquid of 500 mu L, and centrifuged at 12000rpm, and waste liquid in the collection tube is poured out;

3. adding 250 mu L of P1 solution into a centrifuge tube with the bacterial sediment, and completely suspending the bacterial sediment;

4. adding 250 mu L P2 lysis solution into the centrifuge tube, turning the centrifuge tube gently to make the thalli fully lysed, wherein the bacterial liquid becomes clear at the moment, and the lysis time cannot be too long to avoid plasmid damage;

5. adding 350 mu L P3 solution into the centrifuge tube, turning the centrifuge tube up and down to precipitate the protein;

6. centrifuging the centrifuge tube at 12000rpm for 10min, centrifuging the precipitate to the bottom completely, collecting supernatant, placing in adsorption column balanced with B L solution, adsorbing in refrigerator at-20 deg.C for 5min, centrifuging at 12000rpm for 1min, and removing waste liquid in the collection tube;

7. rinsing the adsorption column with the adsorbed plasmid twice with PW solution containing alcohol to remove impurities, centrifuging at 12000rpm for 2min to remove PW as much as possible, and placing the adsorption column in ventilation position to volatilize alcohol.

8. 50-100 μ L deionized water was added to the adsorption column, and the column was placed at 37 ℃ for 10min to dissolve the plasmid in water, and the column was placed in a centrifuge tube and centrifuged at 12000rpm for 2min to collect the plasmid.

Example 2 construction of recombinant Saccharomyces cerevisiae (recombinant bacterium 1) producing terpineol

(1)URA3-up，P_Tef1-ΔTs-T_Cyc1Construction of HIS3-URA3-down

PCR was performed using the PCR templates and primers described in Table 1, respectively, to obtain DNA fragments: m1(URA3-up), M2 (P)_Tef1)，M3(ΔTs)，M4(T_Cyc1)，M5(HIS3)，M6(URA3-down)。

TABLE 1 primer sequences

The fragments M2, M3 and M4 were fused into expression cassette P by fusion PCR_Tef1-ΔTs-T_Cyc1；

The fragments M5 and M6 were fused into the HIS3-URA3-down fragment by fusion PCR.

The fusion PCR method includes mixing the fused fragments in equimolar ratio and in total amount of over 800ng, adding dNTPs, 2 × Phanta Max Buffer, DNA polymerase and deionized water to compound 50u L PCR system, annealing at 60 deg.c and 11cycles, extending time calculated based on the total module length, using the fused fragments as template, PCR amplifying and purifying to obtain URA3-up module, P_Tef1-ΔTs-T_Cyc1，HIS3-URA3-down。

(2) Construction of recombinant bacterium 1

1. Inoculating Saccharomyces cerevisiae W303-1a into a test tube YPD, carrying out shaking table overnight culture at 30 ℃, transferring the overnight cultured Saccharomyces cerevisiae into a new test tube YPD liquid culture medium according to the volume ratio of 1/10, carrying out shaking table culture at 30 ℃ for 4-5h to enable the Saccharomyces cerevisiae to reach a logarithmic growth phase, 3, taking 1m L bacterial liquid in a sterile centrifuge tube, centrifuging at 5000rpm for 3min, removing supernatant, collecting bottom bacterial liquid, washing the bacterial liquid once with 1m L sterile water, 4, resuspending the washed Saccharomyces cerevisiae with 1m L100 mM L iAc, standing for 5min, centrifuging at 5.5000rpm for 3min, removing L iAc solution, reserving bottom Saccharomyces cerevisiae, 6, preparing a transformation system in the centrifuge tube containing the Saccharomyces cerevisiae, and specifically adding reagents and the sequence as follows:

the transformed DNA fragment comprises URA3-up, P_Tef1-ΔTs-T_Cyc1HIS3-URA3-down, each fragment being greater than 300 ng;

7. wherein the salmon sperm DNA is boiled in boiling water for 5min to melt, and then is rapidly transferred to ice bath for yeast transformation;

8. blowing and sucking the prepared conversion system by a pipette or placing the conversion system on a vortex oscillator to vibrate for 1min to fully and uniformly mix the system, placing the system in a 42 ℃ water bath kettle, and thermally exciting for 30 min;

9. centrifuging the yeast after heat shock, removing supernatant with a pipette, adding 1m L YPD medium, and recovering in a shaker at 30 deg.C for 2 hr;

10.5000rpm for 3min, removing YPD liquid medium, and washing with sterile water for 2 times;

11. 100 μ L sterile water was added, the yeast cells were resuspended and plated on SC selection medium lacking histidine and incubated in an incubator at 30 ℃ for 2-3 d.

12. After single bacteria grow out, colony PCR is carried out, and crude extraction is needed to be carried out on the genome, the invention adopts a freeze-thaw method to carry out crude extraction on the saccharomyces cerevisiae genome, firstly, the single bacteria colony is picked into 10 mu L NaOH solution with the concentration of 10mM, boiled in boiling water for 10min, then put into a refrigerator with the temperature of minus 20 ℃ for freezing for 10min, and repeated freeze-thaw is carried out for three times, namely, the genome is crude extracted, the crude extract can be directly used as a template, colony verification is carried out, and the correct strain is verified to be the recombinant bacteria 1 (T1).

SC selection medium formulation 6.7 g/L Yeast Nitrogen Base (YNB), 20 g/L glucose or galactose, 2 g/L corresponding default amino acid mixture.

The starting strains Saccharomyces cerevisiae W303-1a of the invention lack genes L eu2, Trp1, Ura3, Ade2 and His3 and are used for screening and marking, so when preparing the SC selective medium, corresponding components are supplemented as required, and the final concentrations are leucine L eu 0.1 g/L, tryptophan Trp 0.02 g/L, histidine His 0.02 g/L, uracil Ura 0.02 g/L and adenine Ade 0.02 g/L.

Example 3 construction of recombinant Saccharomyces cerevisiae (recombinant bacterium 2) producing terpineol

(1)-up，P_Pgk1-tHMG1-T_Pgk1，P_Tdh3-IDI1-T_Adh1Construction of L EU2- -down

PCR was performed using the PCR templates and primers described in Table 2, respectively, to obtain DNA fragments: m7(-up), M8 (P)_Pgk1)，M9(tHMG1)，M10(T_Pgk1)，M11(P_Tdh3)，M12(IDI1)，M13(T_Adh1) M14 (L EU2), the nucleotide sequence of M15(-down) tHMG1 is shown as SEQ ID NO.5, and the nucleotide sequence of IDI1 is shown as SEQ ID NO. 6;

TABLE 2 primer sequences

The fragments M8, M9 and M10 were fused into expression cassette P by fusion PCR_Pgk1-tHMG1-T_Pgk1；

The fragments M11, M12 and M13 were fused into expression cassette P by fusion PCR_Tdh3-IDI1-T_Adh1；

The fragments M14 and M15 were fused into L EU 2-down fragment by fusion PCR.

The fusion method is described in example 2 (1).

(2) Construction of recombinant bacterium 2(T2)

Fusion module-up, P_Pgk1-tHMG1-T_Pgk1，P_Tdh3-IDI1-T_Adh1L EU2- -Down transformation method referring to example 2(2), wherein the starting strain is recombinant bacterium 1 and the screening medium used is a leucine-deficient SC selection medium, recombinant bacterium 2(T2) was obtained.

Example 4 construction of recombinant Saccharomyces cerevisiae (recombinant Strain 3) producing terpineol

(1)ERG20-up，P_Pgk1-MErg20-T_Cyc1Construction of URA3-ERG20-down

PCR was performed using the PCR templates and primers described in Table 3, respectively, to obtain DNA fragments: m16(ERG20-up), M17 (P)_Pgk1)，M18(MErg20)，M19(T_Cyc1)，M20(URA3)，M21(ERG20-down)。

TABLE 3 primer sequences

The fragments M17, M18 and M19 were fused into expression cassette P by fusion PCR_Pgk1-MErg20-T_Cyc1；

The fragments M20 and M21 were fused into URA3-ERG20-down fragment by fusion PCR.

The fusion method is described in example 2 (1).

(2) Construction of recombinant bacterium 3(T3)

Fusion module ERG20-up, P_Pgk1-MErg20-T_Cyc1URA3-ERG20-down transformation method refers to example 2(2), wherein the original strain is recombinant strain 2, and the screening culture medium is SC selective culture medium lacking uracil to obtain recombinant strain 3 (T3).

Example 5 construction of recombinant Saccharomyces cerevisiae (recombinant bacterium 4) producing terpineol

(1)rDNA-up，P_Pgk1-ERG20FTs-T_Adh1Construction of TRP1-rDNA-down

PCR was performed using the PCR templates and primers described in Table 4, respectively, to obtain DNA fragments: m22(rDNA-up), M23 (P)_Pgk1)，M24(ERG20FTs)，M25(T_Adh1)，M26(TRP1)，M27(rDNA-down)。

TABLE 4 primer sequences

The fragments M23, M24 and M25 were fused into expression cassette P by fusion PCR_Pgk1-ERG20FTs-T_Adh1；

The fragments M26 and M27 were fused into TRP1-rDNA-down by fusion PCR.

The fusion method is described in example 2 (1).

(2) Construction of recombinant bacterium 4(T4)

Fusion module rDNA-up, P_Pgk1-ERG20FTs-T_Adh1The TRP1-rDNA-down transformation method refers to example 2(2), wherein the original strain is recombinant bacterium 3, and the screening medium is SC selective medium lacking tryptophan, to obtain recombinant bacterium 4 (T4).

Example 6 construction of recombinant Saccharomyces cerevisiae (recombinant Strain 5) producing terpineol

(1)HO-up，P_Tdh3-ERG9-T_Adh1Construction of ADE2-HO-down

PCR was performed using the PCR templates and primers described in Table 4, respectively, to obtain DNA fragments: m28(HO-up), M29 (P)_Tdh3)，M30(ERG9)，M31(T_Adh1)，M32(ADE2)，M33(HO-down)。

The nucleotide sequence of the squalene synthase coding gene ERG9 is shown in SEQ ID NO. 13.

TABLE 5 primer sequences

The fragments M29, M30 and M31 were fused into expression cassette P by fusion PCR_Tdh3-ERG9-T_Adh1；

The fragments M32 and M33 were fused to ADE2-HO-down by fusion PCR.

The fusion method is described in example 2 (1).

(2) Construction of recombinant bacterium 5(T5)

Fusion module HO-up, P_Tdh3-ERG9-T_Adh1The ADE2-HO-down transformation method refers to example 2(2), wherein the starting strain is recombinant bacterium 4, and the screening medium is SC selective medium lacking adenine to obtain recombinant bacterium 5 (T5).

Example 7 production of terpineol by recombinant bacteria

(1) Recombinant bacterium culture and product extraction

Fermentation, extraction and detection of terpineol:

fermenting in 30m L YPD liquid culture medium, inoculating seed liquid, and making initial OD₆₀₀Adding 3m L n-dodecane after 0.05 h and 12h for two-phase fermentation, fermenting at 30 ℃, 220rpm for 5d, and measuring the yield of terpineol, wherein the terpineol belongs to a monoterpene compound and is easy to volatilize, and in order to reduce volatilization loss in the fermentation process, the invention adds n-dodecane in the fermentation process, performs two-phase fermentation, can directly take the n-dodecane phase for terpineol measurement, performs detection, and filters a sample with a filter membrane with the pore diameter of 0.22 mu m to remove impurities before performing gas phase and gas chromatography-mass spectrometry detection.

The detection conditions of the gas chromatography of the terpineol comprise a chromatographic column DB-SWAX, a nitrogen flow rate of 1m L/min, a sample injection temperature of 250 ℃, a sample injection split ratio of 1:20, a sample injection amount of 1 mu L, a furnace temperature of 80 ℃ for 1min, a temperature rise of 10 ℃/min to 180 ℃, a temperature rise of 30 ℃/min to 250 ℃, an FID detector of 250 ℃, GC-MS detection conditions of the terpineol, a chromatographic condition and a gas chromatography, an ion source temperature of 230 ℃, and a retention time of the terpineol of 50-600 m/z. in an ion scanning range of 11.01 min.

(2) The result of the detection

A. Terpineol was not detected by Saccharomyces cerevisiae W303-1 a;

B. extracting T1 fermentation product from the recombinant bacterium 1(T1), wherein the production of trace terpineol can be detected, and the yield is 100 ug/L;

C. extracting T2 fermentation product from the recombinant bacterium 2(T1) to detect that the terpineol content is 550 ug/L;

D. extracting T3 fermentation product from the recombinant bacterium 3(T3) to detect that the terpineol content is 832 ug/L;

E. extracting T4 fermentation product from the recombinant bacterium 4(T4), wherein the terpineol content can be detected to be 2.39 mg/L;

F. recombinant bacterium 5(T5) is extracted from a T5 fermentation product, and the terpineol content can be detected to be 3.32 mg/L.

The statistics of the results of the recombinant bacteria are shown in FIG. 2.

Example 8 5L tank fermentation of recombinant strain T5:

firstly, inoculating a T5 single colony into 200m L YPD culture medium, culturing for 24h at a shaking table at 30 ℃ and a rotating speed of 220rpm to prepare seed liquid, initially filling the YPD culture medium with a volume of 2L into a fermentation tank, preparing a feed liquid 1L, inoculating the seed liquid into the culture medium for 24h, then starting to supplement the feed liquid, keeping the dissolved oxygen at 40%, controlling the fermentation pH to be 5.5 by using the feed liquid and ammonia water, and fermenting for 120h to obtain the terpineol with the yield of 21.88 mg/L.

The feed supplement liquid comprises 500 g/L glucose and KH₂PO₄9g/L，K₂SO₄3.5g/L，Na₂SO₄0.28g/L，MgSO₄·7H₂O0.5 g/L, 10ml of microelement mother liquor and 12ml of vitamin mother liquor.

The formula of the microelement mother liquor is as follows: ZnSO₄·7H₂O 10.2g/L，EDTANa₂·2H₂O 15g/L，FeSO₄·7H₂O5.12 g/L, anhydrous CuSO₄0.5g/L，MnCl₂·4H₂O 0.5g/L，CoCl₂·6H₂O 0.86g/L，CaCl₂·2H₂O3.84g/L，Na₂MoO₄·2H₂O 0.56g/L。

The formula of the vitamin mother liquor comprises 25 g/L of inositol, 0.05 g/L of biotin, 1 g/L of nicotinic acid, 1 g/L of calcium pantothenate, 1 g/L of thiamine HCl, 1 g/L of pyridoxol HCl and 0.2 g/L of p-aminobenzoic acid.

Sequence listing

<110> Tianjin university

<120> recombinant saccharomyces cerevisiae for producing terpineol, construction method and application

<160>77

<170>SIPOSequenceListing 1.0

<210>1

<211>1692

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atggcttcac caagaggtat taaagttaag atcggtaatt ctaactgtga agaaatcatc 60

gttagaagaa ctgcaaacta ccatccaaca atctgggatt acgattacgt tcaatcattg 120

agatctgatt acgttggtga aacttacaca agaagattag ataaattgaa gagagatgtt 180

aagccaatgt tgggtaaagt taagaaacca ttggatcaat tggaattaat cgatgttttg 240

caaagattgg gtatctatta ccatttcaag gatgaaatta aaagaatttt aaattctatc 300

tataatcaat acaatagaca tgaagaatgg caaaaagatg atttgtatgc tactgctttg 360

gagtttagat tgttaagaca acatggttac gatgttccacaagatgtttt tagtagattc 420

aaagatgata caggttcttt taaagcttgt ttgtgtgaag atatgaaggg catgttgtgt 480

ttgtacgaag catcatactt gtgtgttcag ggtgaatcta ctatggaaca agctagagat 540

tttgcacata gacatttggg taaaggtttg gaacaaaaca tcgatcaaaa tttggctatc 600

gaagttaagc atgcattgga attaccattg cattggagaa tgccaagatt ggaagctaga 660

tggttcatcg atgtttacga aaagagacaa gatatgaacc caatcttgtt agaatttgct 720

aagttggatt ttaatatggt tcaagcaact catcaagaag atttgagaca tatgtcatct 780

tggtggtcat ctacaagatt gggtgaaaag ttgaacttcg ctagagatag attgatggaa 840

aatttcttgt ggactgttgg tgttattttc gaaccacaat acggttactg tagaagaatg 900

tctacaaagg ttaacacttt gatcacaatc attgatgatg tttatgatgt ttacggtact 960

atggatgaat tagaattgtt tacagatgtt gttgatagat gggatattaa tgctatggac 1020

ccattgccag aatacatgaa gttgtgtttc ttggcattgt acaactcaac aaacgaaatg 1080

gcttacgatg cattgaagga acatggtttg catatcgttt cttatttgag aaaggcttgg 1140

tcagatttgt gtaagtctta cttgttagaa gcaaagtggt actactcaag atacactcca 1200

tctttgcaag aatacatctc aaattcttgg atctcaatct ctggtccagt tattttggtt 1260

catgcttact ttttggttgc aaacccaatc acaaaggaag ctttgcaatc attggaaaga 1320

taccataaca tcatcagatg gtcatctatg atcttgagat tgtcagatga tttgggtact 1380

tctttagatg aattgaagag aggtgacgtt ccaaagtcta tccaatgtta catgtacgaa 1440

acaggtgctt cagaagaaga tgcaagaaag catacttctt atttgatcgg tgaaacatgg 1500

aagaaattga atgaagatgg tgctgttgaa tcaccattcc cagaaacttt tattggtatc 1560

gcaatgaatt tggctagaat ggcacaatgt atgtatcaac atggtgacgg tcatggtatt 1620

gaatacggtg aaacagaaga tagagttttg tctttgttgg ttgaaccaat cccatcattg 1680

tcttttgaat aa 1692

<210>2

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

cacataaaca aacaaaatgg gaaagctatt acaattggc 39

<210>3

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

cataaatcat aagaaattcg ctcacgctct gtgtaaagtg tat 43

<210>4

<211>2668

<212>DNA

<213> Saccharomyces cerevisiae

<400>4

attaacgtat tacataagtt acaggattca tgcttatggg ttagctattt cgcccaatgt 60

gtccatctga cattactatt ttgcatttta atttaattag aacttgacta gcgcactacc 120

agtatatcat ctcatttccg taaataccaa atgtattata tattgaaagc ttttgaccag 180

gttattataa aagaaacttc atgctcgaaa aagatcattt cgaaaagttg cctagtttca 240

tgaaatttta aagcagtttatataaatttt accttttgat gcggaattga ctttttcttg 300

aataatacat aacttttctt aaaagaatca aagacagata aaatttaaga gatattaaat 360

attagtgaga agccgagaat tttgtaacac caacataaca ctgacatctt taacaacttt 420

taattatgat acatttctta cgtcatgatt gattattaca gctatgctga caaatgactc 480

ttgttgcatg gctacgaacc gggtaatact aagtgattga ctcttgctga ccttttatta 540

agaactaaat ggacaatatt atggagcatt tcatgtataa attggtgcgt aaaatcgttg 600

gatctctctt ctaagtacat cctactataa caatcaagaa aaacaagaaa atcggacaaa 660

acaatcaagt atggattcta gaacagttgg tatattagga gggggacaat tgggacgtat 720

gattgttgag gcagcaaaca ggctcaacat taagacggta atactagatg ctgaaaattc 780

tcctgccaaa caaataagca actccaatga ccacgttaat ggctcctttt ccaatcctct 840

tgatatcgaa aaactagctg aaaaatgtga tgtgctaacg attgagattg agcatgttga 900

tgttcctaca ctaaagaatc ttcaagtaaa acatcccaaa ttaaaaattt acccttctcc 960

agaaacaatc agattgatac aagacaaata tattcaaaaa gagcatttaa tcaaaaatgg 1020

tatagcagtt acccaaagtg ttcctgtgga acaagccagt gagacgtccc tattgaatgt 1080

tggaagagat ttgggttttc cattcgtctt gaagtcgagg actttggcat acgatggaag 1140

aggtaacttc gttgtaaaga ataaggaaat gattccggaa gctttggaag tactgaagga 1200

tcgtcctttg tacgccgaaa aatgggcacc atttactaaa gaattagcag tcatgattgt 1260

gagatctgtt aacggtttag tgttttctta cccaattgta gagactatcc acaaggacaa 1320

tatttgtgac ttatgttatg cgcctgctag agttccggac tccgttcaac ttaaggcgaa 1380

gttgttggca gaaaatgcaa tcaaatcttt tcccggttgt ggtatatttg gtgtggaaat 1440

gttctattta gaaacagggg aattgcttat taacgaaatt gccccaaggc ctcacaactc 1500

tggacattat accattgatg cttgcgtcac ttctcaattt gaagctcatt tgagatcaat 1560

attggatttg ccaatgccaa agaatttcac atctttctcc accattacaa cgaacgccat 1620

tatgctaaat gttcttggag acaaacatac aaaagataaa gagctagaaa cttgcgaaag 1680

agcattggcg actccaggtt cctcagtgta cttatatgga aaagagtcta gacctaacag 1740

aaaagtaggt cacataaata ttattgcctc cagtatggcg gaatgtgaac aaaggctgaa 1800

ctacattaca ggtagaactg atattccaat caaaatctct gtcgctcaaa agttggactt 1860

ggaagcaatg gtcaaaccat tggttggaat catcatggga tcagactctg acttgccggt 1920

aatgtctgcc gcatgtgcgg ttttaaaaga ttttggcgtt ccatttgaag tgacaatagt 1980

ctctgctcat agaactccac ataggatgtc agcatatgct atttccgcaa gcaagcgtgg 2040

aattaaaaca attatcgctg gagctggtgg ggctgctcac ttgccaggta tggtggctgc 2100

aatgacacca cttcctgtca tcggtgtgcc cgtaaaaggt tcttgtctag atggagtaga 2160

ttctttacat tcaattgtgc aaatgcctag aggtgttcca gtagctaccg tcgctattaa 2220

taatagtacg aacgctgcgc tgttggctgt cagactgctt ggcgcttatg attcaagtta 2280

tacaacgaaa atggaacagt ttttattaaa gcaagaagaa gaagttcttg tcaaagcaca 2340

aaagttagaa actgtcggtt acgaagctta tctagaaaac aagtaatata taagtttatt 2400

gatatacttg tacagcaaat aattataaaa tgatatacct attttttagg ctttgttatg 2460

attacatcaa atgtggactt catacataga aatcaacgct tacaggtgtc cttttttaag 2520

aatttcatac ataagatcac ttattataca tacatacata tccagtaaca agaagcaagg 2580

aataattacc tgcttaagtc tgcgattaaa aaaataacgt ttcgatacag ttcatataag 2640

gcggctcaat gcagaaccga ggatagcg 2668

<210>5

<211>1512

<212>DNA

<213> Saccharomyces cerevisiae

<400>5

atgccagttt taaccaataa aacagtcatt tctggatcga aagtcaaaag tttatcatct 60

gcgcaatcga gctcatcagg accttcatca tctagtgagg aagatgattc ccgcgatatt 120

gaaagcttgg ataagaaaat acgtccttta gaagaattag aagcattatt aagtagtgga 180

aatacaaaac aattgaagaa caaagaggtc gctgccttgg ttattcacgg taagttacct 240

ttgtacgctt tggagaaaaa attaggtgat actacgagag cggttgcggt acgtaggaag 300

gctctttcaa ttttggcaga agctcctgta ttagcatctg atcgtttacc atataaaaat 360

tatgactacg accgcgtatt tggcgcttgt tgtgaaaatg ttataggtta catgcctttg 420

cccgttggtg ttataggccc cttggttatc gatggtacat cttatcatat accaatggca 480

actacagagg gttgtttggt agcttctgcc atgcgtggct gtaaggcaat caatgctggc 540

ggtggtgcaa caactgtttt aactaaggat ggtatgacaa gaggcccagt agtccgtttc 600

ccaactttga aaagatctgg tgcctgtaag atatggttag actcagaaga gggacaaaac 660

gcaattaaaa aagcttttaa ctctacatca agatttgcac gtctgcaaca tattcaaact 720

tgtctagcag gagatttact cttcatgaga tttagaacaa ctactggtga cgcaatgggt 780

atgaatatga tttctaaagg tgtcgaatac tcattaaagc aaatggtaga agagtatggc 840

tgggaagata tggaggttgt ctccgtttct ggtaactact gtaccgacaa aaaaccagct 900

gccatcaact ggatcgaagg tcgtggtaag agtgtcgtcg cagaagctac tattcctggt 960

gatgttgtca gaaaagtgtt aaaaagtgat gtttccgcat tggttgagtt gaacattgct 1020

aagaatttgg ttggatctgc aatggctggg tctgttggtg gatttaacgc acatgcagct 1080

aatttagtga cagctgtttt cttggcatta ggacaagatc ctgcacaaaa tgttgaaagt 1140

tccaactgta taacattgat gaaagaagtg gacggtgatt tgagaatttc cgtatccatg 1200

ccatccatcg aagtaggtac catcggtggt ggtactgttc tagaaccaca aggtgccatg 1260

ttggacttat taggtgtaag aggcccgcat gctaccgctc ctggtaccaa cgcacgtcaa 1320

ttagcaagaa tagttgcctg tgccgtcttg gcaggtgaat tatccttatg tgctgcccta 1380

gcagccggcc atttggttca aagtcatatg acccacaaca ggaaacctgc tgaaccaaca 1440

aaacctaaca atttggacgc cactgatata aatcgtttga aagatgggtc cgtcacctgc 1500

attaaatcct aa 1512

<210>6

<211>867

<212>DNA

<213> Saccharomyces cerevisiae

<400>6

atgactgccg acaacaatag tatgccccat ggtgcagtat ctagttacgc caaattagtg 60

caaaaccaaa cacctgaaga cattttggaa gagtttcctg aaattattcc attacaacaa 120

agacctaata cccgatctag tgagacgtca aatgacgaaa gcggagaaac atgtttttct 180

ggtcatgatg aggagcaaat taagttaatg aatgaaaatt gtattgtttt ggattgggac 240

gataatgcta ttggtgccgg taccaagaaa gtttgtcatt taatggaaaa tattgaaaag 300

ggtttactac atcgtgcatt ctccgtcttt attttcaatg aacaaggtga attactttta 360

caacaaagag ccactgaaaa aataactttc cctgatcttt ggactaacac atgctgctct 420

catccactat gtattgatga cgaattaggt ttgaagggta agctagacga taagattaag 480

ggcgctatta ctgcggcggt gagaaaacta gatcatgaat taggtattcc agaagatgaa 540

actaagacaa ggggtaagtt tcacttttta aacagaatcc attacatggc accaagcaat 600

gaaccatggg gtgaacatga aattgattac atcctatttt ataagatcaa cgctaaagaa 660

aacttgactg tcaacccaaa cgtcaatgaa gttagagact tcaaatgggt ttcaccaaat 720

gatttgaaaa ctatgtttgc tgacccaagt tacaagttta cgccttggtt taagattatt 780

tgcgagaatt acttattcaa ctggtgggag caattagatg acctttctga agtggaaaat 840

gacaggcaaa ttcatagaat gctataa 867

<210>7

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

acgatacggc gttaagatca tgatacataa aagc 34

<210>8

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gtatcatgat cttaacgccg tatcgtgatt aac 33

<210>9

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ctgacatacc aagacgctat cctcggttct gcattg 36

<210>10

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

accgaggata gcgtcttggt atgtcagcta ctg 33

<210>11

<211>1059

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaatag 1059

<210>12

<211>2778

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttactggtt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatctg ggacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaaggtt ctggttctgg ttctggttct 1080

ggttctatgg cttcaccaag aggtattaaa gttaagatcg gtaattctaa ctgtgaagaa 1140

atcatcgtta gaagaactgc aaactaccat ccaacaatct gggattacga ttacgttcaa 1200

tcattgagat ctgattacgt tggtgaaact tacacaagaa gattagataa attgaagaga 1260

gatgttaagc caatgttggg taaagttaag aaaccattgg atcaattgga attaatcgat 1320

gttttgcaaa gattgggtat ctattaccat ttcaaggatg aaattaaaag aattttaaat 1380

tctatctata atcaatacaa tagacatgaa gaatggcaaa aagatgattt gtatgctact 1440

gctttggagt ttagattgtt aagacaacat ggttacgatg ttccacaaga tgtttttagt 1500

agattcaaag atgatacagg ttcttttaaa gcttgtttgt gtgaagatat gaagggcatg 1560

ttgtgtttgt acgaagcatc atacttgtgt gttcagggtg aatctactat ggaacaagct 1620

agagattttg cacatagaca tttgggtaaa ggtttggaac aaaacatcga tcaaaatttg 1680

gctatcgaag ttaagcatgc attggaatta ccattgcatt ggagaatgcc aagattggaa 1740

gctagatggt tcatcgatgt ttacgaaaag agacaagata tgaacccaat cttgttagaa 1800

tttgctaagt tggattttaa tatggttcaa gcaactcatc aagaagattt gagacatatg 1860

tcatcttggt ggtcatctac aagattgggt gaaaagttga acttcgctag agatagattg 1920

atggaaaatt tcttgtggac tgttggtgtt attttcgaac cacaatacgg ttactgtaga 1980

agaatgtcta caaaggttaa cactttgatc acaatcattg atgatgttta tgatgtttac 2040

ggtactatgg atgaattaga attgtttaca gatgttgttg atagatggga tattaatgct 2100

atggacccat tgccagaata catgaagttg tgtttcttgg cattgtacaa ctcaacaaac 2160

gaaatggctt acgatgcatt gaaggaacat ggtttgcata tcgtttctta tttgagaaag 2220

gcttggtcag atttgtgtaa gtcttacttg ttagaagcaa agtggtacta ctcaagatac 2280

actccatctt tgcaagaata catctcaaat tcttggatct caatctctgg tccagttatt 2340

ttggttcatg cttacttttt ggttgcaaac ccaatcacaa aggaagcttt gcaatcattg 2400

gaaagatacc ataacatcat cagatggtca tctatgatct tgagattgtc agatgatttg 2460

ggtacttctt tagatgaatt gaagagaggt gacgttccaa agtctatcca atgttacatg 2520

tacgaaacag gtgcttcaga agaagatgca agaaagcata cttcttattt gatcggtgaa 2580

acatggaaga aattgaatga agatggtgct gttgaatcac cattcccaga aacttttatt 2640

ggtatcgcaa tgaatttggc tagaatggca caatgtatgt atcaacatgg tgacggtcat 2700

ggtattgaat acggtgaaac agaagataga gttttgtctt tgttggttga accaatccca 2760

tcattgtctt ttgaataa 2778

<210>13

<211>1335

<212>DNA

<213> Saccharomyces cerevisiae

<400>13

atgggaaagc tattacaatt ggcattgcat ccggtcgaga tgaaggcagc tttgaagctg 60

aagttttgca gaacaccgct attctccatc tatgatcagt ccacgtctcc atatctcttg 120

cactgtttcg aactgttgaa cttgacctcc agatcgtttg ctgctgtgat cagagagctg 180

catccagaat tgagaaactg tgttactctc ttttatttga ttttaagggc tttggatacc 240

atcgaagacg atatgtccat cgaacacgat ttgaaaattg acttgttgcg tcacttccac 300

gagaaattgt tgttaactaa atggagtttc gacggaaatg cccccgatgt gaaggacaga 360

gccgttttga cagatttcga atcgattctt attgaattcc acaaattgaa accagaatat 420

caagaagtca tcaaggagat caccgagaaa atgggtaatg gtatggccga ctacatctta 480

gatgaaaatt acaacttgaa tgggttgcaa accgtccacg actacgacgt gtactgtcac540

tacgtagctg gtttggtcgg tgatggtttg acccgtttga ttgtcattgc caagtttgcc 600

aacgaatctt tgtattctaa tgagcaattg tatgaaagca tgggtctttt cctacaaaaa 660

accaacatca tcagagatta caatgaagat ttggtcgatg gtagatcctt ctggcccaag 720

gaaatctggt cacaatacgc tcctcagttg aaggacttca tgaaacctga aaacgaacaa 780

ctggggttgg actgtataaa ccacctcgtc ttaaacgcat tgagtcatgt tatcgatgtg 840

ttgacttatt tggccggtat ccacgagcaa tccactttcc aattttgtgc cattccccaa 900

gttatggcca ttgcaacctt ggctttggta ttcaacaacc gtgaagtgct acatggcaat 960

gtaaagattc gtaagggtac tacctgctat ttaattttga aatcaaggac tttgcgtggc 1020

tgtgtcgaga tttttgacta ttacttacgt gatatcaaat ctaaattggc tgtgcaagat 1080

ccaaatttct taaaattgaa cattcaaatc tccaagatcg aacagtttat ggaagaaatg 1140

taccaggata aattacctcc taacgtgaag ccaaatgaaa ctccaatttt cttgaaagtt 1200

aaagaaagat ccagatacga tgatgaattg gttccaaccc aacaagaaga agagtacaag 1260

ttcaatatgg ttttatctat catcttgtcc gttcttcttg ggttttatta tatatacact 1320

ttacacagag cgtga 1335

<210>14

<211>1277

<212>DNA

<213> Saccharomyces cerevisiae

<400>14

ctctagagga tccccgggat aacttcgtat agcatacatt atacgaagtt atcgttttaa 60

gagcttggtg agcgctagga gtcactgcca ggtatcgttt gaacacggca ttagtcaggg 120

aagtcataac acagtccttt cccgcaattt tctttttcta ttactcttgg cctcctctgt 180

acactctata tttttttatg cctcggtaat gattttcatt tttttttttc cacctagcgg 240

atgactcttt ttttttctta gcgattggca ttatcacata atgaattata cattatataa 300

agtaatgtga tttcttcgaa gaatatacta aaaaatgagc aggcaagata aacgaaggca 360

aagatgacag agcagaaagc cctagtaaag cgtattacaa atgaaaccaa gattcagatt 420

gcgatctctt taaagggtgg tcccctagcg atagagcact cgatcttccc agaaaaagag 480

gcagaagcag tagcagaaca ggccacacaa tcgcaagtga ttaacgtcca cacaggtata 540

gggtttctgg accatatgat acatgctctg gccaagcatt ccggctggtc gctaatcgtt 600

gagtgcattg gtgacttaca catagacgac catcacacca ctgaagactg cgggattgct 660

ctcggtcaag cttttaaaga ggccctaggg gccgtgcgtg gagtaaaaag gtttggatca 720

ggatttgcgc ctttggatga ggcactttcc agagcggtgg tagatctttc gaacaggccg 780

tacgcagttg tcgaacttgg tttgcaaagg gagaaagtag gagatctctc ttgcgagatg 840

atcccgcatt ttcttgaaag ctttgcagag gctagcagaa ttaccctcca cgttgattgt 900

ctgcgaggca agaatgatca tcaccgtagt gagagtgcgt tcaaggctct tgcggttgcc 960

ataagagaag ccacctcgcc caatggtacc aacgatgttc cctccaccaa aggtgttctt 1020

atgtagtgac accgattatt taaagctgca gcatacgata tatatacatg tgtatatatg 1080

tatacctatg aatgtcagta agtatgtata cgaacagtat gatactgaag atgacaaggt 1140

aatgcatcat tctatacgtg tcattctgaa cgaggcgcgc tttccttttt tctttttgct 1200

ttttcttttt ttttctcttg aactcgaata acttcgtata gcatacatta tacgaagtta 1260

tcccgggtac cgagctc 1277

<210>15

<211>2053

<212>DNA

<213> Saccharomyces cerevisiae

<400>15

gtcctgtact tccttgttca tgtgtgttca aaaacgttat atttatagga taattatact 60

ctatttctca acaagtaatt ggttgtttgg ccgagcggtc taaggcgcct gattcaagaa 120

atatcttgac cgcagttaac tgtgggaata ctcaggtatc gtaagatgca agagttcgaa 180

tctcttagca accattattt ttttcctcaa cataacgaga acacacaggg gcgctatcgc 240

acagaatcaa attcgatgac tggaaatttt ttgttaattt cagaggtcgc ctgacgcata 300

tacctttttc aactgaaaaa ttgggagaaa aaggaaaggt gagagcgccg gaaccggctt 360

ttcatataga atagagaagc gttcatgact aaatgcttgc atcacaatac ttgaagttga 420

caatattatt taaggaccta ttgttttttc caataggtgg ttagcaatcg tcttactttc 480

taacttttct taccttttac atttcagcaa tatatatata tatatttcaa ggatatacca 540

ttctaatgtc tgcccctaag aagatcgtcg ttttgccagg tgaccacgtt ggtcaagaaa 600

tcacagccga agccattaag gttcttaaag ctatttctga tgttcgttcc aatgtcaagt 660

tcgatttcga aaatcattta attggtggtg ctgctatcga tgctacaggt gttccacttc 720

cagatgaggc gctggaagcc tccaagaagg ctgatgccgt tttgttaggt gctgtgggtg 780

gtcctaaatg gggtaccggt agtgttagac ctgaacaagg tttactaaaa atccgtaaag 840

aacttcaatt gtacgccaac ttaagaccat gtaactttgc atccgactct cttttagact 900

tatctccaat caagccacaa tttgctaaag gtactgactt cgttgttgtc agagaattag 960

tgggaggtat ttactttggt aagagaaagg aagacgatgg tgatggtgtc gcttgggata 1020

gtgaacaata caccgttcca gaagtgcaaa gaatcacaag aatggccgct ttcatggccc 1080

tacaacatga gccaccattg cctatttggt ccttggataa agctaatgtt ttggcctctt 1140

caagattatg gagaaaaact gtggaggaaa ccatcaagaa cgaattccct acattgaagg 1200

ttcaacatca attgattgat tctgccgcca tgatcctagt taagaaccca acccacctaa 1260

atggtattat aatcaccagc aacatgtttg gtgatatcat ctccgatgaa gcctccgtta 1320

tcccaggttc cttgggtttg ttgccatctg cgtccttggc ctctttgcca gacaagaaca 1380

ccgcatttgg tttgtacgaa ccatgccacg gttctgctcc agatttgcca aagaataagg 1440

tcaaccctat cgccactatc ttgtctgctg caatgatgtt gaaattgtca ttgaacttgc 1500

ctgaagaagg taaggccatt gaagatgcag ttaaaaaggt tttggatgca ggtatcagaa 1560

ctggtgattt aggtggttcc aacagtacca ccgaagtcgg tgatgctgtc gccgaagaag 1620

ttaagaaaat ccttgcttaa aaagattctc tttttttatg atatttgtac ataaacttta 1680

taaatgaaat tcataataga aacgacacga aattacaaaa tggaatatgt tcatagggta 1740

gacgaaacta tatacgcaat ctacatacat ttatcaagaa ggagaaaaag gaggatgtaa 1800

aggaatacag gtaagcaaat tgatactaat ggctcaacgt gataaggaaa aagaattgca 1860

ctttaacatt aatattgaca aggaggaggg caccacacaa aaagttaggt gtaacagaaa 1920

atcatgaaac tatgattcct aatttatata ttggaggatt ttctctaaaa aaaaaaaaat 1980

acaacaaata aaaaacactc aatgacctga ccatttgatg gagtttaagt caataccttc 2040

ttgaaccatt tcc 2053

<210>16

<211>1245

<212>DNA

<213> Saccharomyces cerevisiae

<400>16

gcttgcatgc ctgcaggtcg actctagagg atccccggga taacttcgta taatgtatgc 60

tatacgaagt tatgggtaat aactgatata attaaattga agctctaatt tgtgagttta 120

gtatacatgc atttacttat aatacagttt tttagttttg ctggccgcat cttctcaaat 180

atgcttccca gcctgctttt ctgtaacgtt caccctctac cttagcatcc cttccctttg 240

caaatagtcc tcttccaaca ataataatgt cagatcctgt agagaccaca tcatccacgg 300

ttctatactg ttgacccaat gcgtctccct tgtcatctaa acccacaccg ggtgtcataa 360

tcaaccaatc gtaaccttca tctcttccac ccatgtctct ttgagcaata aagccgataa 420

caaaatcttt gtcgctcttc gcaatgtcaa cagtaccctt agtatattct ccagtagcta 480

gggagccctt gcatgacaat tctgctaaca tcaaaaggcc tctaggttcc tttgttactt 540

cttccgccgc ctgcttcaaa ccgctaacaa tacctgggcc caccacaccg tgtgcattcg 600

taatgtctgc ccattctgct attctgtata cacccgcaga gtactgcaat ttgactgtat 660

taccaatgtc agcaaatttt ctgtcttcga agagtaaaaa attgtacttg gcggataatg 720

cctttagcgg cttaactgtg ccctccatgg aaaaatcagtcaagatatcc acatgtgttt 780

ttagtaaaca aattttggga cctaatgctt caactaactc cagtaattcc ttggtggtac 840

gaacatccaa tgaagcacac aagtttgttt gcttttcgtg catgatatta aatagcttgg 900

cagcaacagg actaggatga gtagcagcac gttccttata tgtagctttc gacatgattt 960

atcttcgttt cctgcaggtt tttgttctgt gcagttgggt taagaatact gggcaatttc 1020

atgtttcttc aacaccacat atgcgtatat ataccaatct aagtctgtgc tccttccttc 1080

gttcttcctt ctgctcggag attaccgaat caaaaaaatt tcaaagaaac cggaatcaaa 1140

aaaaagaaca aaaaaaaaaa agatgaattg aaaagcttta tggaccctga taacttcgta 1200

taatgtatgc tatacgaagt tatcccgggt accgagctcg aattc 1245

<210>17

<211>1007

<212>DNA

<213> Saccharomyces cerevisiae

<400>17

aacgacatta ctatatatat aatataggaa gcatttaata gaacagcatc gtaatatatg 60

tgtactttgc agttatgacg ccagatggca gtagtggaag atattcttta ttgaaaaata 120

gcttgtcacc ttacgtacaa tcttgatccg gagcttttct ttttttgccg attaagaatt 180

cggtcgaaaa aagaaaagga gagggccaag agggagggca ttggtgacta ttgagcacgt 240

gagtatacgt gattaagcac acaaaggcag cttggagtat gtctgttatt aatttcacag 300

gtagttctgg tccattggtg aaagtttgcg gcttgcagag cacagaggcc gcagaatgtg 360

ctctagattc cgatgctgac ttgctgggta ttatatgtgt gcccaataga aagagaacaa 420

ttgacccggt tattgcaagg aaaatttcaa gtcttgtaaa agcatataaa aatagttcag 480

gcactccgaa atacttggtt ggcgtgtttc gtaatcaacc taaggaggat gttttggctc 540

tggtcaatga ttacggcatt gatatcgtcc aactgcatgg agatgagtcg tggcaagaat 600

accaagagtt cctcggtttg ccagttatta aaagactcgt atttccaaaa gactgcaaca 660

tactactcag tgcagcttca cagaaacctc attcgtttat tcccttgttt gattcagaag 720

caggtgggac aggtgaactt ttggattgga actcgatttc tgactgggtt ggaaggcaag 780

agagccccga aagcttacat tttatgttag ctggtggact gacgccagaa aatgttggtg 840

atgcgcttag attaaatggc gttattggtg ttgatgtaag cggaggtgtg gagacaaatg 900

gtgtaaaaga ctctaacaaa atagcaaatt tcgtcaaaaa tgctaagaaa taggttatta 960

ctgagtagta tttatttaag tattgtttgt gcacttgcct gcaggcc 1007

<210>18

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gacgttgaaa ttgaggctac tgcg 24

<210>19

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

tgggggatca ctgacctaat gcttcaacta ac 32

<210>20

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

tgaagcatta ggtcagtgat cccccacaca ccat 34

<210>21

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

cttggtgaag ccattttgta attaaaactt agat 34

<210>22

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

aagttttaat tacaaaatgg cttcaccaag aggtat 36

<210>23

<211>35

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

cgtgacataa ctaatttatt caaaagacaa tgatg 35

<210>24

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

tgtcttttga ataaattagt tatgtcacgc ttac 34

<210>25

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

ggatcctcta gagcaaatta aagccttcga gcg 33

<210>26

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

aaggctttaa tttgctctag aggatccccg ggat 34

<210>27

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

gtagagacca catcgagctc ggtacccggg at 32

<210>28

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

gtaccgagct cgatgtggtc tctacaggat c 31

<210>29

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

caagccttgt cccaaggcag cg 22

<210>30

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

gcttcggtta cttctaagga agtccacaca aatcaagatc cgttag 46

<210>31

<211>69

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

gttataatat ctgtgcgtct tgagttgaag tcaggaatct aaaatattgg aaagtcatta 60

ggtgaggtt 69

<210>32

<211>69

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

tatgtcagac caccaccaat gttaacctca cctaatgact ttccaatatt ttagattcct 60

gacttcaac 69

<210>33

<211>44

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

attggttaaa actggcattg ttttatattt gttgtaaaaa gtag 44

<210>34

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

caacaaatat aaaacaatgc cagttttaac caataaaaca gtc 43

<210>35

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

ctatcgattt caattcaatt caatttagga tttaatgcag gtgac 45

<210>36

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

gtcacctgca ttaaatccta aattgaattg aattgaaatc gatag 45

<210>37

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

taacattcaa cgctagtatc actatactgg atctaaagag tacaatag 48

<210>38

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

ctctttagat ccagtatagt gatactagcg ttgaatgtta gcg 43

<210>39

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

ctattgttgt cggcagtcat tttgtttgtt tatgtgtg 38

<210>40

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

cacacataaa caaacaaaat gactgccgac aacaatag 38

<210>41

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

atcataaatc ataagaaatt cgcttatagc attctatgaa tttgcc 46

<210>42

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

ggcaaattca tagaatgcta taagcgaatt tcttatgatt tatgat 46

<210>43

<211>50

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>43

catgaacaag gaagtacagg acagatcatg atacataaaa gcgatataac 50

<210>44

<211>52

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>44

gttatatcgc ttttatgtat catgatctgt cctgtacttc cttgttcatg tg 52

<210>45

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>45

gatagttgat ttctattcca acaggaaatg gttcaagaag gtattgac 48

<210>46

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>46

gtcaatacct tcttgaacca tttcctgttg gaatagaaat caactatc 48

<210>47

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>47

cacaggcgct accatgagaa ttg 23

<210>48

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>48

ttggttcttc gacatgatca c 21

<210>49

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>49

aggaatctaa aatacgtttc gtttagaacc gacg 34

<210>50

<211>35

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>50

gttctaaacg aaacgtattt tagattcctg acttc 35

<210>51

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>51

ctttttctga agccattgtt tttatatttg ttgt 34

<210>52

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>52

caaatataaa aacaatggct tcagaaaaag aaat 34

<210>53

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>53

cgtgacataa ctaatctatt tgcttctctt gtaaac 36

<210>54

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>54

agagaagcaa atagattagt tatgtcacgc ttac 34

<210>55

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>55

caggcatgca agccaaatta aagccttcga gcg 33

<210>56

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>56

gaaggcttta atttggcttg catgcctgca ggtc 34

<210>57

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>57

catggtcctt atcgaattcg agctcggtac 30

<210>58

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>58

gagctcgaat tcgataagga ccatgtataa g 31

<210>59

<211>17

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>59

atcgatgtaa tgtagag 17

<210>60

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>60

ccggggcacc tgtcactttg g 21

<210>61

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>61

caggaatcta aaatatttcc tctaatcagg ttcc 34

<210>62

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>62

acctgattag aggaaatatt ttagattcct gacttc 36

<210>63

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>63

ctttttctga agccattgtt tttatatttg ttgt 34

<210>64

<211>35

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>64

aatataaaaa caatggcttc agaaaaagaa attag 35

<210>65

<211>35

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>65

tcataagaaa ttcgcttatt caaaagacaa tgatg 35

<210>66

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>66

ttgtcttttg aataagcgaa tttcttatga tttatg 36

<210>67

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>67

tatatagtaa tgtcgttaga tcatgataca taaaagc 37

<210>68

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>68

tatgtatcat gatctaacga cattactata tatataatat ag 42

<210>69

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>69

tcataagaaa ttcgcggcct gcaggcaagt gcac 34

<210>70

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>70

ttgcctgcag gccgcgaatt tcttatgatt tat 33

<210>71

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>71

agatcatgat acataaaagc gat 23

<210>72

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>72

tcccaggcgt agaacagttt atcag 25

<210>73

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>73

tcaacgctag tatgatccaa gctatctact gag 33

<210>74

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>74

agatagcttg gatcatacta gcgttgaatg ttag 34

<210>75

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>75

atagctttcc cattttgttt gtttatgtgt gtttattcg 39

<210>76

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>76

atacacttta cacagagcgt gagcgaattt cttatgattt atg 43

<210>77

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>77

cacttcacgt gcttctggta catacttg 28

Claims (7)

1. A construction method of recombinant saccharomyces cerevisiae for producing terpineol is characterized by comprising the following steps:

using a method of homologous recombination, the strain of saccharomyces cerevisiae ATCC: 208352, introducing a truncated terpineol synthase coding gene delta Ts to obtain a recombinant bacterium 1;

the nucleotide sequence of the truncated terpineol synthase coding gene delta Ts is shown in SEQ ID NO. 1.

2. A construction method of recombinant saccharomyces cerevisiae for producing terpineol is characterized by comprising the following steps:

introducing a truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase encoding gene tHMG1 and an isopentenyl pyrophosphate isomerase encoding gene IDI1 into the recombinant bacterium 1 by utilizing a homologous recombination method to obtain a recombinant bacterium 2;

the nucleotide sequence of the truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene tHMG1 is shown as SEQ ID NO. 5;

the nucleotide sequence of the isopentenyl pyrophosphate isomerase coding gene IDI1 is shown in SEQ ID NO. 6.

3. A construction method of recombinant saccharomyces cerevisiae for producing terpineol is characterized by comprising the following steps:

introducing a mutated farnesyl pyrophosphate synthase encoding gene MERg20 into an ERG20 site in the recombinant bacterium 2 by using a homologous recombination method to obtain a recombinant bacterium 3;

the nucleotide sequence of the mutated farnesyl pyrophosphate synthase encoding gene MErg20 is shown in SEQ ID No. 11.

4. A construction method of recombinant saccharomyces cerevisiae for producing terpineol is characterized by comprising the following steps:

introducing a fusion protein coding gene ERG20FTs of mutated farnesyl pyrophosphate synthase and truncated terpineol synthase into the recombinant bacterium 3 by using a homologous recombination method to obtain a recombinant bacterium 4;

the nucleotide sequence of the coding gene ERG20FTs is shown in SEQ ID NO. 12.

5. A construction method of recombinant saccharomyces cerevisiae for producing terpineol is characterized by comprising the following steps:

by utilizing a homologous recombination method, introducing a squalene synthase coding gene ERG9 into the recombinant strain 4 to obtain a recombinant strain 5;

the nucleotide sequence of the squalene synthase coding gene ERG9 is shown in SEQ ID NO. 13.

6. A recombinant s.cerevisiae producing terpineol constructed by the method of any one of claims 1-5.

7. Use of the terpineol-producing recombinant saccharomyces cerevisiae of claim 6 in the production of terpineol.

Images