CN111334522A - Recombinant saccharomyces cerevisiae for producing ambergris alcohol and construction method thereof - Google Patents
Recombinant saccharomyces cerevisiae for producing ambergris alcohol and construction method thereof Download PDFInfo
- Publication number
- CN111334522A CN111334522A CN202010113440.3A CN202010113440A CN111334522A CN 111334522 A CN111334522 A CN 111334522A CN 202010113440 A CN202010113440 A CN 202010113440A CN 111334522 A CN111334522 A CN 111334522A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- recombinant
- producing
- seq
- ambergris
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01088—Hydroxymethylglutaryl-CoA reductase (1.1.1.88)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y504/00—Intramolecular transferases (5.4)
- C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a recombinant Saccharomyces cerevisiae for producing ambroxol and a construction method thereof, wherein the construction method comprises the following steps of introducing site-directed mutated agastache cyclase encoding gene delta SHC and tetraphenyl- β -curcumene synthase encoding gene BmeTC into Saccharomyces cerevisiae (Saccharomyces cerevisiae W303-1a) to obtain recombinant bacteria 1, introducing truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase encoding gene tHMG1 into the recombinant bacteria 1 to obtain recombinant bacteria 2, and experiments prove that the recombinant Saccharomyces cerevisiae for producing ambroxol can be used for producing ambroxol through fermentation, thereby laying a foundation for artificially synthesizing ambroxol.
Description
Technical Field
The invention relates to the technical field of biology, in particular to recombinant saccharomyces cerevisiae for producing ambergris alcohol and a construction method thereof.
Background
Ambroxol (Ambrein) is a tricyclic triterpenoid, is a main component of ambroxol, is a precious animal spice and is an intestinal metabolite of sperm whale. Ambroxol is reported to have anti-inflammatory, analgesic, and aphrodisiac activities due to its long-lasting taste, and is used as an additive for perfumes. Ambroxol has no fragrance, and is degraded and oxidized after being changed in the air to generate the ambrox with special fragrance. Under the constraint of international treaties on rejecting whales, the production of ambergrol appears to be in short supply, the chemical synthesis process of ambergrol is complicated, and pollution waste liquid is generated.
The emergence of synthetic biology depends on the grasping and accumulation of structural and functional information of a large number of genes, proteins and other basic life elements, and depends on means such as molecular biology, genetic engineering and the like as a support platform. The method utilizes synthetic biology to convert cheap raw materials into usable substances such as biofuel to solve the problem of energy, or utilizes pollutants through biological decomposition to solve the problem of environmental pollution, and can also utilize synthetic biology to produce active complex compounds which are difficult to obtain by chemical and biological synthesis methods. At present, the design and modification of microbial strains to produce natural products by means of synthetic biology have been considered as a potential method, but the construction and optimization of relevant biosynthetic pathways in Saccharomyces cerevisiae to produce ambergris alcohol by means of synthetic biology has not been reported.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide the recombinant saccharomyces cerevisiae for producing ambergris alcohol.
The second purpose of the invention is to provide a construction method of the recombinant saccharomyces cerevisiae for producing ambergris alcohol.
The third purpose of the invention is to provide the application of the recombinant saccharomyces cerevisiae for producing ambergris alcohol in the fermentation production of ambergris alcohol.
The fourth purpose of the invention is to provide the second recombinant saccharomyces cerevisiae for producing ambergris alcohol.
The fifth purpose of the invention is to provide a second construction method of the recombinant saccharomyces cerevisiae for producing ambergris alcohol.
The sixth purpose of the invention is to provide the use of the second recombinant saccharomyces cerevisiae for producing ambergris alcohol by fermentation.
The seventh purpose of the invention is to provide the third recombinant saccharomyces cerevisiae for producing ambergris alcohol.
The eighth purpose of the invention is to provide a construction method of the third recombinant saccharomyces cerevisiae for producing ambergris alcohol.
The ninth purpose of the invention is to provide the use of the third recombinant saccharomyces cerevisiae for producing ambergris alcohol by fermentation.
The technical scheme of the invention is summarized as follows:
a construction method of recombinant Saccharomyces cerevisiae for producing ambergris alcohol comprises introducing site-directed mutated agastache cyclase encoding gene Δ SHC and tetraphenyl- β -curcumene synthase encoding gene BmeTC into Saccharomyces cerevisiae (Saccharomyces cerevisiae W303-1a) to obtain recombinant bacterium 1;
the nucleotide sequence of the site-directed mutant hopene cyclase encoding gene delta SHC is shown in SEQ ID No. 2.
The nucleotide sequence of the tetraphenyl- β -curcumene synthase coding gene BmeTC is shown as SEQ ID No. 3.
The recombinant saccharomyces cerevisiae for producing ambergris alcohol constructed by the method.
The recombinant saccharomyces cerevisiae is used for producing ambergris alcohol by fermentation.
The second construction method of recombinant saccharomyces cerevisiae for producing ambergris alcohol comprises the following steps: introducing a truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene tHMG1 into the recombinant bacterium 1 to obtain a recombinant bacterium 2;
the nucleotide sequence of the truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene tHMG1 is shown in SEQ ID No. 4.
The recombinant saccharomyces cerevisiae for producing ambergris alcohol constructed by the second method.
The second recombinant saccharomyces cerevisiae is used for producing ambergris alcohol through fermentation.
The third construction method of recombinant saccharomyces cerevisiae for producing ambergris alcohol comprises the following steps: introducing farnesyl pyrophosphate synthase encoding gene Erg20 into the recombinant strain 1 to obtain a recombinant strain 3;
the nucleotide sequence of the farnesyl pyrophosphate synthase coding gene Erg20 is shown in SEQ ID No. 5.
The recombinant saccharomyces cerevisiae for producing ambergris alcohol constructed by the third method.
The third recombinant saccharomyces cerevisiae is used for producing ambergris alcohol through fermentation.
Experiments prove that the recombinant saccharomyces cerevisiae for producing ambergris alcohol can be used for producing ambergris alcohol by fermentation. Lays a foundation for artificially synthesizing ambergris alcohol.
Drawings
FIG. 1 is a schematic representation of plasmid PXP320- Δ SHC.
FIG. 2 is a schematic representation of plasmid PXP 218-BmeTC.
FIG. 3 is a GC-MS detection of ambroxol.
Detailed Description
The present invention will be further illustrated by the following specific examples.
The experimental procedures used in the following examples are all conventional ones unless otherwise specified.
The Saccharomyces cerevisiae W303-1a (American ATCC: 208352) used in the present invention,
time of purchase, 2016.6 website: https:// www.atcc.org
The present invention is disclosed for the purpose of better understanding by those skilled in the art, but is not limited thereto. Other yeasts may also be used in the present invention.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 construction of plasmid PXP320- Δ SHC
TABLE 1 primer sequences
According to Table 1, a fragment Δ SHC was amplified using an artificially synthesized Δ SHC gene fragment (SEQ ID No.2, site-directed mutagenesis of the agastache cyclase encoding gene Δ SHC) as a template, Spe1-SHC-F (SEQ ID No.6) as a leader, and SHC-Xho1-R (SEQ ID No.7) as a postleader.
Empty plasmid PXP320 (purchased from Addgene) stored in E.coli was extracted using a plasmid miniprep kit, the extraction procedure was as follows:
1. inoculating Escherichia coli containing empty plasmid PXP320 into LB liquid culture medium containing antibiotic (ampicillin) and culturing for 12 hr, collecting 3mL of bacteria solution in a centrifuge tube, centrifuging at 12000rpm for 1min, and discarding supernatant (the supernatant should be removed as much as possible);
2. balancing the adsorption column with 500 μ L BL balancing solution, centrifuging at 12000rpm, and pouring off the waste liquid in the collection tube;
3. adding 250 mu L of P1 solution into the centrifuge tube with the bacterial precipitates obtained in the step 1, and completely suspending the bacterial precipitates;
4. adding 250 mu L of P2 lysis solution into the centrifuge tube, and gently turning over the centrifuge tube for 6-7 times to fully lyse the thallus, wherein the bacteria solution becomes clear;
5. adding 350 mu L of P3 solution into the centrifuge tube, turning the centrifuge tube up and down to precipitate the protein;
6. centrifuging the centrifuge tube operated in the step 5 at 12000rpm for 10min, completely centrifuging the precipitate to the bottom, taking the supernatant into the adsorption column balanced by BL balance liquid in the step 2, adsorbing for 5min in a refrigerator at-20 ℃, centrifuging at 12000rpm for 1min, and pouring out the waste liquid in the collection tube;
7. rinsing the adsorption column with the adsorbed plasmid twice with PW solution containing alcohol to remove impurities, centrifuging at 12000rpm for 2min to remove PW as much as possible, and placing the adsorption column in ventilation position to volatilize alcohol.
8. Add 100. mu.L of deionized water to the adsorption column, place at 37 ℃ for 10min to dissolve the plasmid in water, place the adsorption column in a centrifuge tube, centrifuge at 12000rpm for 2min, and collect the empty plasmid PXP 320.
The amplified fragment Δ SHC and the extracted plasmid PXP320 were subjected to double digestion with the restriction enzymes SpeI and XhoI as follows:
and (3) placing the prepared enzyme digestion system in a water bath kettle at 37 ℃ for enzyme digestion for 1h, purifying and recovering the enzyme digested plasmid and fragment, and carrying out ligation reaction.
The linking system is as follows:
the prepared connecting system is placed at 22 ℃ for connecting for 1 h. Then, Escherichia coli competent cells Trans1-T1 (referred to as competent cells for short) purchased from Hokko gold were used to transform and verify that the constructed plasmid PXP 320-. DELTA.SHC was correct. The conversion steps are as follows: taking out the competent cells from a refrigerator at minus 80 ℃, putting the competent cells on ice, thawing the competent cells, taking 50 mu L of the competent cells in a centrifuge tube, adding 5 mu L of the connected product (PXP 320-delta SHC), gently mixing the competent cells and the centrifuge tube uniformly, and standing the mixture on the ice for 30 min; moving the centrifugal tube into a 42 ℃ water bath kettle, thermally shocking for 30 seconds, immediately taking out, placing on ice, standing for 2min, and ensuring a stable moving process without violently shaking the centrifugal tube; adding 500 mu L of LB culture medium without antibiotics into the centrifuge tube in the step 2, and recovering for 1 hour in a shaking table at 37 ℃; centrifuging at 4000rpm, removing a supernatant LB culture solution, adding 100 mu L of sterile water, re-suspending cells, coating a bacterial solution on an LB plate culture medium containing antibiotic Amp, culturing at 37 ℃, growing a single colony, extracting plasmids, performing enzyme digestion verification, and verifying correctness, namely successful construction.
Example 2 construction method of plasmid PXP218-BmeTC
The construction method of the plasmid PXP218-BmeTC is the same as that in example 1, and the fragment BmeTC is amplified by PCR by taking an artificially synthesized BmeTC gene fragment (SEQ ID No.3) as a template, Spe1-BmeTC-F as a front guide (SEQ ID No.8) and Xho1-BmeTC-R (SEQ ID No.9) as a rear guide. An empty plasmid PXP218 (purchased from Addgene) was extracted, which was stored in E.coli.
Carrying out double enzyme digestion on the amplified fragment BmeTC and the extracted plasmid PXP218 by using restriction enzymes SpeI and XhoI, preparing according to the enzyme digestion system in the embodiment 1, placing the prepared enzyme digestion system in a water bath kettle at 37 ℃ for enzyme digestion for 1h, purifying and recovering the enzyme digested plasmid and fragment, and carrying out ligation reaction. The prepared connecting system is placed at 22 ℃ for connecting for 1 h. According to the method in the embodiment 1, the constructed plasmid (PXP218-BmeTC) is transformed into an Escherichia coli competent cell Trans1-T1, and when a single colony grows out, the plasmid is extracted for enzyme digestion verification, and the construction is successful after the verification is correct.
Example 3 construction method of Saccharomyces cerevisiae recombinant bacterium 1
The recombinant bacterium 1 is obtained by introducing site-directed mutagenesis agastache cyclase encoding gene delta SHC and tetraphenyl- β -curcumene synthase encoding gene BmeTC into Saccharomyces cerevisiae (Saccharomyces cerevisiae W303-1a), wherein the nucleotide sequence of the site-directed mutagenesis agastache cyclase encoding gene delta SHC is shown as SEQ ID No.2, and the nucleotide sequence of the tetraphenyl- β -curcumene synthase encoding gene BmeTC is shown as SEQ ID No. 3.
Delta SHC (SEQ ID No.2) is obtained by mutating 377 th amino acid of agastache cyclase SHC (SEQ ID No.1) from aspartic acid to cysteine to obtain site-directed mutagenesis agastache cyclase, wherein the agastache cyclase (SHC) is derived from Alicyclobacillus acidocaldarius and tetraphenyl- β -curcumene synthase (BmeTC) is derived from Bacillus megaterium, is synthesized by a chemical synthesis method by K.martensii Kahry bioengineering GmbH, is codon-optimized for Saccharomyces cerevisiae, is connected to an Escherichia coli plasmid, and is stored in Escherichia coli.
The plasmid PXP320- Δ SHC constructed in example 1 was transformed into a strain of Saccharomyces cerevisiae as follows:
1. inoculating Saccharomyces cerevisiae W303-1a serving as a growth-promoting strain into a test tube YPD, and culturing by shaking overnight at 30 ℃;
2. transferring the overnight cultured saccharomyces cerevisiae into a new test tube YPD liquid culture medium according to the volume ratio of 1/10, and performing shake culture at 30 ℃ for 4h to enable the saccharomyces cerevisiae to reach a logarithmic phase;
3. taking 1mL of bacterial liquid in a sterile centrifuge tube, centrifuging for 3min at 5000rpm, removing supernatant, and washing the thalli once with 1mL of sterile water;
4. resuspending the washed Saccharomyces cerevisiae with 1mL of 100mM LiAc aqueous solution, and standing for 5 min;
5.5000rpm for 3min, removing LiAc aqueous solution, and reserving bottom yeast;
6. preparing a transformation system in a centrifugal tube containing yeast, and specifically adding reagents in the following sequence:
(the transformed plasmid is PXP320- Δ SHC, larger than 300 ng; wherein salmon sperm DNA needs to be boiled in boiling water for 5min to melt it and then rapidly transferred to ice bath for yeast transformation;)
7. Blowing and sucking the prepared conversion system by a pipette or placing the conversion system on a vortex oscillator to vibrate for 1min to fully and uniformly mix the system, placing the system in a 42 ℃ water bath kettle, and thermally exciting for 30 min;
8. centrifuging the yeast after heat shock, removing supernatant with a pipette, adding 1mLYPD culture medium, and recovering in a shaking table at 30 deg.C for 2 hr;
9.5000rpm for 3min, removing YPD liquid medium, and washing with sterile water for 2 times;
10. 100 μ L of sterile water was added, the yeast cells were resuspended and plated on SC selective solid medium lacking histidine His, and cultured in 30 ℃ incubator for 2 d.
11. And after the single bacterium grows out, carrying out colony PCR.
The invention adopts a freeze-thaw method to crudely extract a saccharomyces cerevisiae genome, firstly selects a single colony to 10 mu L of NaOH solution with the concentration of 10mM, boils for 10min in boiling water, then puts into a refrigerator with the temperature of minus 20 ℃ for freezing for 10min, and repeatedly freezes and freezes for three times, namely, the saccharomyces cerevisiae cell is crushed, and can be directly used as a template for colony verification, and the strain with correct colony verification is the saccharomyces cerevisiae containing plasmid PXP 320-delta SHC.
The correct strain was confirmed by colony PCR for further transformation.
The plasmid PXP218-BmeTC constructed in the embodiment 2 is transformed into a saccharomyces cerevisiae strain containing the plasmid PXP 320-delta SHC, the transformed saccharomyces cerevisiae strain is coated on an SC selective solid culture medium lacking uracil Ura and histidine His for screening, after single bacteria grow out, colony PCR is carried out, and the correct bacteria are verified to be recombinant bacteria 1.
Example 4 preparation of plasmid pRS304-tHMG1
According to Table 2, the fragment P was PCR-amplified using Saccharomyces cerevisiae genome (Saccharomyces cerevisiae W303-1a) as a template, ApaI-Tdh3P-F (SEQ ID No.10) as a front leader, Tdh3P-R-tHMG1(SEQ ID No.11) as a rear leaderTdh3；
PCR-amplified fragment tHMG1(SEQ ID No.4) by taking Saccharomyces cerevisiae genome (Saccharomyces cerevisiae W303-1a) as a template, Tdh3p-tHMG1-F (SEQ ID No.12) as a front primer and tHMG1-R-Cyc1t (SEQ ID No.13) as a rear primer (the sequence coding the N-terminal amino acid of HMG1 is truncated, and only the sequence coding the C-terminal 503 amino acids of HMG1 protein is reserved);
PCR is carried out by taking Saccharomyces cerevisiae genome (Saccharomyces cerevisiae W303-1a) as template, tHMG1-Cyc1T-F (SEQ ID No.14) as front primer and Cyc1T-R-Pts1(SEQ ID No.15) as rear primer, and fragment T is amplifiedCyc1. Segment PTdh3、tHMG1、TCyc1Fusion into expression cassette P by fusion PCRTdh3-tHMG1-TCyc1。
The PCR enzyme used in the present invention is that of Nanjing NuoZan Biotech Co., Ltd
Max Super-Fidelity polymerase 50. mu.L of PCR amplification system is DNA template, 1. mu.L, 2. mu.L of each of front lead (10. mu.M) and rear lead (10. mu.M), dNTP (10mM), 1. mu.L, 2 × Phanta Max Buffer, 25. mu.L;
max Super-Fidelity polymerase, 1 μ L; finally, double steaming is carried outThe water is filled up to 50 mu L. An amplification program is set up on the PCR instrument. The amplification conditions were 95 ℃ pre-denaturation for 4min (1 cycle); denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, and extension at 72 ℃ for 1min (34 cycles); extension at 72 ℃ for 5min (1 cycle).
The fusion PCR system used by the invention comprises 800ng of total amount of DNA fragments, 1:1 of molar ratio, 1 muL of dNTP (10mM), 2 × Phanta Max Buffer, 25 muL;
max Super-Fidelity polymerase, 1 μ L; finally, 50 mu L of double distilled water is used for supplementing. An amplification program is set up on the PCR instrument. The amplification conditions were 95 ℃ pre-denaturation for 4min (1 cycle); denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 1min (11 cycles), and extension at 72 ℃ for 5min (1 cycle).
The expression cassette P obtained by fusionTdh3-tHMG1-TCyc1And empty vector pRS304 (purchased from the Biovector plasmid vector cell Gene Collection NTCC) was ligated by digestion according to the method of example 1 to construct expression vector pRS304-tHMG1, using ApaI and PstI as restriction enzymes. The constructed plasmid pRS304-tHMG1 is transformed into Escherichia coli according to the method of example 1, and when a single colony grows out, the plasmid is extracted for enzyme digestion verification, and the construction is successful if the plasmid is verified to be correct.
TABLE 2 primer sequences
Example 5 construction method of Saccharomyces cerevisiae recombinant bacterium 2
And (2) introducing a truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene tHMG1 into the recombinant bacterium 1 to obtain a recombinant bacterium 2, wherein the nucleotide sequence of the truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene tHMG1 is shown in SEQ ID No. 4.
The plasmid pRS304-tHMG1 constructed in example 4 was transformed into recombinant bacterium 1 by the following method:
1. inoculating the recombinant strain 1 into a test tube YPD, and carrying out shaking table overnight culture at 30 ℃;
2. transferring the overnight cultured recombinant bacterium 1 to a new test tube YPD liquid culture medium according to the volume ratio of 1/10, and performing shake culture at 30 ℃ for 4h to enable the strain to reach the logarithmic phase;
3. taking 1mL of bacterial liquid in a sterile centrifuge tube, centrifuging for 3min at 5000rpm, removing supernatant, and washing the thalli once with 1mL of sterile water;
4. resuspending the washed recombinant bacterium 1 with 1mL of 100mM LiAc aqueous solution, and standing for 5 min;
5.5000rpm for 3min, removing LiAc aqueous solution, and reserving bottom yeast;
6. preparing a transformation system in a centrifugal tube containing yeast, and specifically adding reagents in the following sequence:
(the transformed plasmid was pRS304-tHMG1, larger than 300 ng; wherein salmon sperm DNA was melted by boiling in boiling water for 5min and then rapidly transferred to an ice bath for yeast transformation;)
7. Blowing and sucking the prepared conversion system by a pipette or placing the conversion system on a vortex oscillator to vibrate for 1min to fully and uniformly mix the system, placing the system in a 42 ℃ water bath kettle, and thermally exciting for 30 min;
8. centrifuging the yeast after heat shock, removing supernatant with a pipette, adding 1mLYPD culture medium, and recovering in a shaking table at 30 deg.C for 2 hr;
9.5000rpm for 3min, removing YPD liquid medium, and washing with sterile water for 2 times;
10. 100 μ L of sterile water was added, the yeast cells were resuspended and plated on SC selective solid medium lacking tryptophan, and cultured in an incubator at 30 ℃ for 2 d.
11. And after the single bacterium grows out, carrying out colony PCR.
The invention adopts a freeze-thaw method to crudely extract a saccharomyces cerevisiae genome, firstly selects a single colony to 10 mu L of NaOH solution with the concentration of 10mM, boils for 10min in boiling water, then puts into a refrigerator with the temperature of minus 20 ℃ for freezing for 10min, and repeatedly freezes and freezes for three times, namely, the saccharomyces cerevisiae cell is crushed, and can be directly used as a template to carry out colony verification, and the bacterial strain with correct colony verification is a recombinant strain 2.
Example 6 preparation of plasmid pRS405-Erg20
According to Table 3, the fragment P was PCR-amplified using Saccharomyces cerevisiae genome (Saccharomyces cerevisiae W303-1a) as template, Pst1-Pgk1P-F (SEQ ID No.16) as front guide, Pgk1P-R-Erg20(SEQ ID No.17) as rear guidePgk1(ii) a PCR is carried out to obtain a segment Erg20(SEQ ID No.5) by taking a Saccharomyces cerevisiae genome (Saccharomyces cerevisiae W303-1a) as a template, Pgk1p-Erg20-F (SEQ ID No.18) as a front guide and Erg20-R-Cyc1t (SEQ ID No.19) as a rear guide; PCR is carried out by taking Saccharomyces cerevisiae genome (Saccharomyces cerevisiae W303-1a) as template, Erg20-Cyc1T-F (SEQ ID No.20) as front guide and Cyc1T-R-BamHI (SEQ ID No.21) as rear guide to obtain fragment TCyc1. Segment PPgk1、Erg20、TCyc1Fusing the expression cassette P by using a fusion PCR methodPgk1-Erg20-TCyc1。
The PCR enzyme used in the present invention is that of Nanjing NuoZan Biotech Co., Ltd
Max Super-Fidelity polymerase 50. mu.L of PCR amplification system is DNA template, 1. mu.L, 2. mu.L of each of front lead (10. mu.M) and rear lead (10. mu.M), dNTP (10mM), 1. mu.L, 2 × Phanta Max Buffer, 25. mu.L;
max Super-Fidelity polymerase, 1 μ L; finally, 50 mu L of double distilled water is used for supplementing. An amplification program is set up on the PCR instrument. The amplification conditions were 95 ℃ pre-denaturation for 4min (1 cycle); denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 15sec, and extension at 72 ℃ for 1min (34 cycles); extension at 72 ℃ for 5min (1 cycle).
The fusion PCR system used by the invention comprises 800ng of total amount of DNA fragments, 1:1 of molar ratio, 1 muL of dNTP (10mM), 2 × Phanta Max Buffer, 25 muL;
max Super-Fidelity polymerase, 1 μ L; finally, 50 mu L of double distilled water is used for supplementing. On the PCR instrument is arrangedAnd (5) performing amplification procedures. The amplification conditions were 95 ℃ pre-denaturation for 4min (1 cycle); denaturation at 95 ℃ for 15sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 1min (11 cycles), and extension at 72 ℃ for 5min (1 cycle).
The expression cassette P obtained by fusionPgk1-Erg20-TCyc1And empty vector pRS405 (from Biotechnology air) were ligated by digestion as described in example 1 to construct expression vector pRS405-Erg 20. The restriction enzymes used were Pst1 and BamHI, which had an asterisk activity and was cleaved for 30 min. The constructed plasmid pRS405-Erg20 is transformed into escherichia coli according to the method of the embodiment 1, and after a single colony grows out, the plasmid is extracted for enzyme digestion verification, and the construction is successful if the plasmid is verified to be correct.
TABLE 3 primer sequences
Example 7 construction method of Saccharomyces cerevisiae recombinant bacterium 3
And (3) introducing a farnesyl pyrophosphate synthase encoding gene Erg20 into the recombinant bacterium 1 to obtain a recombinant bacterium 3, wherein the nucleotide sequence of the farnesyl pyrophosphate synthase encoding gene Erg20 is shown in SEQ ID No. 5.
The plasmid pRS405-Erg20 constructed in example 6 is transformed into the recombinant bacterium 1 by the following method:
1. inoculating the recombinant strain 1 into a test tube YPD, and carrying out shaking table overnight culture at 30 ℃;
2. transferring the overnight cultured recombinant bacterium 1 to a new test tube YPD liquid culture medium according to the volume ratio of 1/10, and performing shake culture at 30 ℃ for 4h to enable the strain to reach the logarithmic phase;
3. taking 1mL of bacterial liquid in a sterile centrifuge tube, centrifuging for 3min at 5000rpm, removing supernatant, and washing the thalli once with 1mL of sterile water;
4. resuspending the washed recombinant bacterium 1 with 1mL of 100mM LiAc aqueous solution, and standing for 5 min;
5.5000rpm for 3min, removing LiAc aqueous solution, and reserving bottom yeast;
6. preparing a transformation system in a centrifugal tube containing yeast, and specifically adding reagents in the following sequence:
(the transformed plasmid is pRS405-Erg20, greater than 300 ng; where salmon sperm DNA needs to be boiled in boiling water for 5min to melt it and then rapidly transferred to an ice bath for yeast transformation;)
7. Blowing and sucking the prepared conversion system by a pipette or placing the conversion system on a vortex oscillator to vibrate for 1min to fully and uniformly mix the system, placing the system in a 42 ℃ water bath kettle, and thermally exciting for 30 min;
8. centrifuging the yeast after heat shock, removing supernatant with a pipette, adding 1mLYPD culture medium, and recovering in a shaking table at 30 deg.C for 2 hr;
9.5000rpm for 3min, removing YPD liquid medium, and washing with sterile water for 2 times;
10. 100 μ L of sterile water was added, the yeast cells were resuspended and plated on SC selective solid medium lacking leucine, and cultured in 30 ℃ incubator for 2 d.
11. And after the single bacterium grows out, carrying out colony PCR.
The invention adopts a freeze-thaw method to crudely extract a saccharomyces cerevisiae genome, firstly selects a single colony to 10 mu L of NaOH solution with the concentration of 10mM, boils for 10min in boiling water, then puts into a refrigerator with the temperature of minus 20 ℃ for freezing for 10min, and repeatedly freezes and freezes for three times, namely, the saccharomyces cerevisiae cell is crushed, and can be directly used as a template to carry out colony verification, and the bacterial strain with correct colony verification is a recombinant strain 3.
Example 8 fermentation of recombinant bacteria to Ambergris alcohol
(1) Recombinant bacterium culture and product extraction
Firstly, activating the recombinant bacteria 1, the recombinant bacteria 2 and the recombinant bacteria 3 obtained in the embodiments 3, 5 and 7 and the ATCC208352 on an SC selective solid culture medium; then inoculating each recombinant strain into YPD liquid culture medium in test tube, culturing overnight until OD is reached600Growing to about 4.0, inoculating into shake flask containing 30mLYPD medium to obtain initial OD600The ambergris alcohol yield was measured after fermentation at 220rpm for 5 days at 0.05, 30 ℃.
The extraction method of ambergris alcohol comprises the following steps: for extracellular ambergris alcohol extraction, 5mL of fermentation broth was mixed with 500. mu.L of n-hexane, shaken with a vortex shaker for 30min, then centrifuged at 12000g for 5min, and the n-hexane layer was collected. The intracellular ambergris alcohol is extracted according to the following method: after separating the supernatant, the cells were mixed with 0.5mL of n-hexane and 0.25mL of glass beads having a diameter of 0.5mm, vortexed and shaken for 30min to break the cells, and then centrifuged at 12000g for 5min, and the n-hexane layer was collected.
(2) GC-MS detection of ambroxol
Ambroxol detection was performed using an Agilent 7890A gas chromatograph and a 5975C insert XL EI/CIMSD mass spectrometer.
The GC-MS detection method of ambergris alcohol comprises the following steps: the chromatographic column HP-5ms, the helium gas flow rate 1mL/min, the injection port temperature 290 ℃, the initial column temperature 220 ℃, the column temperature 2 ℃/min rising to 290 ℃, the scanning range 40-500 m/z.
(3) The result of the detection
A. Saccharomyces cerevisiae W303-1aATCC208352 did not detect ambergrol;
B. 1, recombinant bacteria: extracting a fermentation product of the recombinant bacterium 1, and detecting that the ambergris alcohol content is 5.1 mg/L;
C. recombinant bacterium 2: extracting a fermentation product of the recombinant bacterium 2, and detecting that the content of ambergris alcohol is 8.3 mg/L;
D. recombinant bacterium 3: extracting the fermentation product of the recombinant bacterium 3, and detecting that the content of ambergris alcohol is 15.4 mg/L.
TABLE 4 ability of recombinant strains to produce ambergris alcohol
| Name of bacterium | Ambergris alcohol (mg/L) |
| Saccharomyces cerevisiae W303-1aATCC208352 | 0 |
| Recombinant bacterium 1 | 5.1 |
| Recombinant bacterium 2 | 8.3 |
| Recombinant bacterium 3 | 15.4 |
SC selective solid medium formulation: 6.7g/L Yeast Nitrogen Base (YNB), 20g/L glucose, 20g/L agar powder; 2g/L of the corresponding default amino acid mixture.
The corresponding default amino acid mixture components include:
YPD medium: 20g/L peptone, 10g/L yeast extract powder, 20g/L glucose, and 2% agar powder added to the solid medium.
Sequence listing
<110> Tianjin university
<120> recombinant saccharomyces cerevisiae for producing ambergris alcohol and construction method thereof
<160>21
<170>SIPOSequenceListing 1.0
<210>1
<211>1896
<212>DNA
<213> Alicyclobacillus acidocaldarius (Alicyclobacillus acidocaldarius)
<400>1
atggctgagc agttggtgga agcgccggcc tacgcgcgga cgctggatcg cgcggtggag 60
tatctcctct cctgccaaaa ggacgaaggc tactggtggg ggccgcttct gagcaacgtc 120
acgatggaag cggagtacgt cctcttgtgc cacattctcg atcgcgtcga tcgggatcgc 180
atggagaaga tccggcggta cctgttgcac gagcagcgcg aggacggcac gtgggccctg 240
tacccgggtg ggccgccgga cctcgacacg accatcgagg cgtacgtcgc gctcaagtat 300
atcggcatgt cgcgcgacga ggagccgatg cagaaggcgc tccggttcat tcagagccag 360
ggcgggatcg agtcgtcgcg cgtgttcacg cggatgtggc tggcgctggt gggagaatat 420
ccgtgggaga aggtgcccat ggtcccgccg gagatcatgt tcctcggcaa gcgcatgccg 480
ctcaacatct acgagtttgg ctcgtgggct cgggcgaccg tcgtggcgct ctcgattgtg 540
atgagccgcc agccggtgtt cccgctgccc gagcgggcgc gcgtgcccga gctgtacgag 600
accgacgtgc ctccgcgccg gcgcggcgcc aagggagggg gtgggtggat cttcgacgcg 660
ctcgaccggg cgctgcacgg gtatcagaag ctgtcggtgc acccgttccg ccgcgcggcc 720
gagatccgcg ccttggactg gttgctcgag cgccaggccg gagacggcag ctggggcggg 780
attcagccgc cttggtttta cgcgctcatc gcgctcaaga ttctcgacat gacgcagcat 840
ccggcgttca tcaagggctg ggaaggtcta gagctgtacg gcgtggagct ggattacgga 900
ggatggatgt ttcaggcttc catctcgccg gtgtgggaca cgggcctcgc cgtgctcgcg 960
ctgcgcgctg cggggcttcc ggccgatcac gaccgcttgg tcaaggcggg cgagtggctg 1020
ttggaccggc agatcacggt tccgggcgac tgggcggtga agcgcccgaa cctcaagccg 1080
ggcgggttcg cgttccagtt cgacaacgtg tactacccgg acgtggacga cacggccgtc 1140
gtggtgtggg cgctcaacac cctgcgcttg ccggacgagc gccgcaggcg ggacgccatg 1200
acgaagggat tccgctggat tgtcggcatg cagagctcga acggcggttg gggcgcctac 1260
gacgtcgaca acacgagcga tctcccgaac cacatcccgt tctgcgactt cggcgaagtg 1320
accgatccgc cgtcagagga cgtcaccgcc cacgtgctcg agtgtttcgg cagcttcggg 1380
tacgatgacg cctggaaggt catccggcgc gcggtggaat atctcaagcg ggagcagaag 1440
ccggacggca gctggttcgg tcgttggggc gtcaattacc tctacggcac gggcgcggtg 1500
gtgtcggcgc tgaaggcggt cgggatcgac acgcgcgagc cgtacattca aaaggcgctc 1560
gactgggtcg agcagcatca gaacccggac ggcggctggg gcgaggactg ccgctcgtac 1620
gaggatccgg cgtacgcggg taagggcgcg agcaccccgt cgcagacggc ctgggcgctg 1680
atggcgctca tcgcgggcgg cagggcggag tccgaggccg cgcgccgcgg cgtgcaatac 1740
ctcgtggaga cgcagcgccc ggacggcggc tgggatgagc cgtactacac cggcacgggc 1800
ttcccagggg atttctacct cggctacacc atgtaccgcc acgtgtttcc gacgctcgcg 1860
ctcggccgct acaagcaagc catcgagcgc aggtga 1896
<210>2
<211>1896
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atggcagaac aattagttga agctccagca tacgctagaa ctttggatag agctgttgaa 60
tatttgttgt cttgtcaaaa ggatgaaggt tactggtggg gtccattgtt gtcaaacgtt 120
acaatggaag ctgaatacgt tttgttgtgt catatcttgg atagagttga tagagataga 180
atggaaaaga ttagaagata tttgttgcat gaacaaagag aagatggtac ttgggcttta 240
tacccaggtg gtccaccaga tttggatact acaatcgaag catacgttgc tttgaagtac 300
atcggcatgt ctagagatga agaaccaatg caaaaagctt tgagattcat tcaatcacaa 360
ggtggtatcg aatcttcaag agtttttaca agaatgtggt tggctttagt tggtgaatat 420
ccatgggaaa aagttccaat ggttccacca gaaatcatgt tcttgggtaa aagaatgcca 480
ttgaacatct atgaattcgg ttcttgggca agagctactg ttgttgcatt gtctattgtt 540
atgtcaagac aaccagtttt tccattacca gaaagagcta gagttccaga attgtatgaa 600
acagatgttc caccaagaag aagaggtgca aaaggtggtg gtggttggat ttttgatgca 660
ttagatagag ctttgcatgg ttaccaaaag ttgtctgttc atccttttag aagagctgca 720
gaaattagag cattggattg gttgttagaa agacaagctg gtgacggttc atggggtggt 780
attcaaccac catggttcta cgcattgatc gctttgaaga tcttggatat gactcaacat 840
ccagctttta ttaaaggttg ggaaggtttg gaattatacg gtgttgaatt agattatggt 900
ggttggatgt ttcaagcttc tatttcacca gtttgggata ctggtttggc agttttggct 960
ttaagagctg caggtttacc agcagatcat gatagattgg ttaaagctgg tgaatggttg 1020
ttagatagac aaattacagt tccaggtgac tgggcagtta aaagaccaaa tttgaaacca 1080
ggtggtttcg ctttccaatt cgataacgtt tactacccag atgttgattg tactgcagtt 1140
gttgtttggg ctttgaatac attgagatta ccagatgaaa gaagaagaag agatgctatg 1200
actaaaggtt ttagatggat tgttggtatg caatcttcaa atggtggttg gggtgcttat 1260
gatgttgata acacatctga tttgccaaac catatcccat tctgtgattt cggtgaagtt 1320
actgatccac catctgaaga tgttacagct catgttttag aatgtttcgg ttcattcggt 1380
tatgatgatg catggaaagt tattagaaga gctgttgaat acttgaagag agaacaaaaa 1440
ccagatggtt cttggtttgg tagatggggt gttaattatt tgtacggtac tggtgctgtt 1500
gtttcagcat tgaaagctgt tggtatcgat acaagagaac catacatcca aaaagcattg 1560
gattgggttg aacaacatca aaatccagat ggtggttggg gtgaagattg tagatcttac 1620
gaagatccag cttatgctgg taaaggtgct tctactccat cacaaacagc atgggcttta 1680
atggcattga ttgctggtgg tagagcagaa tcagaagctg caagaagagg tgttcaatat 1740
ttggttgaaa cacaaagacc agatggtggt tgggatgaac catattacac tggtacaggt 1800
tttccaggtg acttctattt gggttacact atgtacagac atgtttttcc aacattggca 1860
ttaggtagat acaaacaagc tattgaaaga agataa 1896
<210>3
<211>1878
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atgatcatat tgctaaagga agttcagcta gagattcagc gaagaatcgc ctatctgcgc 60
ccaacacaaa aaaatgacgg gtcatttcgc tactgttttg aaacaggcgt tatgcctgat 120
gcgtttttaa ttatgcttct tcgcaccttt gatttagata aagaagtgtt gattaaacaa 180
ttaaccgaac ggatcgtttc ccttcaaaat gaagatggtc tttggacgtt gtttgatgat 240
gaagaacata acttatccgc cactattcaa gcttatacag ctcttttata ttcagggtat 300
taccaaaaaa acgaccggat tttgcgaaaa gcagaaagat atattataga ttcgggaggc 360
atttcgcgcg ctcattttct tacaagatgg atgctttctg ttaacggttt atacgagtgg 420
ccaaagctat tttacctccc gctttctctt ttgctcgtgc ctacctatgt accgcttaac 480
ttttatgaat taagcaccta tgccagaatt cacttcgttc cgatgatggt agcaggaaac 540
aaaaaatttt cacttacttc taggcataca ccttctcttt ctcatttaga tgtaagagaa 600
cagaaacagg aatcggagga aactactcaa gaatcacgcg cttctatttt tttagtcgac 660
catttaaaac agctggcttc tttaccttct tacatccaca agcttggtta tcaagcagcg 720
gagcgttaca tgctagaaag aattgaaaaa gacggaacac tctacagcta cgccacctct 780
acttttttta tgatttacgg tcttttggct cttggctata aaaaagattc atttgtgatc 840
caaaaagcaa ttgacggtat ttgttcacta cttagtacat gcagcggcca cgtgcacgta 900
gaaaactcca cgtcaaccgt ttgggatacc gcgctgctat cttacgctct acaggaagca 960
ggtgtaccgc agcaagatcc tatgattaaa ggcacaactc gctacttaaa gaaaagacag 1020
catacaaagc ttggagattg gcagtttcat aacccaaata cagcacctgg aggctggggg 1080
ttttccgata ttaatacgaa taaccctgac ttagacgata cgtctgctgc tatcagagct 1140
ctttctagaa gagcacaaac cgatacagat tatttggagt cttggcaaag aggcattaac 1200
tggctgctgt ccatgcaaaa caaagacggg ggttttgctg catttgaaaa aaatactgac 1260
tctattttat ttacttatct cccgcttgaa aatgcaaaag atgcagcgac ggatccggct 1320
actgccgatt taaccggtcg agtgcttgag tgcctcggaa actttgctgg tatgaataaa 1380
tcccaccctt cgattaaagc tgcagtaaaa tggctgtttg atcatcagtt ggataacggg 1440
agctggtacg gccggtgggg agtttgctac atttacggaa cgtgggccgc tattacagga 1500
cttcgtgctg taggggtttc tgcttctgat ccgcgtatca tcaaagctat caactggctc 1560
aaaagcattc aacaagaaga cggtggattc ggagaatcat gctatagcgc ttctttaaaa 1620
aaatatgtgc cactatcgtt tagcacccct tctcaaacgg cttgggctct cgatgcttta 1680
atgacaatat gtccattaaa agatcgatcc gttgaaaaag gaattaaatt tttactgaat 1740
ccaaatctta cagagcagca aactcattac cccacgggaa ttggtcttcc tggacaattt 1800
tatattcagt accacagcta caatgatatt tttcctcttc ttgcacttgc tcactacgca 1860
aaaaaacatt cttcgtaa 1878
<210>4
<211>1512
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
atgccagttt taaccaataa aacagtcatt tctggatcga aagtcaaaag tttatcatct 60
gcgcaatcga gctcatcagg accttcatca tctagtgagg aagatgattc ccgcgatatt 120
gaaagcttgg ataagaaaat acgtccttta gaagaattag aagcattatt aagtagtgga 180
aatacaaaac aattgaagaa caaagaggtc gctgccttgg ttattcacgg taagttacct 240
ttgtacgctt tggagaaaaa attaggtgat actacgagag cggttgcggt acgtaggaag 300
gctctttcaa ttttggcaga agctcctgta ttagcatctg atcgtttacc atataaaaat 360
tatgactacg accgcgtatt tggcgcttgt tgtgaaaatg ttataggtta catgcctttg 420
cccgttggtg ttataggccc cttggttatc gatggtacat cttatcatat accaatggca 480
actacagagg gttgtttggt agcttctgcc atgcgtggct gtaaggcaat caatgctggc 540
ggtggtgcaa caactgtttt aactaaggat ggtatgacaa gaggcccagt agtccgtttc 600
ccaactttga aaagatctgg tgcctgtaag atatggttag actcagaaga gggacaaaac 660
gcaattaaaa aagcttttaa ctctacatca agatttgcac gtctgcaaca tattcaaact 720
tgtctagcag gagatttact cttcatgaga tttagaacaa ctactggtga cgcaatgggt 780
atgaatatga tttctaaagg tgtcgaatac tcattaaagc aaatggtaga agagtatggc 840
tgggaagata tggaggttgt ctccgtttct ggtaactact gtaccgacaa aaaaccagct 900
gccatcaact ggatcgaagg tcgtggtaag agtgtcgtcg cagaagctac tattcctggt 960
gatgttgtca gaaaagtgtt aaaaagtgat gtttccgcat tggttgagtt gaacattgct 1020
aagaatttgg ttggatctgc aatggctggg tctgttggtg gatttaacgc acatgcagct 1080
aatttagtga cagctgtttt cttggcatta ggacaagatc ctgcacaaaa tgttgaaagt 1140
tccaactgta taacattgat gaaagaagtg gacggtgatt tgagaatttc cgtatccatg 1200
ccatccatcg aagtaggtac catcggtggt ggtactgttc tagaaccaca aggtgccatg 1260
ttggacttat taggtgtaag aggcccgcat gctaccgctc ctggtaccaa cgcacgtcaa 1320
ttagcaagaa tagttgcctg tgccgtcttg gcaggtgaat tatccttatg tgctgcccta 1380
gcagccggcc atttggttca aagtcatatg acccacaaca ggaaacctgc tgaaccaaca 1440
aaacctaaca atttggacgc cactgatata aatcgtttga aagatgggtc cgtcacctgc 1500
attaaatcct aa 1512
<210>5
<211>1059
<212>DNA
<213> Saccharomyces cerevisiae
<400>5
atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60
gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120
gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180
gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240
aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttacttctt ggtcgccgat 300
gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360
gttggggaaa ttgccatcaa tgacgcattc atgttagagg ctgctatcta caagcttttg 420
aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480
accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540
gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600
tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660
gatttgaaacaagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720
gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780
gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840
aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900
attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960
gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020
actgcgttct tgaacaaagt ttacaagaga agcaaatag 1059
<210>6
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ggactagtca tggcagaaca attagttgaa g 31
<210>7
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ccctcgaggt tatcttcttt caatagctt 29
<210>8
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
ggactagtca tgatcatatt gctaaagga 29
<210>9
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
ccctcgaggt tacgaagaat gtttttttgc 30
<210>10
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
aagggcccat actagcgttg aatgttagcg 30
<210>11
<211>50
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ctgttttatt ggttaaaact ggcattttgt ttgtttatgt gtgtttattc 50
<210>12
<211>50
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
gaataaacac acataaacaa acaaaatgcc agttttaacc aataaaacag 50
<210>13
<211>45
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
cgacaaagga aaaggggcct gtttaggatt taatgcaggt gacgg 45
<210>14
<211>45
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
ccgtcacctg cattaaatcc taaacaggcc ccttttcctt tgtcg 45
<210>15
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
tgcctgcaga agcagacgct actaaggaaa ac 32
<210>16
<211>34
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
taactgcagt attttagatt cctgacttca actc 34
<210>17
<211>49
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
ctaatttctt tttctgaagc cattgtttta tatttgttgt aaaaagtag 49
<210>18
<211>49
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
ctacttttta caacaaatat aaaacaatgg cttcagaaaa agaaattag 49
<210>19
<211>47
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
cgacaaagga aaaggggcct gtctatttgc ttctcttgta aactttg 47
<210>20
<211>47
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
caaagtttac aagagaagca aatagacagg ccccttttcc tttgtcg 47
<210>21
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
cgggatccaa gcagacgcta ctaaggaaaa c 31
Claims (9)
1. The construction method of the recombinant Saccharomyces cerevisiae for producing ambroxol is characterized by comprising the following steps of introducing site-directed mutated hopene cyclase encoding gene delta SHC and tetraphenyl- β -curcumene synthase encoding gene BmeTC into Saccharomyces cerevisiae (Saccharomyces cerevisiae W303-1a) to obtain recombinant bacteria 1;
the nucleotide sequence of the site-directed mutant hopene cyclase encoding gene delta SHC is shown in SEQ ID No. 2.
The nucleotide sequence of the tetraphenyl- β -curcumene synthase coding gene BmeTC is shown as SEQ ID No. 3.
2. The recombinant saccharomyces cerevisiae for producing ambergris alcohol constructed by the method of claim 1.
3. Use of the recombinant saccharomyces cerevisiae of claim 2 for the fermentative production of ambergris alcohol.
4. The construction method of the recombinant saccharomyces cerevisiae for producing ambergris alcohol is characterized by comprising the following steps: introducing a truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene tHMG1 into the recombinant bacterium 1 to obtain a recombinant bacterium 2;
the nucleotide sequence of the truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase coding gene tHMG1 is shown in SEQ ID No. 4.
5. The recombinant saccharomyces cerevisiae for producing ambergris alcohol constructed by the method of claim 4.
6. Use of the recombinant saccharomyces cerevisiae of claim 5 for the fermentative production of ambergris alcohol.
7. The construction method of the recombinant saccharomyces cerevisiae for producing ambergris alcohol is characterized by comprising the following steps: introducing farnesyl pyrophosphate synthase encoding gene Erg20 into the recombinant strain 1 to obtain a recombinant strain 3;
the nucleotide sequence of the farnesyl pyrophosphate synthase coding gene Erg20 is shown in SEQ ID No. 5.
8. The recombinant saccharomyces cerevisiae for producing ambergris alcohol constructed by the method of claim 7.
9. Use of the recombinant saccharomyces cerevisiae of claim 8 for the fermentative production of ambergris alcohol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010113440.3A CN111334522B (en) | 2020-02-24 | 2020-02-24 | Recombinant saccharomyces cerevisiae for producing ambergris alcohol and construction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010113440.3A CN111334522B (en) | 2020-02-24 | 2020-02-24 | Recombinant saccharomyces cerevisiae for producing ambergris alcohol and construction method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111334522A true CN111334522A (en) | 2020-06-26 |
| CN111334522B CN111334522B (en) | 2023-05-30 |
Family
ID=71177859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010113440.3A Active CN111334522B (en) | 2020-02-24 | 2020-02-24 | Recombinant saccharomyces cerevisiae for producing ambergris alcohol and construction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111334522B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111440733A (en) * | 2020-02-07 | 2020-07-24 | 天津大学 | Recombinant saccharomyces cerevisiae for producing terpineol, construction method and application |
| CN114134059A (en) * | 2021-11-17 | 2022-03-04 | 天津大学 | Recombinant saccharomyces cerevisiae for producing forskolin and construction method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002053747A1 (en) * | 2000-12-28 | 2002-07-11 | Toyota Jidosha Kabushiki Kaisha | Process for producing prenyl alcohol |
| CN107828709A (en) * | 2017-11-09 | 2018-03-23 | 天津大学 | The recombination bacillus coli and its construction method of heterologous synthesis ambrein |
-
2020
- 2020-02-24 CN CN202010113440.3A patent/CN111334522B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002053747A1 (en) * | 2000-12-28 | 2002-07-11 | Toyota Jidosha Kabushiki Kaisha | Process for producing prenyl alcohol |
| CN107828709A (en) * | 2017-11-09 | 2018-03-23 | 天津大学 | The recombination bacillus coli and its construction method of heterologous synthesis ambrein |
Non-Patent Citations (1)
| Title |
|---|
| 刘婷: "异源合成左旋海松酸的酿酒酵母菌株构建", 《硕士电子期刊 》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111440733A (en) * | 2020-02-07 | 2020-07-24 | 天津大学 | Recombinant saccharomyces cerevisiae for producing terpineol, construction method and application |
| CN114134059A (en) * | 2021-11-17 | 2022-03-04 | 天津大学 | Recombinant saccharomyces cerevisiae for producing forskolin and construction method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111334522B (en) | 2023-05-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110438099A (en) | The application of glycosyl transferase and its associated materials in the engineering bacteria that building produces ginsenoside Rb1 and Rg1 | |
| CN109097343B (en) | Steroid 11 beta-hydroxylase in curvularia lunata as well as coding gene and application thereof | |
| CN113684169B (en) | Poly (3-hydroxybutyrate-4-hydroxybutyrate-5-hydroxyvalerate) trimer and microorganism production strain construction thereof | |
| CN112852650B (en) | Saccharomyces cerevisiae engineering bacterium for high yield of santalene and santalol and construction method and application thereof | |
| CN111334522B (en) | Recombinant saccharomyces cerevisiae for producing ambergris alcohol and construction method | |
| CN113755354B (en) | Recombinant saccharomyces cerevisiae for producing gastrodin by utilizing glucose and application thereof | |
| CN114150012B (en) | Recombinant saccharomyces cerevisiae for heterogeneously synthesizing ginsenoside F2 and construction method thereof | |
| CN111205993A (en) | Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof | |
| CN107723252A (en) | Produce the restructuring Yarrowia lipolytica and construction method of valencia orange alkene and nootkatone | |
| CN111675758B (en) | Genetic engineering subunit vaccine for resisting sheep echinococcosis infection | |
| CN114621968A (en) | Tetrahydropyrimidine biosynthesis gene cluster, mutant and method for preparing tetrahydropyrimidine | |
| CN111041041A (en) | Saccharomyces cerevisiae recombinant strain for producing α -lupinene, 8-hydroxy- α -lupinene and zingerone and construction method thereof | |
| CN112175848B (en) | Yeast strain for producing patchouli alcohol and construction method and application thereof | |
| CN112391300B (en) | Application of flavone 3 beta-hydroxylase derived from silybum marianum and coenzyme thereof | |
| CN109136119B (en) | Microorganisms and uses thereof | |
| CN105647958B (en) | Saccharomyces cerevisiae engineering bacterium for producing 2-phenylethyl alcohol and preparation method and application thereof | |
| CN109097342B (en) | Steroid 11 beta-hydroxylase in Absidia coerulea, coding gene and application thereof | |
| CN111690549A (en) | Recombinant yarrowia lipolytica strain for producing protopanoxadiol by using xylose and construction method and application thereof | |
| CN113249240B (en) | Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof | |
| CN113249241B (en) | Construction and application of saccharomyces cerevisiae protease deletion strain | |
| CN115806890A (en) | Genetically engineered bacterium for high yield of 3-fucosyllactose and construction method and application thereof | |
| CN113604442A (en) | Sargassum sterol synthetase and preparation method and application thereof | |
| CN106119137B (en) | Method for improving protein secretion capacity of filamentous fungi | |
| CN112708602B (en) | Dioscorea zingiberensis-derived diosgenin synthesis related protein, coding gene and application | |
| CN111041040A (en) | Recombinant saccharomyces cerevisiae for producing levopimaric diene and levopimaric acid and construction method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |